RESUMO
Alzheimer's disease (AD) is a chronic, complex neurodegenerative disorder mainly characterized by the irreversible loss of memory and cognitive functions. Different hypotheses have been proposed thus far to explain the etiology of this devastating disorder, including those centered on the Amyloid-ß (Aß) peptide aggregation, Tau hyperphosphorylation, neuroinflammation and oxidative stress. Nonetheless, the therapeutic strategies conceived thus far to treat AD neurodegeneration have proven unsuccessful, probably due to the use of single-target drugs unable to arrest the progressive deterioration of brain functions. For this reason, the theoretical description of the AD etiology has recently switched from over-emphasizing a single deleterious process to considering AD neurodegeneration as the result of different pathogenic mechanisms and their interplay. Moreover, much relevance has recently been conferred to several comorbidities inducing insulin resistance and brain energy hypometabolism, including diabetes and obesity. As consequence, much interest is currently accorded in AD treatment to a multi-target approach interfering with different pathways at the same time, and to life-style interventions aimed at preventing the modifiable risk-factors strictly associated with aging. In this context, phytochemical compounds are emerging as an enormous source to draw on in the search for multi-target agents completing or assisting the traditional pharmacological medicine. Intriguingly, many plant-derived compounds have proven their efficacy in counteracting several pathogenic processes such as the Aß aggregation, neuroinflammation, oxidative stress and insulin resistance. Many strategies have also been conceived to overcome the limitations of some promising phytochemicals related to their poor pharmacokinetic profiles, including nanotechnology and synthetic routes. Considering the emerging therapeutic potential of natural medicine, the aim of the present review is therefore to highlight the most promising phytochemical compounds belonging to two major classes, polyphenols and monoterpenes, and to report the main findings about their mechanisms of action relating to the AD pathogenesis.
RESUMO
Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
Assuntos
Quadruplex G , Ácidos Nucleicos , DNA/química , Genes myc , Glucosídeos/farmacologia , Simulação de Acoplamento Molecular , Compostos Fitoquímicos , Proteínas Proto-Oncogênicas c-myc/metabolismo , Análise Espectral , EstilbenosRESUMO
Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2â³S,3â³R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.
Assuntos
Cálcio/metabolismo , ADP-Ribose Cíclica/análogos & derivados , ADP-Ribose Cíclica/farmacologia , Neurônios/efeitos dos fármacos , Animais , Células Cultivadas , Neurônios/metabolismo , Ratos , Ratos WistarRESUMO
Alzheimer's disease (AD) is a neurodegenerative disorder leading to cognitive deficits and cognitive decline. Since no cure or preventing therapy is currently available to counteract AD, natural-derived compounds are investigated to find new potential neuroprotective agents for its treatment. In the present study, we tested the neuroprotective effect of lavender and coriander essential oils (EOs) and their main active constituent linalool, against the neurotoxicity elicited by Aß1-42 oligomers, a key molecular factor in the neurodegeneration of AD. Importantly, our findings on neuronally differentiated PC12 cells exposed to Aß1-42 oligomers are in accordance with previous in vivo studies reporting the neuroprotective potential of lavender and coriander EOs and linalool. We found that lavender and coriander EOs at the concentration of 10 µg/mL as well as linalool at the same concentration were able to improve viability and to reduce nuclear morphological abnormalities in cells treated with Aß1-42 oligomers for 24 hours. Lavender and coriander EOs and linalool also showed to counteract the increase of intracellular reactive oxygen species production and the activation of the pro-apoptotic enzyme caspase-3 induced by Aß1-42 oligomers. Our findings provide further evidence that these EOs and their main constituent linalool could be natural agents of therapeutic interest against Aß1-42 -induced neurotoxicity.
Assuntos
Peptídeos beta-Amiloides/toxicidade , Coriandrum/química , Lavandula/química , Fármacos Neuroprotetores/farmacologia , Óleos Voláteis/farmacologia , Fragmentos de Peptídeos/toxicidade , Monoterpenos Acíclicos/farmacologia , Doença de Alzheimer , Animais , Transtornos Cognitivos/induzido quimicamente , Disfunção Cognitiva , Células PC12 , Óleos de Plantas/farmacologia , Ratos , Espécies Reativas de Oxigênio/metabolismoRESUMO
Herein, we reported on the synthesis of cpIPP, which is a new structurally-reduced analogue of cyclic ADP-ribose (cADPR), a potent Ca2+-releasing secondary messenger that was firstly isolated from sea urchin eggs extracts. To obtain cpIPP the "northern" ribose of cADPR was replaced by a pentyl chain and the pyrophosphate moiety by a phophono-phosphate anhydride. The effect of the presence of the new phosphono-phosphate bridge on the intracellular Ca2+ release induced by cpIPP was assessed in PC12 neuronal cells in comparison with the effect of the pyrophosphate bridge of the structurally related cyclic N1-butylinosine diphosphate analogue (cbIDP), which was previously synthesized in our laboratories, and with that of the linear precursor of cpIPP, which, unexpectedly, revealed to be the only one provided with Ca2+ release properties.