Pharmacokinetics and Metabolism of Melflufen, an Alkylating Peptide-Drug Conjugate, in Patients with Relapsed Refractory Multiple Myeloma.

Melphalan flufenamide (melflufen) is a novel lipophilic peptide-drug conjugate recently approved in the European Union and the United Kingdom for the treatment of relapsed refractory multiple myeloma. Melflufen rapidly crosses the cell membrane, and inside tumor cells, melflufen utilizes peptidases and esterases to release entrapped hydrophilic metabolites with alkylating activity. In vitro, in whole blood, melflufen was rapidly distributed into blood cells and quickly converted to its main metabolite melphalan, with maximum cellular concentrations of noncovalently bound melflufen and melphalan after 1 and 6 minutes, respectively. Melphalan outflow from blood cells was slow, with peak concentrations in plasma after 25 minutes. The pharmacokinetics of melflufen was best described by a 2-compartment model. Following a 30-minutes intravenous infusion of 40 mg in 27 patients with relapsed refactory multiple myeloma, mean half-life in the α phase of the curve was 1.24 minutes, half-life in the ß phase of the curve 26.7 minutes, and clearance 13.4 L/min. Desethyl-melflufen exposure was below 20% compared to melflufen. Based on population analysis (298 patients with relapsed refactory multiple myeloma), the melphalan pharmacokinetics were well characterized by a 3-compartment model with melflufen dosing into a peripheral compartment, assuming instantaneous distribution of melflufen into cells and subsequent rapid metabolism to melphalan. Mean clearance and central and deep peripheral volumes of distribution were 22.4 L/h, 2.70 L, and 51.3 L, respectively. Clearance increased and maximum concentration decreased with increasing body weight and estimated glomerular filtration rate. In conclusion, melflufen administration differs from melphalan administration by a more rapid distribution into cells, which, in conjunction with a rapid intracellular metabolism, allows for higher maximum concentrations of alkylating agents, and by a more extensive distribution of melphalan to peripheral tissues.

A comprehensive regulatory and industry review of modeling and simulation practices in oncology clinical drug development.

Exposure-response (E-R) analyses are an integral component in the development of oncology products. Characterizing the relationship between drug exposure metrics and response allows the sponsor to use modeling and simulation to address both internal and external drug development questions (e.g., optimal dose, frequency of administration, dose adjustments for special populations). This white paper is the output of an industry-government collaboration among scientists with broad experience in E-R modeling as part of regulatory submissions. The goal of this white paper is to provide guidance on what the preferred methods for E-R analysis in oncology clinical drug development are and what metrics of exposure should be considered.

Pharmacometric modeling and machine learning analyses of prognostic and predictive factors in the JAVELIN Gastric 100 phase III trial of avelumab.

Avelumab (anti-PD-L1) is an approved anticancer treatment for several indications. The JAVELIN Gastric 100 phase III trial did not meet its primary objective of demonstrating superior overall survival (OS) with avelumab maintenance versus continued chemotherapy in patients with advanced gastric cancer/gastroesophageal junction cancer; however, the OS rate was numerically higher with avelumab at timepoints after 12 months. Machine learning (random forests, SIDEScreen, and variable-importance assessments) was used to build models to identify prognostic/predictive factors associated with long-term OS and tumor growth dynamics (TGDs). Baseline, re-baseline, and longitudinal variables were evaluated as covariates in a parametric time-to-event model for OS and Gompertzian population model for TGD. The final OS model incorporated a treatment effect on the log-logistic shape parameter but did not identify a treatment effect on OS or TGD. Variables identified as prognostic for longer OS included older age; higher gamma-glutamyl transferase (GGT) or albumin; absence of peritoneal carcinomatosis; lower neutrophil-lymphocyte ratio, lactate dehydrogenase, or C-reactive protein (CRP); response to induction chemotherapy; and Eastern Cooperative Oncology Group performance status of 0. Among baseline and time-varying covariates, the largest effects were found for GGT and CRP, respectively. Liver metastasis at re-baseline predicted higher tumor growth. Tumor size after induction chemotherapy was associated with number of metastatic sites and stable disease (vs. response). Asian region did not impact OS or TGD. Overall, an innovative workflow supporting pharmacometric modeling of OS and TGD was established. Consistent with the primary trial analysis, no treatment effect was identified. However, potential prognostic factors were identified.

Exposure-response modeling of the effect of glasdegib on cardiac repolarization in patients with cancer.

PURPOSE: To characterize the effect of glasdegib on cardiac repolarization (QTc) in patients with advanced cancer. METHODS: A concentration-QTc model was developed using data from two glasdegib single-agent, dose-escalation trials. Triplicate electrocardiogram was performed at pre-specified timepoints paired with pharmacokinetic blood collections after a single dose and at steady-state. Changes in QTc from baseline were predicted by model-based simulations at the clinical dose (100 mg QD) and in a supratherapeutic setting. RESULTS: Glasdegib did not affect the heart rate, but had a positive effect on the corrected QT interval, described by a linear mixed-effects model with ΔQTcF (QTc using Fridericia's formula) as the dependent variable with glasdegib plasma concentrations from doses of 5-640 mg QD. The predicted mean QTcF change (upper bound of the 95% CI) was 5.30 (6.24) msec for the therapeutic 100-mg QD dose; at supratherapeutic concentrations (40% and 100% increase over the therapeutic Cmax), it was 7.42 (8.74) and 12.09 (14.25) msec, respectively. CONCLUSIONS: The relationship of glasdegib exposure and QTc was well characterized by the model. The effect of glasdegib on the QTc interval did not cross the threshold of clinical concern for an oncology drug. TRIAL REGISTRATION: ClinicalTrials.gov ID: NCT01286467 and NCT00953758.

Lorlatinib Exposure-Response Analyses for Safety and Efficacy in a Phase I/II Trial to Support Benefit-Risk Assessment in Non-Small Cell Lung Cancer.

Lorlatinib is a small molecule inhibitor of anaplastic lymphoma kinase (ALK) and c-ROS oncogene 1 (ROS1) tyrosine kinases and is approved for the treatment of patients with ALK-positive advanced non-small cell lung cancer (NSCLC). In the phase I/II study (NCT01970865), potential exposure-response (E-R) relationships between lorlatinib and selected safety and efficacy end points were evaluated in patients with NSCLC. E-R relationships were assessed for safety end points with incidence > 10% in all treated patients (n = 328). In total, 4 safety end points were assessed: hypercholesterolemia grade ≥ 3, hypertriglyceridemia grade ≥ 3, weight gain grade ≥ 2, and treatment-emergent adverse events (TEAEs) grade ≥ 3. Using logistic regression, significant relationships were identified between lorlatinib plasma exposure and risk of hypercholesterolemia grade ≥ 3 (odds ratio (OR) 5.256) and risk of TEAE grade ≥ 3 (OR 3.214). The covariates baseline cholesterol and time on study prior to the event (TE) were associated with the probability of hypercholesterolemia grade ≥ 3. Baseline cholesterol and TE were found to have a statistically significant correlation with TEAE grade ≥ 3. Exposure-efficacy relationships were assessed for objective response rate (ORR; n = 197) and intracranial objective response rate (IC-ORR; n = 132). Lorlatinib plasma exposure was not identified as a statistically significant factor related to either efficacy end point. The only significant E-R relationships identified for efficacy were between baseline alkaline phosphatase and baseline amylase with IC-ORR (ORs 0.363 and 1.015, respectively). These findings support the lorlatinib indicated dose and dose modification guidelines regarding the management of lorlatinib-related AEs.

Population pharmacokinetic model with time-varying clearance for lorlatinib using pooled data from patients with non-small cell lung cancer and healthy participants.

Lorlatinib, a selective inhibitor of anaplastic lymphoma kinase (ALK) and c-ROS oncogene 1 (ROS1) tyrosine kinase, is indicated for the treatment of ALK-positive metastatic non-small cell lung cancer (NSCLC) following progression on crizotinib and at least one other ALK inhibitor, or alectinib/ceritinib as the first ALK inhibitor therapy for metastatic disease. The population pharmacokinetics (PopPK) of lorlatinib was conducted by nonlinear mixed effects modeling of data from 330 patients with ALK-positive or ROS1-positive NSCLC and 95 healthy participants from six phase I studies in healthy volunteers; demographic, metabolizer phenotype, and patient prognostic factors were evaluated as covariates. Lorlatinib plasma PK was well-characterized by a two-compartment model with sequential zero-order and first-order absorption and a time-varying induction of clearance. Single dose clearance was estimated to be 9.04 L/h. Assuming that the metabolic auto-induction of lorlatinib reaches saturation in ~ 5 half-lives, clearance was estimated to approach a maximum of 14.5 L/h at steady-state after a period of ~ 7.25 days. The volume of distribution of the central compartment was estimated to be 121 L and the first-order absorption rate constant was estimated to be 3.1 h-1 . Baseline albumin and lorlatinib total daily dose were significant covariates on lorlatinib clearance. Use of proton pump inhibitors was found to be a significant covariate on the lorlatinib absorption rate constant. These factors were assessed to have no clinically meaningful impact on lorlatinib plasma exposure, and no dose adjustments are considered necessary based on the examined covariates.

Evaluation of the Relationship of Glasdegib Exposure and Safety End Points in Patients With Refractory Solid Tumors and Hematologic Malignancies.

Glasdegib is approved for treating acute myeloid leukemia in elderly patients at 100 mg once daily in combination with low-dose cytarabine. Exposure-efficacy analysis showed that the survival benefit of glasdegib was not glasdegib exposure-dependent. The relationship between glasdegib exposure and adverse event (AE) cluster terms of clinical concern was explored in this analysis. The incidence and severity of dysgeusia, muscle spasms, renal toxicity, and QT interval prolonged was modeled using ordinal logistic regression. AEs were graded using the National Cancer Institute Common Terminology Criteria for Adverse Events (version 4.03). Estimated pharmacokinetic parameters were used to derive glasdegib exposure metrics. Demographic characteristics, disease factors, and other variables of interest as potential moderators of safety signals were evaluated. Clinical trial data from patients who received single-agent glasdegib (N = 70; 5-640 mg once daily); or glasdegib (N = 202, 100-200 mg once daily) with low-dose cytarabine, decitabine, or daunorubicin and cytarabine were analyzed. Glasdegib exposure was statistically significantly associated with the cluster term safety end points dysgeusia, muscle spasms, renal toxicity, and QT interval prolonged. The impact of age on muscle spasms and baseline body weight and creatinine clearance on renal toxicity helped explain the AE grade distribution. At the 100 mg once daily clinical dose, the predicted probabilities of the highest AE grade were 11.3%, 6.7%, 7.7%, and 2.5% for dysgeusia, muscle spasms, renal toxicity, and QT interval prolonged, respectively. Overall, the predicted probability of developing an AE of any severity for these safety end points was low. Therefore, no starting dose adjustments are recommended for glasdegib based on the observed safety profile.

Characterization of the Relationship of Inotuzumab Ozogamicin Exposure With Efficacy and Safety End Points in Adults With Relapsed or Refractory Acute Lymphoblastic Leukemia.

Inotuzumab ozogamicin (InO), an anti-CD22 monoclonal antibody conjugated to calicheamicin, is approved in Europe and the United States for treatment of adults with relapsed or refractory acute lymphoblastic leukemia (ALL). Population analyses were performed to evaluate the relationship between InO exposure and efficacy and safety end points in patients with ALL. The probability of achieving complete remission/complete remission with incomplete hematologic recovery (CR/CRi) and minimal residual disease (MRD)-negativity for InO relative to chemotherapy was also investigated. Data from study 1010 (NCT01363297) and INO-VATE (NCT01564784) were pooled for exposure-response (InO, n = 234) and treatment-response (InO, n = 234; chemotherapy, n = 143) analyses. The analyses demonstrated that InO exposure was significantly correlated with achieving CR/CRi and MRD-negativity, as well as with hepatic event adjudication board-reported veno-occlusive disease/sinusoidal obstruction. Patients with ALL treated with InO had significantly greater odds of achieving CR/CRi (7-times higher) and MRD-negativity (13-times higher) than those receiving chemotherapy.

An evaluation of overall survival in patients with newly diagnosed acute myeloid leukemia and the relationship with glasdegib treatment and exposure.

PURPOSE: Glasdegib, an oral inhibitor of the Hedgehog signaling pathway, is approved in the United States in combination with low-dose cytarabine (LDAC) to treat patients with newly diagnosed acute myeloid leukemia (AML) ineligible to receive intensive chemotherapy. This population pharmacokinetic/pharmacodynamic analysis characterized the time course of survival with glasdegib + LDAC relative to LDAC alone, and explored whether the differences in glasdegib exposure at the clinical dose of 100 mg once daily (QD) significantly affected overall survival (OS). METHODS: Data from the BRIGHT AML 1003 trial in patients with AML were included in treatment-response (glasdegib + LDAC, n = 78; LDAC alone, n = 38) and exposure-response (glasdegib + LDAC, n = 75) analyses. RESULTS: The analyses demonstrate that patients treated with glasdegib + LDAC (vs LDAC alone) at any time point during the study period were 58% less likely to die, translating to prolonging of median OS by ~ 5 months (hazard ratio 0.42 [95% confidence interval 0.28-0.66]). Variability in glasdegib exposures did not impact the risk of death. Additionally, potential covariates such as patient demographics, prior treatment with a hypomethylating agent, baseline safety laboratory values, and disease characteristics, did not impact the probability of OS. CONCLUSION: Together these results confirm that glasdegib + LDAC treatment (vs. LDAC alone) is associated with a significant survival benefit in patients with newly diagnosed AML, and that variability in glasdegib doses (e.g., for dose reductions) and exposures do not compromise the survival benefit of glasdegib 100 mg QD. CLINICAL TRIAL NUMBER: NCT01546038.

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Pharmacokinetic Models to Characterize the Absorption Phase and the Influence of a Proton Pump Inhibitor on the Overall Exposure of Dacomitinib.

INTRODUCTION: Dacomitinib is an epidermal growth factor receptor (EGFR) inhibitor approved for the treatment of metastatic non-small cell lung cancer (NSCLC) in the first line in patients with EGFR activating mutations. Dacomitinib is taken orally once daily at 45 mg with or without food, until disease progression or unacceptable toxicity occurs. Oncology patients often can develop gastroesophageal reflux disease (GERD), which may require management with an acid-reducing agent. Proton pump inhibitors (PPIs), such as rabeprazole, inhibit sodium-potassium adenosine triphosphatase (H+/K+-ATPase) pumps that stimulate acid secretion in the stomach and have a prolonged pharmacodynamic effect that extends beyond 24 h post-administration. The aim of this work was to characterize the absorption of dacomitinib via modeling with a particular interest in quantifying the impact of rabeprazole on the pharmacokinetics (PK) of dacomitinib. MATERIALS AND METHODS: The pooled dataset consisted of five clinical pharmacology healthy volunteer studies, which collected serial pharmacokinetic concentration-time profiles of dacomitinib. Non-linear mixed effects modeling was carried out to characterize dacomitinib pharmacokinetics in the presence and absence of the concomitant use of a PPI, rabeprazole. Several absorption models, some more empirical, and some more physiologically based, were tested: transit compartment, first-order absorption with and without lag time, and variations of combined zero- and first-order absorption kinetics models. RESULTS: The presence of a PPI was a significant covariate affecting the extent (F) and rate (ka) of dacomitinib absorption, as previously reported in the dedicated clinical study. A transit compartment model was able to best describe the absorption phase of dacomitinib.

Population Pharmacokinetics of Glasdegib in Patients With Advanced Hematologic Malignancies and Solid Tumors.

Glasdegib is an inhibitor of the Hedgehog pathway recently approved in the United States for the treatment of acute myeloid leukemia. A population pharmacokinetic analysis was conducted to characterize the kinetic behavior of glasdegib and its sources of variability (covariates) by utilizing data from 269 patients with cancer treated with oral glasdegib doses ranging from 5 to 640 mg/d. Nonlinear mixed-effects modeling was conducted using NONMEM (v.7.3) and Perl-speaks NONMEM (v.4.2.0). The estimated apparent total clearance, apparent central volume of distribution, and apparent peripheral volume of distribution were 6.27 L/h, 3.32 L, and 279.2 L, respectively. Age, sex, race, and hepatic function were not significant covariates on glasdegib pharmacokinetic parameters. Baseline body weight, percentage bone marrow blasts, creatinine clearance, and use of moderate or strong cytochrome P450 3A inhibitors were statistically significant covariates on apparent total clearance; however, the magnitude of the effects was not considered clinically meaningful.

Pharmacokinetic/Pharmacodynamic Modeling to Support the Re-approval of Gemtuzumab Ozogamicin.

Gemtuzumab ozogamicin (Mylotarg; Pfizer, New York, NY) was the first antibody-drug conjugate to be approved for CD33-positive acute myeloid leukemia (AML). However, it was voluntarily withdrawn from the US market due to lack of clinical benefit in the confirmatory phase III trial. In 2012, several investigator cooperative studies using a different dosing regimen showed efficacy, but pharmacokinetic (PK) data were not collected in these trials. Through simulation of expected concentrations for new dosing regimens, PK/pharmacodynamic modeling was able to support the safety and efficacy of these regimens. Significant exposure-response relationships were found for the attainment of complete remission with and without platelet recovery, attainment of blast-free status, the time course of myelosuppression, several grade ≥ 3 hepatic adverse events, and veno-occlusive disease. Gemtuzumab ozogamicin received full approval by the US Food and Drug Administration (FDA) in September 2017 for newly diagnosed and relapsed AML in adult patients and relapsed AML in pediatric patients aged 2-17 years.

Population pharmacokinetics of inotuzumab ozogamicin in relapsed/refractory acute lymphoblastic leukemia and non-Hodgkin lymphoma.

This population pharmacokinetics analysis evaluated the target-mediated drug disposition of inotuzumab ozogamicin (InO) through an empirical time-dependent clearance (CLt) term and identified potential covariates that may be important predictors of variability in InO distribution and elimination. This analysis was conducted by pooling data from 2 studies of single-agent InO in patients with relapsed or refractory (R/R) B cell acute lymphoblastic leukemia (ALL), 3 studies of single-agent InO, 5 studies of InO plus rituximab (R-InO), and 1 study of R-InO plus chemotherapy in patients with R/R B-cell non-Hodgkin lymphoma (NHL). Pharmacokinetic data included 8361 InO concentration-time observations that were modeled using nonlinear mixed-effects analysis. Covariate relations were identified using generalized additive modeling on base model parameters and then tested in a stepwise manner via covariate modeling. InO concentration was described with a 2-compartment model with linear and time-dependent clearance components. Based on the final model, baseline body surface area was a covariate of the linear and time-dependent clearance components and volume of distribution in the central compartment; baseline percentage of blasts in the peripheral blood was a covariate of the decay coefficient of the time-dependent clearance term (CLt); and concomitant rituximab treatment was a covariate of the linear clearance component (CL1). The magnitude of change of each pharmacokinetic parameter due to these covariates was not considered clinically relevant. Therefore, no dose adjustment of InO for the treatment of patients with R/R B-cell ALL or NHL is needed on the basis of selected covariates.

Palbociclib has no clinically relevant effect on the QTc interval in patients with advanced breast cancer.

The aim of this study was to assess the potential effects of palbociclib in combination with letrozole on QTc. PALOMA-2, a phase 3, randomized, double-blind, placebo-controlled trial, compared palbociclib plus letrozole with placebo plus letrozole in postmenopausal women with estrogen receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer. The study included a QTc evaluation substudy carried out as a definitive QT interval prolongation assessment for palbociclib. Time-matched triplicate ECGs were performed at 0, 2, 4, 6, and 8 h at baseline (Day 0) and on Cycle 1 Day 14. Additional ECGs were collected from all patients for safety monitoring. The QT interval was corrected for heart rate using Fridericia's correction (QTcF), Bazett's correction (QTcB), and a study-specific correction factor (QTcS). In total, 666 patients were randomized 2 : 1 to palbociclib plus letrozole or placebo plus letrozole. Of these, 125 patients were enrolled in the QTc evaluation substudy. No patients in the palbociclib plus letrozole arm of the substudy (N=77) had a maximum postbaseline QTcS or QTcF value of ≥ 480 ms, or a maximum increase from clock time-matched baseline for QTcS or QTcF values of ≥ 60 ms. The upper bounds of the one-sided 95% confidence interval for the mean change from time-matched baseline for QTcS, QTcF, and QTcB at all time points and at steady-state Cmax following repeated administration of 125 mg palbociclib were less than 10 ms. Palbociclib, when administered with letrozole at the recommended therapeutic dosing regimen, did not prolong the QT interval to a clinically relevant extent.

Characterization of Neutropenia in Advanced Cancer Patients Following Palbociclib Treatment Using a Population Pharmacokinetic-Pharmacodynamic Modeling and Simulation Approach.

Neutropenia is the most commonly reported hematologic toxicity following treatment with palbociclib, a cyclin-dependent kinase 4/6 inhibitor approved for metastatic breast cancer. Using data from 185 advanced cancer patients receiving palbociclib in 3 clinical trials, a pharmacokinetic-pharmacodynamic model was developed to describe the time course of absolute neutrophil count (ANC) and quantify the exposure-response relationship for neutropenia. These analyses help in understanding neutropenia associated with palbociclib and its comparison with chemotherapy-induced neutropenia. In the model, palbociclib plasma concentration was related to its antiproliferative effect on precursor cells through drug-related parameters (ie, maximum estimated drug effect and concentration corresponding to 50% of the maximum effect), and neutrophil physiology was mimicked through system-related parameters (ie, mean transit time, baseline ANC, and feedback parameter). Sex and baseline albumin level were significant covariates for baseline ANC. It was demonstrated by different model evaluation approaches (eg, prediction-corrected visual predictive check and standardized visual predictive check) that the final model adequately described longitudinal ANC with good predictive capability. The established model suggested that higher palbociclib exposure was associated with lower longitudinal neutrophil counts. The ANC nadir was reached approximately 21 days after palbociclib treatment initiation. Consistent with their mechanisms of action, neutropenia associated with palbociclib (cytostatic) was rapidly reversible and noncumulative, with a notably weaker antiproliferative effect on precursor cells relative to chemotherapies (cytotoxic). This pharmacokinetic-pharmacodynamic model aids in predicting neutropenia and optimizing dosing for future palbociclib trials with different dosing regimen combinations.

Effect of food on the bioavailability of palbociclib.

PURPOSE: This phase I study estimated the effect of food on bioavailability of palbociclib (IBRANCE®), and a selective inhibitor of cyclin-dependent kinase 4/6 approved for oncology indications has pH-dependent solubility and high permeability. METHODS: In this randomized, four-sequence, four-period crossover study, 28 healthy volunteers received a single 125-mg dose of palbociclib (free-base capsule) following an overnight fast or (1) after a high-fat/-calorie meal, (2) after a low-fat/-calorie meal, and (3) between two moderate-fat/standard-calorie meals. Pharmacokinetic samples were collected predose and serially ≤144 h postdose; palbociclib concentrations were measured using validated high-performance liquid chromatography tandem mass spectrometry. Pharmacokinetic data were analyzed using a noncompartmental approach based on a mixed-effects model. RESULTS: Median time to maximum concentration was 8 h for all conditions. Exposure (AUCinf and C max) increased slightly in the fed versus fasted conditions; ratios (90% CIs) of the adjusted geometric mean relative to the fasted condition ranged from 111.8 (104.3-119.9%) to 120.6% (112.6-129.1%) for AUCinf and from 124.0 (108.4-141.9%) to 137.8% (120.6-157.5%) for C max due mainly to three subjects with significantly lower exposure (low liers) in the fasted condition. Pharmacokinetic variability was reduced in the fed (AUCinf, 23-27%; C max, 21-24%) versus fasted (AUCinf, 39%; C max, 73%) conditions. In a supplemental analysis excluding the three low liers, food intake did not affect palbociclib exposure. CONCLUSIONS: Food intake modestly increased palbociclib exposure while greatly reducing pharmacokinetic variability. For subjects with normal absorption, food intake did not affect palbociclib exposure. Thus, palbociclib should be administered with food. TRIAL REGISTRATION: ClinicalTrials.gov: NCT01904747.

Effect of axitinib on the QT interval in healthy volunteers.

PURPOSE: Axitinib is a potent and selective inhibitor of vascular endothelial growth factor receptors 1-3, approved for second-line treatment of advanced renal cell carcinoma (RCC). Preclinical studies did not indicate potential for axitinib-induced delayed cardiac repolarization. METHODS: The effect of axitinib on corrected QT (QTc) prolongation was evaluated with one-stage concentration-QTc response modeling using data from a definitive randomized crossover QT phase I study in healthy volunteers administered one single 5-mg axitinib dose alone or in the presence of steady-state ketoconazole (400 mg once daily). RESULTS: Axitinib and ketoconazole had opposite effects on heart rate: Axitinib lowered it, ketoconazole raised it. The final analysis showed a flat relationship between QTc and axitinib concentration (slope -0.0314 ms·mL/ng) for axitinib alone. Mean highest placebo-matched change from baseline in QTc was -3.0 [90 % confidence interval (CI) -5.4, -0.6] ms. At supratherapeutic axitinib exposures achieved with potent cytochrome P450 3A4/5 inhibition by ketoconazole, the model predicted mean QTc change of 6.5 (90 % CI 4.4-8.5) ms. The slope population mean estimate was -0.331 (95 % CI -0.860, 0.198) ms·mL/µg for ketoconazole alone and 0.0725 (0.0445-0.1005) ms·mL/ng for axitinib in the presence of ketoconazole. The results were then compared with those obtained based on more widely used Fridericia's, Bazett's, and study-specific correction methods. CONCLUSIONS: Since axitinib plasma concentrations observed in this study exceeded the range of concentrations observed in patients with RCC at the highest approved clinical dose (10 mg twice daily), axitinib was not associated with clinically significant QTc prolongation in target populations.

Pharmacokinetics of single-agent axitinib across multiple solid tumor types.

PURPOSE: Axitinib, a potent and selective inhibitor of vascular endothelial growth factor receptors, showed antitumor activity as a single agent against several solid tumor types in Phase II and III trials. This study was conducted to evaluate axitinib pharmacokinetics across a variety of solid tumors. METHODS: The current study analyzed the pharmacokinetics of axitinib in 110 patients with non-small cell lung cancer (NSCLC), thyroid cancer, or melanoma from three Phase II trials plus 127 healthy volunteers, using nonlinear mixed-effects modeling. Boxplots of maximum observed plasma concentration (C max) and area under the plasma concentration-time curve (AUC) of data from these tumor populations was compared to C max and AUC from the final population pharmacokinetic model developed for metastatic renal cell carcinoma (mRCC) to compare axitinib pharmacokinetics across different tumor types. RESULTS: Axitinib disposition based on data from 237 subjects was best described using a two-compartment model with first-order absorption and lag time. Population estimates for systemic clearance, central volume of distribution, absorption rate constant, absolute bioavailability, and lag time were 20.1 L/h, 56.2 L, 1.26/h(-1), 0.663, and 0.448 h, respectively. Statistically significant covariates included gender on clearance, and body weight on central volume of distribution. However, predicted changes due to gender and body weight were found not clinically meaningful. The final analysis indicated that the pharmacokinetic model for mRCC was able to successfully describe axitinib pharmacokinetics in patients with NSCLC, thyroid cancer, and melanoma. CONCLUSION: The pharmacokinetics of axitinib appears to be similar across a variety of tumor types.

A phase 2 trial of dacomitinib (PF-00299804), an oral, irreversible pan-HER (human epidermal growth factor receptor) inhibitor, in patients with advanced non-small cell lung cancer after failure of prior chemotherapy and erlotinib.

BACKGROUND: This phase 2 trial (ClinicalTrials.gov identifier NCT00548093) assessed the efficacy, safety, and impact on health-related quality of life of dacomitinib (PF-00299804), an irreversible tyrosine kinase inhibitor (TKI) of human epidermal growth factor receptors (EGFR)/HER1, HER2, and HER4, in patients with KRAS wild-type non-small cell lung cancer (NSCLC). METHODS: Patients with advanced NSCLC, progression on 1 or 2 regimens of chemotherapy and erlotinib, KRAS wild-type or known EGFR-sensitizing mutant tumor, and Eastern Cooperative Oncology Group performance status of 0 to 2 received 45 mg of dacomitinib once daily continuously in 21-day cycles. RESULTS: A total of 66 patients enrolled (adenocarcinoma, n = 50; those without adenocarcinoma [nonadenocarcinoma], n = 16). The objective response rate (ORR) for patients with adenocarcinoma (primary endpoint) was 5% (2 partial responses; 1-sided P = .372 for null hypothesis [H0 ]: ORR ≤ 5%) and 6% (1 partial response) for patients with nonadenocarcinoma. Responders included: 2 of 25 EGFR mutation-positive tumors; 1 of 3 EGFR wild-type with HER2 amplification. Median progression-free survival was 12 weeks overall (n = 66) and 18 weeks (n = 26) for patients with EGFR mutation-positive tumors. Common treatment-related adverse events were of grade 1 or 2 severity, manageable with standard supportive care, and included diarrhea (grade 3 [G3], 12%), acneiform dermatitis (G3, 6%), exfoliative rash (G3, 3%), dry skin (G3, 0%), fatigue (G3, 3%), and stomatitis (G3, 2%). Six patients (9%) discontinued due to treatment-related adverse events. By patient report, NSCLC symptoms of dyspnea, cough, and pain (chest, arm/shoulder) showed improvement first observed after 3 weeks on therapy. CONCLUSIONS: Dacomitinib demonstrated preliminary activity and acceptable tolerability in heavily pretreated patients, and may offer benefit in molecularly defined patient subsets.