RESUMO
G-quadruplexes are emerging targets in cancer research and understanding how diagnostic probes bind to DNA G-quadruplexes in solution is critical to the development of new molecular tools. In this study the binding of an enantiopure NIR emitting [Os(TAP)2 (dppz)]2+ complex to different G-quadruplex structures formed by human telomer (hTel) and cMYC sequences in solution is reported. The combination of NMR and time-resolved infrared spectroscopic techniques reveals the sensitivity of the emission response to subtle changes in the binding environment of the complex. Similar behaviour is also observed for the related complex [Os(TAP)2 (dppp2)]2+ upon quadruplex binding.
Assuntos
Quadruplex G , Osmio , Humanos , DNA/química , Espectroscopia de Ressonância Magnética/métodos , Imageamento por Ressonância MagnéticaRESUMO
It is well established that plant thylakoid membranes (TMs), in addition to a bilayer, contain two isotropic lipid phases and an inverted hexagonal (HII) phase. To elucidate the origin of non-bilayer lipid phases, we recorded the 31P-NMR spectra of isolated spinach plastoglobuli and TMs and tested their susceptibilities to lipases and proteases; the structural and functional characteristics of TMs were monitored using biophysical techniques and CN-PAGE. Phospholipase-A1 gradually destroyed all 31P-NMR-detectable lipid phases of isolated TMs, but the weak signal of isolated plastoglobuli was not affected. Parallel with the destabilization of their lamellar phase, TMs lost their impermeability; other effects, mainly on Photosystem-II, lagged behind the destruction of the original phases. Wheat-germ lipase selectively eliminated the isotropic phases but exerted little or no effect on the structural and functional parameters of TMs-indicating that the isotropic phases are located outside the protein-rich regions and might be involved in membrane fusion. Trypsin and Proteinase K selectively suppressed the HII phase-suggesting that a large fraction of TM lipids encapsulate stroma-side proteins or polypeptides. We conclude that-in line with the Dynamic Exchange Model-the non-bilayer lipid phases of TMs are found in subdomains separated from but interconnected with the bilayer accommodating the main components of the photosynthetic machinery.
Assuntos
Bicamadas Lipídicas , Tilacoides , Lipase/metabolismo , Bicamadas Lipídicas/metabolismo , Espectroscopia de Ressonância Magnética , Peptídeo Hidrolases/metabolismo , Tilacoides/metabolismoRESUMO
Glasdegib is a recently approved drug for the treatment of acute myeloid leukemia. It is formulated and marketed in monomaleate salt form. In our investigation, we were able to prepare a glasdegib dimaleate form, which could, in theory, exist in double-salt form or as a mixture of salt and co-crystal species. Therefore, the obtained crystals of glasdegib dimaleate were characterized via 15N ssNMR and single-crystal X-ray diffraction, which revealed that the obtained glasdegib dimaleate exists in double-salt form. This is a surprising finding based on the pKa values for glasdegib and maleic acid. Furthermore, we fully characterized the new dimaleate form using thermal analyses (DSC and TGA) and spectroscopy (IR and Raman). Finally, the physicochemical properties, such as solubility and chemical stability, of both forms were determined and compared.
RESUMO
Human telomeric G-quadruplex DNA structures are attractive anticancer drug targets, but the target's polymorphism complicates the drug design: different ligands prefer different folds, and very few complexes have been solved at high resolution. Here we report that Phen-DC3 , one of the most prominent G-quadruplex ligands in terms of high binding affinity and selectivity, causes dTAGGG(TTAGGG)3 to completely change its fold in KCl solution from a hybrid-1 to an antiparallel chair-type structure, wherein the ligand intercalates between a two-quartet unit and a pseudo-quartet, thereby ejecting one potassium ion. This unprecedented high-resolution NMR structure shows for the first time a true ligand intercalation into an intramolecular G-quadruplex.
Assuntos
Antineoplásicos , Quadruplex G , DNA/química , Humanos , Ligantes , Potássio/química , TelômeroRESUMO
HIV-1 integrated long terminal repeat (LTR) promoter activity is modulated by folding of its G-rich region into non-canonical nucleic acids structures, such as G-quadruplexes (G4s), and their interaction with cellular proteins. Here, by a combined pull-down/mass spectrometry/Western-blot approach, we identified the fused in liposarcoma (FUS) protein and found it to preferentially bind and stabilize the least stable and bulged LTR G4, especially in the cell environment. The outcome of this interaction is the down-regulation of viral transcription, as assessed in a reporter assay with LTR G4 mutants in FUS-silencing conditions. These data indicate that the complexity and dynamics of HIV-1 LTR G4s are much greater than previously envisaged. The G-rich LTR region, with its diverse G4 landscape and multiple cell protein interactions, stands out as prime sensing center for the fine regulation of viral transcription. This region thus represents a rational antiviral target for inhibiting both the actively transcribing and latent viruses.
Assuntos
Quadruplex G , Repetição Terminal Longa de HIV , HIV-1 , HIV-1/genética , Humanos , Regiões Promotoras Genéticas , Proteína FUS de Ligação a RNARESUMO
Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.
Assuntos
Quadruplex GRESUMO
Several sequences forming G-quadruplex are highly conserved in regulatory regions of genomes of different organisms and affect various biological processes like gene expression. Diverse G-quadruplex properties can be modulated via their interaction with small polyaromatic molecules such as pyrene. To investigate how pyrene interacts with G-rich DNAs, we incorporated deoxyuridine nucleotide(s) with a covalently attached pyrene moiety (Upy) into a model system that forms parallel G-quadruplex structures. We individually substituted terminal positions and positions in the pentaloop of the c-kit2 sequence originating from the KIT proto-oncogene with Upy and performed a detailed NMR structural study accompanied with molecular dynamic simulations. Our results showed that incorporation into the pentaloop leads to structural polymorphism and in some cases also thermal destabilization. In contrast, terminal positions were found to cause a substantial thermodynamic stabilization while preserving topology of the parent c-kit2 G-quadruplex. Thermodynamic stabilization results from π-π stacking between the polyaromatic core of the pyrene moiety and guanine nucleotides of outer G-quartets. Thanks to the prevalent overall conformation, our structures mimic the G-quadruplex found in human KIT proto-oncogene and could potentially have antiproliferative effects on cancer cells.
Assuntos
Quadruplex G , Proteínas Proto-Oncogênicas c-kit/genética , Desoxiuridina/química , Humanos , Modelos Moleculares , Ressonância Magnética Nuclear Biomolecular , Regiões Promotoras Genéticas , Proto-Oncogene Mas , Pirenos/química , TermodinâmicaRESUMO
We report on the design, synthesis, and biological evaluation of a series of nucleotide-binding oligomerization-domain-containing protein 2 (NOD2) desmuramylpeptide agonists with improved in vitro and in vivo adjuvant properties. We identified two promising compounds: 68, a potent nanomolar in vitro NOD2 agonist, and the more lipophilic 75, which shows superior adjuvant activity in vivo. Both compounds had immunostimulatory effects on peripheral blood mononuclear cells at the protein and transcriptional levels, and augmented dendritic-cell-mediated activation of T cells, while 75 additionally enhanced the cytotoxic activity of peripheral blood mononuclear cells against malignant cells. The C18 lipophilic tail of 75 is identified as a pivotal structural element that confers in vivo adjuvant activity in conjunction with a liposomal delivery system. Accordingly, liposome-encapsulated 75 showed promising adjuvant activity in mice, surpassing that of muramyl dipeptide, while achieving a more balanced Th1/Th2 immune response, thus highlighting its potential as a vaccine adjuvant.
Assuntos
Acetilmuramil-Alanil-Isoglutamina/química , Adjuvantes Imunológicos/química , Proteína Adaptadora de Sinalização NOD2/agonistas , Acetilmuramil-Alanil-Isoglutamina/metabolismo , Acetilmuramil-Alanil-Isoglutamina/farmacologia , Adjuvantes Imunológicos/metabolismo , Adjuvantes Imunológicos/farmacologia , Animais , Formação de Anticorpos/efeitos dos fármacos , Linhagem Celular , Desenho de Fármacos , Humanos , Imunoglobulina G/metabolismo , Interleucina-1beta/metabolismo , Interleucina-6/metabolismo , Leucócitos Mononucleares/citologia , Leucócitos Mononucleares/efeitos dos fármacos , Leucócitos Mononucleares/metabolismo , Lipossomos/química , Ativação Linfocitária/efeitos dos fármacos , Camundongos , Camundongos Endogâmicos C57BL , Proteína Adaptadora de Sinalização NOD2/metabolismo , Ovalbumina/imunologia , Relação Estrutura-Atividade , Células Th1/citologia , Células Th1/imunologia , Células Th1/metabolismo , Células Th2/citologia , Células Th2/imunologia , Células Th2/metabolismoRESUMO
The lack of efficient methods to control the major diseases of crops most important to agriculture leads to huge economic losses and seriously threatens global food security. Many of the most important microbial plant pathogens, including bacteria, fungi, and oomycetes, secrete necrosis- and ethylene-inducing peptide 1 (Nep1)-like proteins (NLPs), which critically contribute to the virulence and spread of the disease. NLPs are cytotoxic to eudicot plants, as they disturb the plant plasma membrane by binding to specific plant membrane sphingolipid receptors. Their pivotal role in plant infection and broad taxonomic distribution makes NLPs a promising target for the development of novel phytopharmaceutical compounds. To identify compounds that bind to NLPs from the oomycetes Pythium aphanidermatum and Phytophthora parasitica, a library of 587 small molecules, most of which are commercially unavailable, was screened by surface plasmon resonance. Importantly, compounds that exhibited the highest affinity to NLPs were also found to inhibit NLP-mediated necrosis in tobacco leaves and Phytophthora infestans growth on potato leaves. Saturation transfer difference-nuclear magnetic resonance and molecular modelling of the most promising compound, anthranilic acid derivative, confirmed stable binding to the NLP protein, which resulted in decreased necrotic activity and reduced ion leakage from tobacco leaves. We, therefore, confirmed that NLPs are an appealing target for the development of novel phytopharmaceutical agents and strategies, which aim to directly interfere with the function of these major microbial virulence factors. The compounds identified in this study represent lead structures for further optimization and antimicrobial product development.
Assuntos
Phytophthora/patogenicidade , Doenças das Plantas/prevenção & controle , Pythium/patogenicidade , Solanum tuberosum/genética , Simulação de Dinâmica Molecular , Necrose , Phytophthora/genética , Doenças das Plantas/parasitologia , Folhas de Planta/genética , Folhas de Planta/parasitologia , Pythium/genética , Solanum tuberosum/parasitologia , Ressonância de Plasmônio de Superfície , Nicotiana/genética , Nicotiana/parasitologiaRESUMO
Misregulation of BCL2 expression has been observed with many diseases and is associated with cellular exposure to reactive oxygen species. A region upstream of the P1 promoter in the human BCL2 gene plays a major role in regulating transcription. This G/C-rich region is highly polymorphic and capable of forming G-quadruplex structures. Herein we report that an oxidative event simulated with an 8-oxo-7,8-dihydroguanine (oxoG) substitution within a long G-tract results in a reduction of structural polymorphism. Surprisingly, oxoG within a 25-nt construct boosts thermal stability of the resulting G-quadruplex. This is achieved by distinct hydrogen bonding properties of oxoG, which facilitate formation of an antiparallel basket-type G-quadruplex with a three G-quartet core and a G·oxoG·C base triad. While oxoG has previously been considered detrimental for G-quadruplex formation, its stabilizing effect within a promoter described in this study suggests a potential novel regulatory role of oxidative stress in general and specifically in BCL2 gene transcription.
Assuntos
Quadruplex G , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas c-bcl-2/genética , Genes bcl-2 , Guanina/análogos & derivados , Guanina/química , Humanos , Modelos Moleculares , Estresse OxidativoRESUMO
Well-differentiated liposarcoma (WDLPS) is a malignant neoplasia hard to diagnose and treat. Its main molecular signature is amplification of the MDM2-containing genomic region. The MDM2 oncogene is the master regulator of p53: its overexpression enhances p53 degradation and inhibits apoptosis, leading to the tumoral phenotype. Here, we show that the MDM2 inducible promoter G-rich region folds into stable G-quadruplexes both in vitro and in vivo and it is specifically recognized by cellular helicases. Cell treatment with G-quadruplex-ligands reduces MDM2 expression and p53 degradation, thus stimulating cancer cell cycle arrest and apoptosis. Structural characterization of the MDM2 G-quadruplex revealed an extraordinarily stable, unique four-tetrad antiparallel dynamic conformation, amenable to selective targeting. These data indicate the feasibility of an out-of-the-box G-quadruplex-targeting approach to defeat WDLPS and all tumours where restoration of wild-type p53 is sought. They also point to G-quadruplex-dependent genomic instability as possible cause of MDM2 expansion and WDLPS tumorigenesis.
Assuntos
Quadruplex G , Regulação Neoplásica da Expressão Gênica/genética , Lipossarcoma/terapia , Terapia de Alvo Molecular , Regiões Promotoras Genéticas/genética , Proteínas Proto-Oncogênicas c-mdm2/genética , Neoplasias de Tecidos Moles/terapia , Apoptose , Ciclo Celular , Linhagem Celular Tumoral , Simulação por Computador , Humanos , Ligantes , Modelos Genéticos , Proteínas de Neoplasias/metabolismo , Proteínas Nucleares/metabolismo , Mapeamento de Interação de Proteínas , Proteólise , Proteínas Proto-Oncogênicas c-mdm2/biossíntese , Proteína Supressora de Tumor p53/metabolismoRESUMO
Aflatoxins are considered to be a critical dietary risk factor for humans, with aflatoxin B1 (AFB1) identified by the WHO as one of the most potent natural group 1 carcinogen. Despite this, more than half of the world's population is chronically exposed, resulting in up to 170,000 annual cases of human hepatocellular carcinoma cancer. Here we report an easily implemented approach using non-equilibrium plasma for targeted degradation of AFB1. Apart from reaching the 100 % decontamination in less than 120 s of treatment, this is the first study that combines hypersensitive analytical methods such as high-resolution mass spectroscopy (HRMS) and nuclear magnetic resonance spectroscopy (NMR) to provide a detailed description of CAP mediated AFB1 degradation. We identify rapid scission of the vinyl bond between 8- and 9-position on the terminal furan ring of AFB1 as being of paramount importance for the suppression of toxic potential, which is confirmed by the examination of both cytotoxicity and genotoxicity. The plasma reactive species mediated degradation pathways are elucidated, and it is demonstrated that the approach not only renders AFB1 harmless but does so in order of magnitude less time than UV irradiation as one of the other non-thermal methods currently under investigation.
Assuntos
Aflatoxinas , Carcinoma Hepatocelular , Neoplasias Hepáticas , Aflatoxina B1/toxicidade , Humanos , Espectrometria de MassasRESUMO
The cholecystokinin-2/gastrin receptor (CCK2 R) is considered a suitable target for the development of radiolabelled antagonists, due to its overexpression in various tumours, but no such compounds are available in clinical use. Therefore, we designed novel 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-conjugated ligands based on CCK2 R antagonist Z360/nastorazepide. As a proof of concept that CCK2 R antagonistic activity can be retained by extending the Z360/nastorazepide structure using suitable linker, we present herein three compounds containing various PEG linkers synthesised on solid phase and in solution. The antagonistic properties were measured in a functional assay in the A431-CCK2 R cell line (in the presence of agonist G17), with IC50 values of 3.31, 4.11 and 10.4â nM for compounds containing PEG4 , PEG6 and PEG12 , respectively. All compounds were successfully radiolabelled with indium-111, lutetium-177 and gallium-68 (incorporation of radiometal >95 %). The gallium-68-labelled compounds were stable for up to 2â h (PBS, 37 °C). log D7.4 values were determined for indium-111- and gallium-68-labelled compounds, showing improved hydrophilicity compared to the reference compound.
Assuntos
Desenho de Fármacos , Polietilenoglicóis/química , Compostos Radiofarmacêuticos/síntese química , Receptor de Colecistocinina B/antagonistas & inibidores , Sítios de Ligação , Linhagem Celular Tumoral , Estabilidade de Medicamentos , Radioisótopos de Gálio/química , Humanos , Interações Hidrofóbicas e Hidrofílicas , Radioisótopos de Índio/química , Lutécio/química , Simulação de Acoplamento Molecular , Radioisótopos/química , Compostos Radiofarmacêuticos/metabolismo , Receptor de Colecistocinina B/metabolismo , Técnicas de Síntese em Fase SólidaRESUMO
Naphthalene diimides showed significant anticancer activity in animal models, with therapeutic potential related to their ability to strongly interact with G-quadruplexes. Recently, a trifunctionalized naphthalene diimide, named NDI-5, was identified as the best analogue of a mini-library of novel naphthalene diimides for its high G-quadruplex binding affinity along with marked, selective anticancer activity, emerging as promising candidate drug for in vivo studies. Here we used NMR, dynamic light scattering, circular dichroism and fluorescence analyses to investigate the interactions of NDI-5 with G-quadruplexes featuring either parallel or hybrid topology. Interplay of different binding modes of NDI-5 to G-quadruplexes was observed for both parallel and hybrid topologies, with end-stacking always operative as the predominant binding event. While NDI-5 primarily targets the 5'-end quartet of the hybrid G-quadruplex model (m-tel24), the binding to a parallel G-quadruplex model (M2) occurs seemingly simultaneously at the 5'- and 3'-end quartets. With parallel G-quadruplex M2, NDI-5 formed stable complexes with 1:3 DNA:ligand binding stoichiometry. Conversely, when interacting with hybrid G-quadruplex m-tel24, NDI-5 showed multiple binding poses on a single G-quadruplex unit and/or formed different complexes comprising two or more G-quadruplex units. NDI-5 produced stabilizing effects on both G-quadruplexes, forming complexes with dissociation constants in the nM range.
Assuntos
Antineoplásicos/metabolismo , DNA de Neoplasias/metabolismo , Quadruplex G , Guanina/metabolismo , Imidas/metabolismo , Naftalenos/metabolismo , Antineoplásicos/síntese química , Sequência de Bases , Sítios de Ligação , DNA de Neoplasias/química , Guanina/química , Humanos , Imidas/síntese química , Ligantes , Naftalenos/síntese química , Soluções , TermodinâmicaRESUMO
Bone remodeling is a fine-tuned process principally regulated by a cascade triggered by interaction of receptor activator of NF-κB (RANK) and RANK ligand (RANKL). Excessive activity of the RANKL gene leads to increased bone resorption and can influence the incidence of osteoporosis. Although much has been learned about the intracellular signals activated by RANKL/RANK complex, significantly less is known about the molecular mechanisms of regulation of RANKL expression. Here, we report on the structure of an unprecedented DNA G-quadruplex, well-known secondary structure-mediated gene expression regulator, formed by a G-rich sequence found in the regulatory region of a RANKL gene. Solution-state NMR structural study reveals the formation of a three-layered parallel-type G-quadruplex characterized by an unique features, including a G-A bulge. Although a guanine within a G-tract occupies syn glycosidic conformation, bulge-forming residues arrange in a pseudo-loop conformation to facilitate partial 5/6-ring stacking, typical of G-quadruplex structures with parallel G-tracts orientation. Such distinctive structural features protruding from the core of the structure can represent a novel platform for design of highly specific ligands with anti-osteoporotic function. Additionally, our study suggests that the expression of RANKL gene may be regulated by putative folding of its G-rich region into non-B-DNA structure(s).
Assuntos
Adenina/química , Guanina/química , Osteoporose/genética , Quadruplex G , Humanos , Ressonância Magnética Nuclear Biomolecular , Conformação de Ácido Nucleico , Ligante RANK/genética , Receptor Ativador de Fator Nuclear kappa-B/genéticaRESUMO
Due to their ability to inhibit viral DNA or RNA replication, nucleoside analogues have been used for decades as potent antiviral therapeutics. However, one of the major limitations of nucleoside analogues is the development of antiviral resistance. In that regard, flexible nucleoside analogues known as "fleximers" have garnered attention over the years due to their ability to survey different amino acids in enzyme binding sites, thus overcoming the potential development of antiviral resistance. Acyclic fleximers have previously demonstrated antiviral activity against numerous viruses including Middle East Respiratory Syndrome coronavirus (MERS-CoV), Ebola virus (EBOV), and, most recently, flaviviruses such as Dengue (DENV) and Yellow Fever Virus (YFV). Due to these interesting results, a Structure Activity Relationship (SAR) study was pursued in order to analyze the effect of the pyrimidine functional group and acyl protecting group on antiviral activity, cytotoxicity, and conformation. The results of those studies are presented herein.
Assuntos
Antivirais/química , Antivirais/farmacologia , Pirimidinas/química , Pirimidinas/farmacologia , Linhagem Celular Tumoral , Ebolavirus/efeitos dos fármacos , Humanos , Indicadores e Reagentes , Lipídeos/química , Conformação Molecular , Espectroscopia de Prótons por Ressonância Magnética , Relação Estrutura-AtividadeRESUMO
The potential to affect gene expression via G-quadruplex stabilization has been extended to all domains of life, including viruses. Here, we investigate the polymorphism and structures of G-quadruplexes of the human papillomavirus type 52 with UV, CD and NMR spectroscopy and gel electrophoresis. We show that oligonucleotide with five G-tracts folds into several structures and that naturally occurring single nucleotide polymorphisms (SNPs) have profound effects on the structural polymorphism in the context of G-quadruplex forming propensity, conformational heterogeneity and folding stability. With help of SNP analysis, we were able to select one of the predominant forms, formed by G-rich sequence d(G3TAG3CAG4ACACAG3T). This oligonucleotide termed HPV52(1-4) adopts a three G-quartet snap back (3 + 1) type scaffold with four syn guanine residues, two edgewise loops spanning the same groove, a no-residue V loop and a propeller type loop. The first guanine residue is incorporated in the central G-quartet and all four-guanine residues from G4 stretch are included in the three quartet G-quadruplex core. Modification studies identified several structural elements that are important for stabilization of the described G-quadruplex fold. Our results expand set of G-rich targets in viral genomes and address the fundamental questions regarding folding of G-rich sequences.
Assuntos
DNA/genética , Papillomaviridae/genética , Polimorfismo de Nucleotídeo Único/genética , DNA/química , Quadruplex G , Humanos , Espectroscopia de Ressonância Magnética , Conformação de Ácido Nucleico , Relação Estrutura-AtividadeRESUMO
BACKGROUND: Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown. METHODS: To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations. RESULTS: Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy. CONCLUSIONS: The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner. GENERAL SIGNIFICANCE: Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid.
Assuntos
Espectroscopia de Ressonância Magnética , Metiltransferases/química , Selênio/química , Selenocisteína/química , Catálise , Domínio Catalítico , Humanos , Cinética , Metilação , Conformação Molecular , Simulação de Acoplamento Molecular , Ligação Proteica , Processamento de Proteína Pós-Traducional , Proteínas Recombinantes/química , Selenocisteína/análogos & derivadosRESUMO
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10â¢C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
Assuntos
Quadruplex G , Modelos Moleculares , Conformação de Ácido Nucleico , Proteínas Proto-Oncogênicas c-kit/química , Adenina/química , Compostos de Amônio/química , Fenômenos Biofísicos , Humanos , Íons/química , Cinética , Regiões Promotoras Genéticas , Proto-Oncogene Mas , Sódio/química , Termodinâmica , Timina/químicaRESUMO
Machine learning models in metabolomics, despite their great prediction accuracy, are still not widely adopted owing to the lack of an efficient explanation for their predictions. In this study, we propose the use of the general explanation method to explain the predictions of a machine learning model to gain detailed insight into metabolic differences between biological systems. The method was tested on a dataset of 1 Hâ NMR spectra acquired on normal lung and mesothelial cell lines and their tumor counterparts. Initially, the random forests and artificial neural network models were applied to the dataset, and excellent prediction accuracy was achieved. The predictions of the models were explained with the general explanation method, which enabled identification of discriminating metabolic concentration differences between individual cell lines and enabled the construction of their specific metabolic concentration profiles. This intuitive and robust method holds great promise for in-depth understanding of the mechanisms that underline phenotypes as well as for biomarker discovery in complex diseases.