Effects of gut microbiome and obesity on the development, progression and prevention of cancer (Review).

Cancer is one of the leading causes of death worldwide and it is estimated that the mortality rate of cancer will increase in the coming years. The etiology of the development and progression of cancer is multifactorial. Insights have been gained on the association between the human microbiome and tumor cell malignancy. A number of commensal microbe species are present in the human gut. They serve pivotal roles in maintaining several health and disease conditions, such as inflammatory bowel disease, irritable bowel syndrome, obesity and diabetes. Known major factors involved in cancer development include age, hormone levels, alcohol consumption, diet, being overweight, obesity, and infections, regardless of the type of cancer. Therefore, the present review aims to discuss the relationship between the gut microbiome and obesity­associated malignancies, including colorectal, gastric and liver cancer. Obesity has been reported to contribute to the development of numerous types of cancer primarily caused by high fatty food intake. In addition, obesity­associated microbiome alterations can lead to cancer and its progression. Dysbiosis of the gut microbiota can alter the metabolite profile, whilst increasing the levels of toxins, such as Bacteroides fragilis toxin and colibactin and cytolethal distending toxin, which are responsible for oncogenesis. The present review provides insights into the impact of gut microbiome dysbiosis on the progression of different types of cancers associated with obesity. It also discusses possible strategies for preserving a healthy gut microbiome. Different pre­clinical and clinical models are available for studying cancer development downstream of gut microbiome dysbiosis. Furthermore, the role of metabolites or drugs employed in colorectal, gastric and liver cancer therapy would be discussed.

Mindin (SPON2) Is Essential for Cutaneous Fibrogenesis in a Mouse Model of Systemic Sclerosis.

Systemic sclerosis is a fibrotic disease that initiates in the skin and progresses to internal organs, leading to a poor prognosis. Unraveling the etiology of a chronic, multifactorial disease such as systemic sclerosis has been aided by various animal models that recapitulate certain aspects of the human pathology. We found that the transcription factor SNAI1 is overexpressed in the epidermis of patients with systemic sclerosis, and a transgenic mouse recapitulating this expression pattern is sufficient to induce many clinical features of the human disease. Using this mouse model as a discovery platform, we have uncovered a critical role for the matricellular protein Mindin (SPON2) in fibrogenesis. Mindin is produced by SNAI1 transgenic skin keratinocytes and aids fibrogenesis by inducing early inflammatory cytokine production and collagen secretion in resident dermal fibroblasts. Given the dispensability of Mindin in normal tissue physiology, targeting this protein holds promise as an effective therapy for fibrosis.

Drug repurposing-an emerging strategy in cancer therapeutics.

Cancer is a complex disease affecting millions of people around the world. Despite advances in surgical and radiation therapy, chemotherapy continues to be an important therapeutic option for the treatment of cancer. The current treatment is expensive and has several side effects. Also, over time, cancer cells develop resistance to chemotherapy, due to which there is a demand for new drugs. Drug repurposing is a novel approach that focuses on finding new applications for the old clinically approved drugs. Current advances in the high-dimensional multiomics landscape, especially proteomics, genomics, and computational omics-data analysis, have facilitated drug repurposing. The drug repurposing approach provides cheaper, effective, and safe drugs with fewer side effects and fastens the process of drug development. The review further delineates each repurposed drug's original indication and mechanism of action in cancer. Along with this, the article also provides insight upon artificial intelligence and its application in drug repurposing. Clinical trials are vital for determining medication safety and effectiveness, and hence the clinical studies for each repurposed medicine in cancer, including their stages, status, and National Clinical Trial (NCT) identification, are reported in this review article. Various emerging evidences imply that repurposing drugs is critical for the faster and more affordable discovery of anti-cancerous drugs, and the advent of artificial intelligence-based computational tools can accelerate the translational cancer-targeting pipeline.

Phytoremediation for Co-contaminated Soils of Cadmium and Polychlorinated Biphenyls Using the Ornamental Plant Tagetes patula L.

In this study, pot-culture experiments were conducted to investigate the single effect of Cd, PCBs, and the combined effect of Cd-PCBs with Tagetes patula L. The study highlights that the minimum concentration of PCBs (100 µg kg-1) could enable the growth of the plant with an increase in biomass by 27.76% when compared with the control. In all the experiments performed, the Cd concentrations over the surface parts were found to be above 100 mg kg-1. Significant positive correlations were observed between the Cd and PCBs concentrations accumulated in tissues of the soil and plants (p < 0.05). T. patula exhibited high tolerance to Cd and PCBs, and the plant promoted the removal rate of PCBs. The removal rates of PCB18 and PCB28 were up to 42.72 and 42.29%, respectively. The study highlights the potential and suitability of T. patula for phytoremediation of Cd and PCBs in contaminated soils.

Advances in targeting the WNT/ß-catenin signaling pathway in cancer.

WNT/ß-catenin signaling orchestrates various physiological processes, including embryonic development, growth, tissue homeostasis, and regeneration. Abnormal WNT/ß-catenin signaling is associated with various cancers and its inhibition has shown effective antitumor responses. In this review, we discuss the pathway, potential targets for the development of WNT/ß-catenin inhibitors, available inhibitors, and their specific molecular interactions with the target proteins. We also discuss inhibitors that are in clinical trials and describe potential new avenues for therapeutically targeting the WNT/ß-catenin pathway. Furthermore, we introduce emerging strategies, including artificial intelligence (AI)-assisted tools and technology-based actionable approaches, to translate WNT/ß-catenin inhibitors to the clinic for cancer therapy.

Ribosomal protein S6 kinase beta-1 gene variants cause hypertrophic cardiomyopathy.

BACKGROUND: Hypertrophic cardiomyopathy (HCM) is a genetic heart muscle disease with preserved or increased ejection fraction in the absence of secondary causes. Mutations in the sarcomeric protein-encoding genes predominantly cause HCM. However, relatively little is known about the genetic impact of signalling proteins on HCM. METHODS AND RESULTS: Here, using exome and targeted sequencing methods, we analysed two independent cohorts comprising 401 Indian patients with HCM and 3521 Indian controls. We identified novel variants in ribosomal protein S6 kinase beta-1 (RPS6KB1 or S6K1) gene in two unrelated Indian families as a potential candidate gene for HCM. The two unrelated HCM families had the same heterozygous missense S6K1 variant (p.G47W). In a replication association study, we identified two S6K1 heterozygotes variants (p.Q49K and p.Y62H) in the UK Biobank cardiomyopathy cohort (n=190) compared with matched controls (n=16 479). These variants are neither detected in region-specific controls nor in the human population genome data. Additionally, we observed an S6K1 variant (p.P445S) in an Arab patient with HCM. Functional consequences were evaluated using representative S6K1 mutated proteins compared with wild type in cellular models. The mutated proteins activated the S6K1 and hyperphosphorylated the rpS6 and ERK1/2 signalling cascades, suggesting a gain-of-function effect. CONCLUSIONS: Our study demonstrates for the first time that the variants in the S6K1 gene are associated with HCM, and early detection of the S6K1 variant carriers can help to identify family members at risk and subsequent preventive measures. Further screening in patients with HCM with different ethnic populations will establish the specificity and frequency of S6K1 gene variants.

A mathematical formulation for volume expansions in contouring for radiotherapy planning.

CONTEXT: This research describe the characteristic volume expansion of a moving target as a function of differential margins. AIM: We aimed to ascertain the volume change after giving margin for clinical and set up uncertainties including generating internal target volume (ITV) for moving target. MATERIALS AND METHODS: Settings and Design - Spheres of diameter (0.5-10 cm) with differential expansion of 1-15 mm were generated using a mathematical formula. Moving targets of radius 1-5 cm were generated, and the resultant volume envelopes with incremental motion from 1 to 20 mm were obtained. All relative volume change results were fitted with mathematical functions to obtain a generalized mathematical formula. STATISTICAL ANALYSIS USED: None. RESULTS: The percentage increase in volume (%ΔVp) was much more pronounced for smaller radius target. For moving target with relatively smaller radius, %ΔVp is predominant over the absolute volume change and vice versa in case of larger radius. Mathematical formulae were obtained for %ΔVp as a function of radius and expansion and for %ΔVp in ITV volume as a function of radius and tumor movement. CONCLUSIONS: This study provides an idea of volume change for various expansions for various size targets and/or moving target for different range of movements. It establishes a correlation of these volume changes with the changing target size and range of movements. Finally, a clinically useful mathematical formulation on volume expansion has been developed for rapid understanding of the consequence of volume expansion.

Emergence of Cardiac Glycosides as Potential Drugs: Current and Future Scope for Cancer Therapeutics.

Cardiac glycosides are natural sterols and constitute a group of secondary metabolites isolated from plants and animals. These cardiotonic agents are well recognized and accepted in the treatment of various cardiac diseases as they can increase the rate of cardiac contractions by acting on the cellular sodium potassium ATPase pump. However, a growing number of recent efforts were focused on exploring the antitumor and antiviral potential of these compounds. Several reports suggest their antitumor properties and hence, today cardiac glycosides (CG) represent the most diversified naturally derived compounds strongly recommended for the treatment of various cancers. Mutated or dysregulated transcription factors have also gained prominence as potential therapeutic targets that can be selectively targeted. Thus, we have explored the recent advances in CGs mediated cancer scope and have considered various signaling pathways, molecular aberration, transcription factors (TFs), and oncogenic genes to highlight potential therapeutic targets in cancer management.

Finding of novel telomeric repeats and their distribution in the human genome.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Comparing SUV values of images at PET-CT console and the RT planning console using identical dataset of a study phantom.

PURPOSE: The use of positron emission tomography (PET) for radiotherapy planning purposes has become increasingly important in the last few years.In the current study, we compared the SUV values of images at the PET CT console to the SUV values obtained at the RT planning workstation. MATERIALS AND METHODS: The PET-CT cylindrical body phantom was filled with a uniform 18F solution of 5.3. ± 0.27 kBq/mL radioactivity concentration. PET-CT scans were performed on a16 slice Time of Flight system. On a single day, the three consecutive scans were done at three time points 15 minutes apart to generate time points image data sets titled T1, T2, and T3. SUV calculations were performed by drawing region of interest. (ROI) encompassing the entire hot spot on each slice on the PET-CT console and the iPlan workstation. Minimum SUV, Maximum SUV and the Mean SUV were recorded. Statistical analysis was done using the SPSS software. (SPSS Inc.) (Version 18). RESULTS: The absolute difference in average max SUV values i.e. Max (PET-CT) - Max (iPlan) for the time points T1, T2 and T3 were -0.168 (SD 0.175), -0.172 (SD 0.172) and -0.178 (SD 0.169). The difference in the minimum SUV values were -0.513 (SD 0.428), -0.311 (SD 0.358) and -0.303 (SD 0.322), respectively. Finally, the difference in the mean SUV values were -0.107 (SD 0.040), -0.096 (SD 0.067) and -0.072 (SD 0.044), respectively. CONCLUSIONS: Our study found out that the average difference in the two systems for maximum SUV values was < 0.2 absolute units.Our study suggests good reproducibility of SUV between the two systems. The relevance of these findings would be of seminal importance in current and future SUV-based PET-CT-based contouring in treatment planning systems.

Association of cytochrome P450 2C9 polymorphism with locally advanced head and neck squamous cell carcinoma and response to concurrent cisplatin-based radical chemoradiation.

AIMS: The aim of the present study is to investigate the association between polymorphism of cytochrome P450 2C9 (CYP2C9) enzyme with head and neck squamous cell carcinoma (HNSCC) and response in patients receiving cisplatin-based radical chemoradiation (CT-RT). MATERIALS AND METHODS: Four hundred and sixty patients suffering from locally advanced HNSCC and an equal number of healthy controls were genotyped for CYP2C9*2 and CYP2C9*013, leading to poor metabolizers (PMs) by polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP). Each case was assessed thoroughly for treatment response as per the World Health Organization (WHO) criteria. RESULTS AND ANALYSIS: The frequency of heterozygous genotypes of both CYP2C9*2 (27.8%) and CYP2C9*3 (25%) were found to be significantly higher in the HNSCC cases as compared to the healthy controls. Tobacco intake in the form of chewing or smoking and alcohol intake resulted in several folds increase in the risk to HNSCC in the cases carrying variant genotypes of CYP2C9*2 or CYP2C9*013. Further, majority of the cases assessed for response (n = 436) carrying variant alleles of CYP2C9*2 (69.6%) or CYP2C9*3 (65.2%) were found to respond poorly to cisplatin-based radical CT-RT. CONCLUSION: The data suggests a significant association of the CYP2C9 polymorphism with HNSCC and treatment outcome underlining the importance of pretherapeutic genotyping in determining the treatment protocol.

Primary granulocytic sarcoma of lip - A rare extramedullary presentation of myeloid leukemia.

A sixty year old male presented with a swelling in the upper lip. On cytopathology, the patient was diagnosed as a case of granulocytic sarcoma. His bone marrow examination was unremarkable. Patient was then treated by radiotherapy alone 30 Gray in 15 fractions and achieved complete response. Eighteen months after follow up the patient is absolutely normal. To our knowledge this is the first ever reported case of granulocytic sarcoma of lip.

Concurrent chemoradiation versus radiotherapy alone in cervical carcinoma: A randomized phase III trial.

AIM: Chemo-radiotherapy (CRT) is the standard of care for treating almost all cervical carcinoma patients on the basis of the National Cancer Institute (NCI) alert. The disease burden in developing countries is more advanced with poor general condition than in patients in the trials prompting the NCI alert. Therefore, practicing CRT as standard of care should be tested in these patients. METHODS: A randomized controlled trial was conducted comparing radiotherapy (RT) alone with CRT (cisplatin 40 mg/m(2) weekly × 5) in patients with localized stage Ib to IVa cervical carcinoma between September 2006 and December 2008. External beam RT was delivered using a telecobalt unit. This was followed by 12-18 Gy of brachytherapy. RESULTS: In total, 305 patients were recruited: RT alone (150) and CRT (155). The median follow up was 34 months. Locoregional relapse-free survival (LRFS) at 2 years was 55 and 54% for the RT and CRT group, respectively, with a median LRFS time of 27 and 30 months for the RT and CRT group, respectively, (P = 0.624). Overall survival (OS) at 2 years was 58 and 60%, with a median OS of 31 and 34 months for the RT and CRT group, respectively; (P = 0.9). The toxicity profile, both acute and late, were comparable in both groups; CONCLUSION: No improvement in outcome was seen with addition of cisplatin. In the Indian subcontinent where patients present at late stages with poor general condition and limited access to good supportive care, RT alone still remains a valid option.

Unusual nail pigmentation following cyclophosphamide-containing chemotherapy regimen.

Cyclophosphamide therapy may rarely cause pigmentation of the nails which is of different patterns. We report a patient who developed pigmentation of nails after six cycles of cyclophosphamide, methotrexate, and 5-flourouracil chemotherapy, each repeated after 28 days for breast cancer. The patient developed nail pigmentation that started proximally and spread distally and involved all the nails of both hands and feet except the second and third toenails of right foot. Using Naranjo ADR Probability Scale, the case revealed a "probable" association with cyclophosphamide.