Leukoerythroblastosis in a Sickle Cell Patient With Pregnancy: An Interesting Peripheral Blood Smear Finding.

The global pandemic of coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has shaken the entire world. The social, health and financial impacts of this pandemic are beyond words. We have learnt a lot about this new disease in a short period of time, but still a long road to go to fully determine its pathogenic effect. The primary target of this virus is angiotensin-converting enzyme 2 (ACE2) receptor, which is prevalent in endothelial cells throughout the body. Immunocompromised patients such as patients with sickle cell disease are more vulnerable to severe respiratory infections, including infection with SARS-CoV-2. In addition, sickle cell disease patients are prone to vaso-occlusive crisis, and theoretically SARS-CoV-2 can worsen the situation as it also can cause endothelial dysfunction and thrombosis. Herein, we are sharing an interesting peripheral blood smear finding of an asymptomatic 31-year-old multigravida pregnant female with a history of sickle cell disease and found to have a positive COVID-19 polymerase chain reaction (PCR) test during her third trimester of pregnancy at a routine clinic visit. Two weeks after the initial positive test, she developed nausea, vomiting, constipation and a pain crisis affecting her extremities while her COVID-19 PCR test was still positive. She was hemodynamically stable, and lab workup revealed chronic anemia, leukocytosis with neutrophilia and lymphopenia. Morphologic examination of the peripheral blood smear showed a marked leukoerythroblastosis: rare myeloblasts, sickle cells, markedly abundant nucleated red blood cells (RBCs), metamyelocytes, and many large and giant platelets were seen. In this context, her previous peripheral blood smears (prior to positive COVID-19 test) did not show leukoerythroblastosis. She was managed conservatively with hydration and pain control and delivered at 36 weeks via cesarean section due to pre-term labor and intrauterine growth retardation. The unusual finding of leukoerythroblastosis in a pregnant sickle cell disease patient with an asymptomatic COVID-19 infection indicates further studies to determine its effect on hematopoietic system and elucidate its clinical significance.

Current advances of endophytes as a platform for production of anti-cancer drug camptothecin.

Camptothecin (CPT), a well-known monoterpenoid indole alkaloid with broad-spectrum anti-cancer activity, is produced from plants and endophytes. In view of the limitations of plants as sources of camptothecin in productivity and efficiency, endophytes serve as the fast growth, high cost-effectiveness, good reproducibility, and feasible genetic manipulation, so they have the potential to meet the huge market demand of the pharmaceutical industry. In this review, we summarized the isolation, identification and fermentation of CPT-producing endophytes, as well as the biosynthesis, extraction and detection of camptothecin from endophytes. Among them, we put emphasis on increasing the production of camptothecin in endophytes through different strategies such as changing the proportion of carbon, nitrogen and phosphate source, adding the precursors, elicitors or adsorbent resin, utilizing co-culture fermentation or fermenter culture. However, cell subculture and metabolic reprogramming affect the expression of camptothecin biosynthetic genes in CPT-producing endophytes, which poses a challenge to the industrial production of camptothecin. Therefore, it will be useful to gain insights through the review of these researches and provide alternative approaches to develop economical, eco-friendly and reliable natural products.

Co-administration of zinc phthalocyanine and quercetin via hybrid nanoparticles for augmented photodynamic therapy.

The photodynamic anticancer activity of a photosensitizer can be further increased by co-administration of a flavonoid. However, this requires that both molecules must be effectively accumulated at the tumor site. Hence, in order to enhance the activity of zinc phthalocyanine (ZnPc, photosensitizer), it was co-encapsulated with quercetin (QC, flavonoid) in lipid polymer hybrid nanoparticles (LPNs) developed using biodegradable & biocompatible materials and prepared using a single-step nanoprecipitation technique. High stability and cellular uptake, sustained release, inherent fluorescence, of ZnPC were observed after encapsulation in the LPNs, which also showed a higher cytotoxic effect in breast carcinoma cells (MCF-7) compared to photodynamic therapy (PDT) alone. In vivo studies in tumor-bearing Sprague Dawley rats demonstrated that the LPNs were able to deliver ZnPc and QC to the tumor site with minimal systemic toxicity and increased antitumor effect. Overall, the photodynamic effect of ZnPc was synergized by QC. This strategy could be highly beneficial for cancer management in the future while nullifying the side effects of chemotherapy.

Liposomal Delivery of Mycophenolic Acid With Quercetin for Improved Breast Cancer Therapy in SD Rats.

The present study explores the influence of mycophenolic acid (MPA) in combination therapy with quercetin (QC) (impeding MPA metabolic rate) delivered using the liposomal nanoparticles (LNPs). Mycophenolic acid liposome nanoparticles (MPA-LNPs) and quercetin liposome nanoparticles (QC-LNPs) were individually prepared and comprehensively characterized. The size of prepared MPA-LNPs and QC-LNPs were found to be 183 ± 13 and 157 ± 09.8, respectively. The in vitro studies revealed the higher cellular uptake and cytotoxicity of combined therapy (MPA-LNPs + QC-LNPs) compared to individual ones. Moreover pharmacokinetics studies in female SD-rat shown higher T 1 / 2 value (1.94 fold) of combined therapy compared to MPA. Furthermore, in vivo anticancer activity in combination of MPA-LNPs and QC-LNPs was also significantly higher related to other treatments groups. The combination therapy of liposomes revealed the new therapeutic approach for the treatment of breast cancer.

In vitro and in vivo anti-inflammatory effects of different extracts from Epigynum auritum through down-regulation of NF-κB and MAPK signaling pathways.

ETHNOPHARMACOLOGICAL RELEVANCE: Epigynum auritum has been historically used as a "dai" or traditional medicine for the treatment of inflammation, swelling and severe pain during injury; these may reduce risk of disease and lead to healthier aging. Apart from this, Epigynum auritum extract was also used in arhritis treatment which is also a type of inflammation. Previous phytochemical studies of E. auritum revealed that steroids are main characteristic components with a number of biological activities (especially immunosuppressive and anti-inflammatory activity) Nevertheless, the underlying mechanism of the E. auritum on inflammatory diseases is still unresolved. AIM OF THE STUDY: This study aimed to comparatively investigate the anti-inflammatory potential of different fractions from the extract of E. auritum (EAE), with their possible active ingredients to reveal the underlying mechanism. MATERIALS AND METHODS: The EAE was fractionated by column chromatography with macroporous resin D101 which yielded six fractions. The potential anti-inflammatory properties of different fractions of EAE were evaluated in in vitro and in vivo model. The lipopolysaccharide (LPS)-induced RAW264.7 macrophages cells were used for in vitro studies however two typical acute inflammation murine models (xylene-induced ear edema and carrageenan-induced paw edema) were used for anti-inflammatory studies. The important molecular mechanisms related to inflammation were also analyzed by ELISA, western blotting and immunofluorescence. UHPLC-MS/MS was used to analyze the chemical composition of 100% EAE fraction. RESULTS: Different EAE fractions (especially the Fr. 100% of MeOH:H2O) significantly reduced the productions of NO, ROS, TNF-α, and IL-6 by LPS-induced RAW264.7 macrophages and increased the expression of IL-10. The expression levels of iNOS and COX-2 enzymes were significantly down-regulated by 100% EAE fraction. Furthermore, 100% EAE fraction inhibited the phosphorylation of the ERK1/2, JNK, and p38 MAPK, and reduced the nuclear translocation of NF-κB which prevents its activation by blocking the phosphorylation and degradation of inhibitor protein of IκBα. In addition two inflammatory animal models; xylene-induced ear edema and carrageenan-stimulated paw edema were also developed with significantly ameliorated inflammatory cytokines. The treatment of these inflammatory models with 100% EAE fraction (Fr. 100%) suppressed the expressions of elevated inflammatory cytokines. Besides the UHPLC-HRMS/MS analysis was also carried out in which the androstane analogues were found to be as a main chemical components. CONCLUSION: Different fractions (especially Fr. 100%) exert inhibitory effect on inflammation by regulating the release of inflammatory mediators through the NF-κB and MAPK signaling pathways. The androstane and its derivatives might be performing an important role in the observed anti-inflammatory activity. Therefore, Fr. 100% of EAE could be applied as a potential drug candidate for the prevention and treatment of inflammatory diseases.

The Anticancer Properties of Tanshinones and the Pharmacological Effects of Their Active Ingredients.

Cancer is a common malignant disease worldwide with an increasing mortality in recent years. Salvia miltiorrhiza, a well-known traditional Chinese medicine, has been used for the treatment of cardiovascular and cerebrovascular diseases for thousands of years. The liposoluble tanshinones in S. miltiorrhiza are important bioactive components and mainly include tanshinone IIA, dihydrodanshinone, tanshinone I, and cryptotanshinone. Previous studies showed that these four tanshinones exhibited distinct inhibitory effects on tumor cells through different molecular mechanisms in vitro and in vivo. The mechanisms mainly include the inhibition of tumor cell growth, metastasis, invasion, and angiogenesis, apoptosis induction, cell autophagy, and antitumor immunity, and so on. In this review, we describe the latest progress on the antitumor functions and mechanisms of these four tanshinones to provide a deeper understanding of the efficacy. In addition, the important role of tumor immunology is also reviewed.

Mycophenolate co-administration with quercetin via lipid-polymer hybrid nanoparticles for enhanced breast cancer management.

Mycophenolic acid (MPA) has promising anticancer properties; however, it has limited clinical applications in vivo due to hydrophobic nature, high first-pass metabolism, lack of targeting, etc. These associated problems could be addressed by developing a suitable delivery vehicle, inhibiting the first-pass metabolism and additive/synergistic pharmacodynamic effect. Thus, MPA loaded highly stable lipid polymer hybrid nanoparticles (LPNs) were developed and investigated with the combination of quercetin (QC), a CYP 450 inhibitor cum anticancer. LPNs of MPA and QC (size; 136 ±â€¯12 and 176 ±â€¯35 nm, respectively) demonstrated higher cellular uptake and cytotoxicity of combination therapy (MPA-LPN + QC-LPN) compared to individual congeners in MCF-7 cells. In vivo pharmacokinetics demonstrated 2.17 fold higher T1/2 value and significantly higher pharmacodynamic activity in case of combination therapy compared to free MPA. In nutshell, the combinatory therapeutic regimen of MPA and QC could be a promising approach in improved breast cancer management.

Facile development of biodegradable polymer-based nanotheranostics: Hydrophobic photosensitizers delivery, fluorescence imaging and photodynamic therapy.

Photodynamic therapy (PDT) is reported to be a promising technique to eradicate various cancers. As most of the photosensitizers (PSs) are hydrophobic in nature, thus, the effective delivery of PSs at the targeted site is the main hurdle associated with PDT. Zinc phthalocyanine and Zinc naphthalocyanine are reported as good PSs, however, highly hydrophobic characteristics restrict their use for clinical applications. To circumvent this limitation here we developed the advanced polymer-based nano-delivery system having polyethylene glycol (PEG) coated polymeric core with ~90% PS encapsulation. The PEG coating was responsible for the stabilization of probe in the physiological environment and storage conditions. The developed theranostic probes showed efficient in vitro fluorescence and singlet oxygen quantum yields upon irradiation with 620-750 nm (30 mW/cm2) light. The clathrin-mediated endocytosis (CME) based mechanism of cellular internalization was evaluated. The fluorescence of treated MCF-7 cells showed the ability of the probes as imaging agents. Moreover, up to 65% cell inhibition showed their cytotoxic efficiency. Further, comparatively higher tumor-accumulation of PSs without significant hepato/nephro-toxicity shown in vivo experimentation using breast tumor-bearing female Sprague Dawley (SD) rats suggested the featured passive targeting ability of preparations and clinically safe to be used. The study explored the exceptional delivery system for hydrophobic PSs with commendable theranostic applications.

Self-Assembled Gold Nanoparticle-Lipid Nanocomposites for On-Demand Delivery, Tumor Accumulation, and Combined Photothermal-Photodynamic Therapy.

In this study, a distinct photoamenable nanoparticle-based drug delivery system was developed for highly efficient targeted on-demand delivery, fluorescence imaging, and therapy by incorporating zinc phthalocyanine (ZnPc) and gold nanoparticles (AuNPs) into liposomes. The hyperthermia, produced by AuNPs under LED light irradiation, enhanced the liquidity of liposomal membrane and promoted the instantaneous release of ZnPc from the carriers realizing the concept of on-demand release. In addition, the local hyperthermia also resulted in thermal damage of cancer cells along with photodynamic effect and achieved a synergetic effect of photodynamic and photothermal therapy. The developed probes showed a high breast cancer carcinoma cells (MCF-7 cell line) inhibition up to 86.7% under red light irradiation. Further, in vivo experiments suggested the high tumor accumulation as well as the antitumor effect in breast tumor-bearing female Sprague-Dawley (SD) rats. The outcomes demonstrate the capability of these probes as a novel drug delivery system to codeliver therapeutic agents with photothermal agents and will have an enormous potential for future diagnosis and therapy.

Timing of Onset of Adverse Cutaneous Reactions Associated With Programmed Cell Death Protein 1 Inhibitor Therapy.

Importance: An increasing number of cutaneous adverse reactions resulting from use of programmed cell death protein 1 (PD-1) inhibitors have been described, but with relatively little focus to date on the timing of these reactions. Objective: To determine the timing of cutaneous drug reactions after initiation of PD-1 inhibitor therapy. Design, Setting, and Participants: This retrospective observational study included patients referred to an academic dermatology clinic by an oncologist from January 1, 2014, through February 28, 2018, with at least 1 skin biopsy specimen of a skin reaction associated with PD-1 inhibitor use. Participants were included if they had a biopsy-proven cutaneous reaction in response to a PD-1 inhibitor used alone or in combination with ipilimumab. Exposures: All patients included in this study received pembrolizumab, nivolumab, or nivolumab with ipilimumab as immunotherapy for cancer. Main Outcomes and Measures: The main outcome measure was time to onset of biopsy-proven cutaneous reactions that occurred during or after use of pembrolizumab or nivolumab. Results: A total of 17 patients (12 men, 5 women; mean [SD] age, 68.6 [11.1] years) were identified who presented with cutaneous adverse reactions associated with PD-1 inhibitor therapy; these reactions included lichenoid dermatitis, bullous pemphigoid, erythema multiforme, eczema, lupus, and sarcoidosis. Twelve patients presented with reactions at least 3 months after beginning pembrolizumab or nivolumab therapy. The skin reactions presented a median (range) of 4.2 months (0.5-38.0 months) after drug initiation. In 5 cases, the cutaneous adverse reactions attributed to the PD-1 inhibitor therapy developed after the drug therapy was terminated. Conclusions and Relevance: Diverse cutaneous adverse reactions secondary to PD-1 inhibitor use may present with delayed onsets and even after discontinuation of therapy. Dermatologists should be aware of the potential for delayed presentations of cutaneous adverse reactions.

Cutaneous lymphangioma circumscriptum: frog spawn on the skin.

Lymphangiomas are congenital malformations of the lymphatic system that may involve the skin, subcutaneous tissues, and intestines. They account for 4% of all vascular tumors, but comprise 25% of benign vascular growths in children. They are hamartomatous in nature and may be grouped into cutaneous lymphangioma circumscriptum (CLC), cavernous lymphangiomas, and cystic hygromas. CLC appears localized to the dermis, although frequently extends deeper and laterally. It is important to distinguish CLC, a potentially recurrent disease, from an unusual type of metastatic carcinoma of the skin called carcinoma telangiectoides.

Inducible cutaneous inflammation reveals a protumorigenic role for keratinocyte CXCR2 in skin carcinogenesis.

Transgenic mice that overexpress PKCalpha in the epidermis (K5-PKCalpha mice) exhibit acute CXCR2-mediated intraepidermal neutrophilic inflammation and a strong epidermal hyperplasia in response to application of 12-O-tetradecanoylphorbol-13-acetate (TPA). We now show that hyperplasia is independent of infiltrating neutrophils. Furthermore, when K5-PKCalpha mice were initiated with 7,12-dimethylbenz(a)anthracene (DMBA) and promoted with a low dose of TPA, 58% of K5-PKCalpha mice developed skin papillomas that progressed to carcinoma, whereas wild-type mice did not develop tumors. We confirmed that CXCR2 is expressed by keratinocytes and showed that transformation by oncogenic ras (a hallmark of DMBA initiation) or TPA exposure induced all CXCR2 ligands. Ras induction of CXCR2 ligands was mediated by autocrine activation of epidermal growth factor receptor and nuclear factor-kappaB, and potentiated by PKCalpha. Oncogenic ras also induced CXCR2 ligands in keratinocytes genetically ablated for CXCR2. However, ras transformed CXCR2 null keratinocytes formed only small skin tumors in orthotopic skin grafts to CXCR2 intact hosts, whereas transformed wild-type keratinocytes produced large tumors. In vitro, CXCR2 was essential for CXCR2 ligand-stimulated migration of ras-transformed keratinocytes and for ligand activation of the extracellular signal-regulated kinase (ERK) and Akt pathways. Both migration and activation of ERK and Akt were restored by CXCR2 reconstitution of CXCR2 null keratinocytes. Thus, activation of CXCR2 on ras-transformed keratinocytes has both promigratory and protumorigenic functions. The up-regulation of CXCR2 ligands after initiation by oncogenic ras and promotion with TPA in the mouse skin model provides a mechanism to stimulate migration by both autocrine and paracrine pathways and contribute to tumor development.

Zosteriform lymphangioma circumscriptum.

Lymphangioma circumscriptum (LC) is a form of lymphangioma involving skin and subcutaneous tissue. It is evident as translucent vesicles of varying size, though commonly 2 to 4 mm, and of a pink, red, or black hue. It is localized to the dermis, frequently extending deeply and laterally. LC may resemble other entities, such as metastatic carcinoma of the skin, lymphangiectasis, or herpes zoster. We report an unusual verruciform, zosteriform form of LC.

Subungual melanoma: a deceptive disorder.

Subungual melanoma is an uncommon form of acral melanoma that arises within the nail bed. The incidence for acral melanomas is similar worldwide, but the proportion is higher in dark-skinned individuals. The subungual form represents about 2% of cutaneous non-sun induced melanomas in the western world, and up to 75% in Africans, 10% in Japanese, and 25% in the Chinese of Hong Kong. Up to 33% of subungual melanomas are amelanotic. Black pigmentation of the adjacent nail fold, termed Hutchinson's sign, may be a diagnostic clue. Non-specific features and symptoms along with a high incidence of amelanosis often lead to delayed diagnosis, disease progression, and a poor prognosis with challenging treatment options.

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain.

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.

The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex.

Repression of poly(A)-binding protein (PABP) mRNA translation involves the binding of PABP to the adenine-rich autoregulatory sequence (ARS) in the 5'-untranslated region of its own mRNA. In this report, we show that the ARS forms a complex in vitro with PABP, and two additional polypeptides of 63 and 105 kDa. The 63 and 105 kDa polypeptides were identified, as IMP1, an ortholog of chicken zip-code binding polypeptide, and UNR, a PABP binding polypeptide, respectively, by mass spectrometry of the ARS RNA affinity purified samples. Using a modified ribonucleoprotein (RNP) immunoprecipitation procedure we further show that indeed, both IMP1 and UNR bind to the ARS containing reporter RNA in vivo. Although both IMP1 and UNR could bind independently to the ARS RNA in vitro, their RNA-binding ability was stimulated by PABP. Mutational analyses of the ARS show that the presence of four of the six oligo(A) regions of the ARS was sufficient to repress translation and the length of the conserved pyrimidine spacers between the oligo(A) sequences was important for ARS function. The ability of mutant ARS RNAs to form the PABP, IMP1 and UNR containing RNP complex correlates well with the translational repressor activity of the ARS. There is also a direct relationship between the length of the poly(A) RNAs and their ability to form a trimeric complex with PABP, and to repress mRNA translation. UV crosslinking studies suggest that the ARS is less efficient than a poly(A) RNA of similar length, to bind to PABP. We show here that the ARS cannot efficiently form a trimeric complex with PABP; therefore, additional interactions with IMP1 and UNR to form a heteromeric RNP complex may be required for maximal repression of PABP mRNA translation under physiological conditions.

Perinuclear localization of slow troponin C m RNA in muscle cells is controlled by a cis-element located at its 3' untranslated region.

The process of mRNA localization within a specific cytoplasmic region is an integral aspect of the regulation of gene expression. Furthermore, colocalization of mRNAs and their respective translation products may facilitate the proper assembly of multi-subunit complexes like the thick and thin filaments of muscle. This postulate was tested by investigating the cytoplasmic localization of three mRNAs-the alpha-actin, slow troponin C (sTnC), and slow troponin I (sTnI), which encode different poly-peptide partners of the thin filament. Using in situ hybridization we showed that all three thin filament mRNAs are localized in the perinuclear cytoplasm of cultured C2C12 muscle cells. Their localization differs from that of the nonmuscle beta-actin mRNA, which is localized in the peripheral region of both proliferating nondifferentiated myoblasts and the differentiated myocytes. Analysis of the localization signal of the sTnC mRNA showed that a 40-nucleotide-long region of the sTnC mRNA 3' UTR is sufficient to confer the perinuclear localization on a heterologous reporter beta-Gal mRNA. This localization signal showed tissue specificity and worked only in the differentiated myocytes, but not in the proliferating myoblasts or in HeLa cells. The predicted secondary structure of the localization signal suggests the presence of multiple stem and loop structures in this region of the 3' UTR. Mutations within the stem region of the localization signal, which abolish the base pairing in this region, significantly reduced its perinuclear mRNA localization activity. Using UV-induced photo-cross-linking of RNA and proteins we found that a myotube-specific 42-kDa polypeptide binds to the localization signal.