TET2 regulates immune tolerance in chronically activated mast cells.

Mutation of the TET2 DNA-hydroxymethylase has been associated with a number of immune pathologies. The disparity in phenotype and clinical presentation among these pathologies leads to questions regarding the role of TET2 mutation in promoting disease evolution in different immune cell types. Here we show that, in primary mast cells, Tet2 expression is induced in response to chronic and acute activation signals. In TET2-deficient mast cells, chronic activation via the oncogenic KITD816V allele associated with mastocytosis, selects for a specific epigenetic signature characterized by hypermethylated DNA regions (HMR) at immune response genes. H3K27ac and transcription factor binding is consistent with priming or more open chromatin at both HMR and non-HMR in proximity to immune genes in these cells, and this signature coincides with increased pathological inflammation signals. HMR are also associated with a subset of immune genes that are direct targets of TET2 and repressed in TET2-deficient cells. Repression of these genes results in immune tolerance to acute stimulation that can be rescued with vitamin C treatment or reiterated with a Tet inhibitor. Overall, our data support a model where TET2 plays a direct role in preventing immune tolerance in chronically activated mast cells, supporting TET2 as a viable target to reprogram the innate immune response for innovative therapies.

Polymorphic and Higher-Order G-Quadruplexes as Possible Transcription Regulators: Novel Perspectives for Future Anticancer Therapeutic Applications.

In the past two decades, significant efforts have been put into designing small molecules to target selected genomic sites where DNA conformational rearrangements control gene expression. G-rich sequences at oncogene promoters are considered good points of intervention since, under specific environmental conditions, they can fold into non-canonical tetrahelical structures known as G-quadruplexes. However, emerging evidence points to a frequent lack of correlation between small molecule targeting of G-quadruplexes at gene promoters and the expression of the associated protein, which hampers pharmaceutical applications. The wide genomic localization of G-quadruplexes along with their highly polymorphic behavior may account for this scenario, suggesting the need for more focused drug design strategies. Here, we will summarize the G4 structural features that can be considered to fulfill this goal. In particular, by comparing a telomeric sequence with the well-characterized G-rich domain of the KIT promoter, we will address how multiple secondary structures might cooperate to control genome architecture at a higher level. If this holds true, the link between drug-DNA complex formation and the associated cellular effects will need to be revisited.

Double-stranded flanking ends affect the folding kinetics and conformational equilibrium of G-quadruplexes forming sequences within the promoter of KIT oncogene.

G-quadruplexes embedded within promoters play a crucial role in regulating the gene expression. KIT is a widely studied oncogene, whose promoter contains three G-quadruplex forming sequences, c-kit1, c-kit2 and c-kit*. For these sequences available studies cover ensemble and single-molecule analyses, although for kit* the latter were limited to a study on a promoter domain comprising all of them. Recently, c-kit2 has been reported to fold according to a multi-step process involving folding intermediates. Here, by exploiting fluorescence resonance energy transfer, both in ensemble and at the single molecule level, we investigated the folding of expressly designed constructs in which, alike in the physiological context, either c-kit2 or c-kit* are flanked by double stranded DNA segments. To assess whether the presence of flanking ends at the borders of the G-quadruplex affects the folding, we studied under the same protocols oligonucleotides corresponding to the minimal G-quadruplex forming sequences. Data suggest that addition of flanking ends results in biasing both the final equilibrium state and the folding kinetics. A previously unconsidered aspect is thereby unravelled, which ought to be taken into account to achieve a deeper insight of the complex relationships underlying the fine tuning of the gene-regulatory properties of these fascinating DNA structures.

Nanomechanics of G-quadruplexes within the promoter of the KIT oncogene.

G-quadruplexes (G4s) are tetrahelical DNA structures stabilized by four guanines paired via Hoogsteen hydrogen bonds into quartets. While their presence within eukaryotic DNA is known to play a key role in regulatory processes, their functional mechanisms are still under investigation. In the present work, we analysed the nanomechanical properties of three G4s present within the promoter of the KIT proto-oncogene from a single-molecule point of view through the use of magnetic tweezers (MTs). The study of DNA extension fluctuations under negative supercoiling allowed us to identify a characteristic fingerprint of G4 folding. We further analysed the energetic contribution of G4 to the double-strand denaturation process in the presence of negative supercoiling, and we observed a reduction in the energy required for strands separation.

G-Quadruplex Modulation of SP1 Functional Binding Sites at the KIT Proximal Promoter.

The regulation of conformational arrangements of gene promoters is a physiological mechanism that has been associated with the fine control of gene expression. Indeed, it can drive the time and the location for the selective recruitment of proteins of the transcriptional machinery. Here, we address this issue at the KIT proximal promoter where three G-quadruplex forming sites are present (kit1, kit2 and kit*). On this model, we focused on the interplay between G-quadruplex (G4) formation and SP1 recruitment. By site directed mutagenesis, we prepared a library of plasmids containing mutated sequences of the WT KIT promoter that systematically exploited different G4 formation attitudes and SP1 binding properties. Our transfection data showed that the three different G4 sites of the KIT promoter impact on SP1 binding and protein expression at different levels. Notably, kit2 and kit* structural features represent an on-off system for KIT expression through the recruitment of transcription factors. The use of two G4 binders further helps to address kit2-kit* as a reliable target for pharmacological intervention.

Targeting multiple G-quadruplex-forming DNA sequences: Design, biophysical and biological evaluations of indolo-naphthyridine scaffold derivatives.

It is well recognized that the non-canonical DNA structures known as G-quadruplexes (G4s) have a potential anticancer significance and several compounds have been discovered and evaluated as promising G4 binders with anticancer activity. Here, starting from a promising hit with an indolo-naphthyridine scaffold, a small series of five indolo-naphthyridine based derivatives have been designed and evaluated as G4-targeting compounds. FRET biophysical studies were performed on multiple DNA G4 structures, leading to the identification of a multi-target G4 stabilizer with a slight preference for the c-KIT1 and a good G4 over duplex selectivity. The good affinity of this compound against c-KIT1 G4 was also confirmed by SPR and MST experiments, while biological assays revealed its cytotoxic activity on tumour cells. Finally, Molecular Dynamics simulations helped to elucidate the stabilization effect of the selected compound against the c-KIT1 G4.

pH-driven conformational switch between non-canonical DNA structures in a C-rich domain of EGFR promoter.

EGFR is an oncogene that encodes for a trans-membrane tyrosine kinase receptor. Its mis-regulation is associated to several human cancers that, consistently, can be treated by selective tyrosine kinase inhibitors. The proximal promoter of EGFR contains a G-rich domain located at 272 bases upstream the transcription start site. We previously proved it folds into two main interchanging G-quadruplex structures, one of parallel and one of hybrid topology. Here we present the first evidences supporting the ability of the complementary C-rich strand (EGFR-272_C) to assume an intramolecular i-Motif (iM) structure that, according to the experimental conditions (pH, presence of co-solvent and salts), can coexist with a different arrangement we referred to as a hairpin. The herein identified iM efficiently competes with the canonical pairing of the two complementary strands, indicating it as a potential novel target for anticancer therapies. A preliminary screening for potential binders identified some phenanthroline derivatives as able to target EGFR-272_C at multiple binding sites when it is folded into an iM.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Conformational profiling of a G-rich sequence within the c-KIT promoter.

G-quadruplexes (G4) within oncogene promoters are considered to be promising anticancer targets. However, often they undergo complex structural rearrangements that preclude a precise description of the optimal target. Moreover, even when solved structures are available, they refer to the thermodynamically stable forms but little or no information is supplied about their complex multistep folding pathway. To shed light on this issue, we systematically followed the kinetic behavior of a G-rich sequence located within the c-KIT proximal promoter (kit2) in the presence of monovalent cations K+ and Na+. A very short-lived intermediate was observed to start the G4 folding process in both salt conditions. Subsequently, the two pathways diverge to produce distinct thermodynamically stable species (parallel and antiparallel G-quadruplex in K+ and Na+, respectively). Remarkably, in K+-containing solution a branched pathway is required to drive the wild type sequence to distribute between a monomeric and dimeric G-quadruplex. Our approach has allowed us to identify transient forms whose relative abundance is regulated by the environment; some of them were characterized by a half-life within the timescale of physiological DNA processing events and thus may represent possible unexpected targets for ligands recognition.

Coexistence of two main folded G-quadruplexes within a single G-rich domain in the EGFR promoter.

EGFR is an oncogene which codifies for a tyrosine kinase receptor that represents an important target for anticancer therapy. Indeed, several human cancers showed an upregulation of the activity of this protein. The promoter of this gene contains some G-rich domains, thus representing a yet unexplored point of intervention to potentially silence this gene. Here, we explore the conformational equilibria of a 30-nt long sequence located at position -272 (EGFR-272). By merging spectroscopic and electrophoretic analysis performed on the wild-type sequence as well as on a wide panel of related mutants, we were able to prove that in potassium ion containing solution this sequence folds into two main G-quadruplex structures, one parallel and one hybrid. They show comparable thermal stabilities and affinities for the metal ion and, indeed, they are always co-present in solution. The folding process is driven by a hairpin occurring in the domain corresponding to the terminal loop which works as an important stabilizing element for both the identified G-quadruplex arrangements.

Characterization of G4-G4 Crosstalk in the c-KIT Promoter Region.

The proximal promoter of c-KIT contains a peculiar domain that consists of three short G-rich sequences that are close together and can fold into noncanonical DNA secondary structures called G-quadruplexes (G4). Here, we focused on a sequence containing two consecutive G4 (kit2 and kit*). By electrophoretic, surface plasmon resonance, and spectroscopic techniques, we demonstrated that they retain the ability to fold into G4 upon being inserted into the extended sequence. Here, we highlighted the occurrence of crosstalk between the two forming units. This previously unexplored G4-G4 interaction modulates both the conformation and the stability of the overall arrangement of the c-KIT promoter. It is not supported by stacking of single nucleotides but refers to a G4-G4 interaction surface surrounded by a two-nucleotides loop that might represent a reliable unprecedented target for anticancer therapy.

Optimized Virtual Screening Workflow for the Identification of Novel G-Quadruplex Ligands.

G-quadruplexes, alternative DNA secondary structures present in telomeres, emerge as promising targets for the treatment of cancer, because they prevent telomere elongation and accordingly cell proliferation. Within this study, theoretically validated pharmacophore- and shape-based models as well as a theoretically validated docking protocol were generated and applied in parallel for virtual screening and the identification of novel G-quadruplex ligands. Top-ranked hits retrieved with all methods independently and in addition in a consensus approach were selected for biological testing. Of the 32 tested virtual hits seven selectively stabilized G-quadruplexes over duplex DNA in the fluorescence melting assay. For the five most active compounds, chemically closely related analogues were collected and subjected to in vitro analysis. Thereby, seven further novel G-quadruplex ligands could be identified. These molecules do not only represent novel scaffolds, but some of them are in addition even more potent G-quadruplex stabilizers than the established reference compound berberine. This study proposes an optimized in silico workflow for the identification of novel G-quadruplex stabilizers, which can also be applied in future studies. In addition, structurally novel and promising lead candidates with strong and selective G-quadruplex stabilizing properties are reported.

Macrocyclic naphthalene diimides as G-quadruplex binders.

The synthesis, biological and molecular modeling evaluation of a series of macrocyclic naphthalene diimides is reported. The present investigation expands on the study of structure-activity relationships of prototype compound 2 by constraining the molecule into a macrocyclic structure with the aim of improving its G-quadruplex binding activity and selectivity. The new derivatives, compounds 4-7 carry spermidine- and spermine-like linkers while in compound 8 the inner basic nitrogen atoms of spermine have been replaced with oxygen atoms. The design strategy has led to potent compounds stabilizing both human telomeric (F21T) and c-KIT2 quadruplex sequences, and high selectivity for quadruplex in comparison to duplex DNA. Antiproliferative effects of the new derivatives 4-8 have been evaluated in a panel of cancer cell lines and all the tested compounds showed activity in the low micromolar or sub-micromolar range of concentrations. In order to rationalize the molecular basis of the DNA G-quadruplex versus duplex recognition preference, docking and molecular dynamics studies have been performed. The computational results support the observation that the main driving force in the recognition is due to electrostatic factors.