Increased expression of prion protein gene is accompanied by demethylation of CpG sites in a mouse embryonal carcinoma cell line, P19C6.

Elucidation of the processes regulating the prion protein gene (Prnp) is an important key to understanding the development of prion disorders. In this study, we explored the involvement of DNA methylation in Prnp transcriptional regulation during neuronal differentiation of embryonic carcinoma P19C6 cells. When P19C6 cells were differentiated into neuronal cells, the expression of Prnp was markedly increased, while CpG methylation was significantly demethylated at the nucleotide region between -599 and -238 from the transcription start site. In addition, when P19C6 cells were applied in a DNA methyltransferase inhibitor, RG108, Prnp transcripts were also significantly increased in relation to the decreased methylation statuses. These findings helped to elucidate the DNA methylation-mediated regulation of Prnp expression during neuronal differentiation.

Localization of insulinoma associated protein 2, IA-2 in mouse neuroendocrine tissues using two novel monoclonal antibodies.

AIMS: Insulinoma-associated protein 2 (IA-2) is a member of the protein tyrosine phosphatase family that is localized on the insulin granule membrane. IA-2 is also well known as one of the major autoantigens in Type 1 diabetes mellitus. IA-2 gene deficient mice were recently established and showed abnormalities in insulin secretion. Thus, detailed localization of IA-2 was studied using wild-type and IA-2 gene deficient mice. MAIN METHODS: To localize IA-2 expression in mouse neuroendocrine tissues, monoclonal antibodies were generated against IA-2 and western blot and immunohistochemical analyses were carried out in IA-2(+/+) mice. IA-2(-/-) mice served as a negative control. KEY FINDINGS: Western blot analysis revealed that the 65 kDa form of IA-2 was observed in the cerebrum, cerebellum, medulla oblongata, pancreas, adrenal gland, pituitary gland, muscular layers of the stomach, small intestine, and colon. By immunohistochemical analysis, IA-2 was produced in endocrine cells in pancreatic islets, adrenal medullary cells, thyroid C-cells, Kulchitsky cells, and anterior, intermediate, and posterior pituitary cells. In addition, IA-2 was found in somatostatin-producing D-cells and other small populations of cells were scattered in the gastric corpus. IA-2 expression in neurites was confirmed by the immunostaining of IA-2 using primary cultured neurons from the small intestine and nerve growth factor (NGF)-differentiated PC12 cells. SIGNIFICANCE: The IA-2 distribution in peripheral neurons appeared more intensely in neurites rather than in the cell bodies.

Adhesion of MRP8/14 to amastigotes in skin lesions of Leishmania major-infected mice.

In murine experimental cutaneous leishmaniasis, parasite infection induces an accumulation of macrophages expressing migration inhibitory factor-related protein 8 (MRP8) and MRP14, two members of the S100 calcium-binding protein family. Although MRP8 and MRP14 are cytoplasmic proteins expressed by myeloid cells, recent studies have demonstrated that MRP8 and MRP14 have extracellular functions such as chemotactic activities. In this study, we examined whether extracellular MRP8 and MRP14 interact with Leishmania parasites during infection. By immunohistochemistry, positive staining by MRP8 and MRP14 was detected on amastigotes in skin lesions of Leishmania major-infected mice. Western blot analysis with amastigotes purified from the skin lesions demonstrated that both of these proteins adhered to amastigotes. The adhesion of MRP14 to amastigotes was reproduced in vitro and enhanced in the presence of Ca2+ and Zn2+. MRP14 adhered to not only amastigotes, but also promastigotes, suggesting receptor molecules for MRP14 are expressed commonly in both developmental stages.

Detection of proteolytic cleavages of diabetes-associated protein IA-2 beta in the pancreas and the brain using novel anti-IA-2 beta monoclonal antibodies.

Insulinoma-associated protein (IA)-2 beta, an inactive member of the protein-tyrosine phosphatase (PTP) family, is a major autoantigen in type-1 diabetes mellitus. IA-2 beta exists mainly in a 60-kDa form, and is frequently located in the dense-core secretory vesicles of pancreatic beta cells. As IA-2 beta gene-deficient mice exhibit impaired insulin secretions, IA-2 beta is probably involved in insulin secretions. In the present study, we characterized the major forms of IA-2 beta in the brain and pancreas of normal and non-obese diabetic (NOD) mice. Novel monoclonal antibodies (mAbs) against IA-2 beta revealed that this brain protein was of multiple compositions incorporating the 60-, 64-, 67- and 71-kDa forms, which were designated as IA-2 beta 60, IA-2 beta 64, IA-2 beta 67 and IA-2 beta 71, respectively. On the contrary, only the 60-kDa isoform of IA-2 beta was expressed in the mouse pancreas and in the mouse pancreatic beta cell line, MIN6. Sequence analyses revealed that IA-2 beta 60, IA-2 beta 64 and IA-2 beta 71 (brain-derived immunoprecipitated IA-2 beta isoforms) contained alternative NH2- termini starting from Glu489, Ala464, and Ser414, respectively, while IA-2 beta 60 (an MIN6-derived immunoprecipitated IA-2 beta isoform) contained those from Glu489. Consistent with the lack of an NH2-terminal region of IA-2 beta, the isoforms were recognized by their respective mAbs characterized with different epitope regions. Furthermore, Western blotting and immunohistochemistry demonstrated that NOD mice expressed similar isoforms present in the brains and pancreatic islets of C57BL/6J, BALC/CA and ICR mice, accordingly. Taken together, these results suggest that IA-2 beta undergoes at least three distinct proteolytic cleavages.

Accumulation of macrophages expressing MRP8 and MRP14 in skin lesions during Leishmania major infection in BALB/c and RAG-2 knockout mice.

Migration inhibitory factor-related protein 8 (MRP8) and MRP14 are expressed by myeloid cells and especially known as marker proteins of an immature and inflammatory subtype of macrophages. In this study, we immunohistochemically examined an accumulation of MRP8+ and MRP14+ macrophages in skin lesions during Leishmania major infection in susceptible BALB/c and RAG-2-/- mice. L. major infection caused the development of a nodular type of skin lesion at the infection site in mice and a massive accumulation of macrophages was observed in the lesions at four weeks after the infection. Immunohistochemical analyses showed MRP8+ and MRP14+ macrophages are predominant cell types in the skin lesions in both mouse strains. In contrast, F4/80+ cells, which correspond to mature macrophages, were rarely found in the skin lesions. These data suggest that the accumulation of inflammatory subtype of macrophages in BALB/c mice during L. major infection can be induced without acquired immune responses.

Activation of phosphatidylinositol 3-kinase by cellular prion protein and its role in cell survival.

The cellular prion protein (PrP(C)) is thought to be involved in protection against cell death, however the exact cellular mechanisms involved are still controversial. Herein we present data that strongly indicate a functional link between PrP(C) expression and phosphatidylinositol 3-kinase (PI 3-kinase) activation, a protein kinase that plays a pivotal role in cell survival. Both mouse neuroblastoma N2a cells and immortalized murine hippocampal neuronal cell lines expressing wild-type PrP(C) had significantly higher PI 3-kinase activity levels than their respective controls. Moreover, PI 3-kinase activity was found to be elevated in brain lysates from wild-type mice, as compared to prion protein-knockout mice. Recruitment of PI 3-kinase by PrP(C) was shown to contribute to cellular survival toward oxidative stress by using 3-morpholinosydnonimine (SIN-1) and serum deprivation. Moreover, both PI 3-kinase activation and cytoprotection by PrP(C) appeared to rely on copper binding to the N-terminal octapeptide of PrP(C). Thus, we propose a model in which the interaction of copper(II) with the N-terminal domain of PrP(C) enables transduction of a signal to PI 3-kinase; the latter, in turn, mediates downstream regulation of cell survival.

Serum thymic factor prevents LPS-induced pancreatic cell damage in mice via up-regulation of Bcl-2 expression in pancreas.

The protective effect of synthetic serum thymic factor (FTS) nonapeptide on lipopolysaccharide (LPS)-induced pancreatic cell damage in 10-week-old BALB/c male mice was investigated. Mice were divided into three groups. Group I was treated with LPS (10 micro g/head; i.p.) (LPS-treated mice). Group II was administered with FTS (50 micro g/head; i.p.) 24 hr before treatment with LPS and complemented immediately before LPS injection with FTS (50 micro g/head; i.p.) (FTS-administered mice). Group III was only treated with the same volume of saline (control mice). Treatment of LPS in vivo resulted in the destruction of pancreatic acinar cells. In those cells, many apoptotic cells were detected by immunohistochemistry using an anti-single stranded DNA antibody. Immunohistochemistry and reverse transcription-polymerase chain reaction (RT-PCR) revealed that LPS treatment also caused low or a lack of insulin expression in pancreatic islets. In contrast, morphological change was not seen and apoptotic cell death was suppressed in pancreatic cells of FTS-administered mice. Moreover, insulin expression was normal in those mice. FTS administration enhanced expression of Bcl-2 mRNA levels in pancreatic tissues and IL-6 mRNA levels in splenocytes significantly compared with those of LPS treatment at 3 hr after LPS injection. These findings suggest that FTS prevents LPS-induced cell damage via enhancing Bcl-2 expression in the pancreas and systemic IL-6 production.

Hyperbaric oxygen enhances the expression of prion protein and heat shock protein 70 in a mouse neuroblastoma cell line.

1. Cellular prion protein, PrP(C), is a ubiquitous glycoprotein strongly expressed in neurons with an as yet unknown biological function. In previous studies, we demonstrated that PrP(C) could be regulated by heat shock stress, implying that it might be a stress-responsive protein. Hyperbaric oxygen (HBO) administration is a well-defined model for the study of oxidative stress. 2. This study investigated the effect of HBO on PrP(C) and Hsp 70 expression in mouse neuroblastoma cell lines (N18), assessing the expression of PrP(C) and Hsp 70 using RT-PCR and Western blotting. HBO administration resulted in a time- and dose-dependent increase in PrP(C) and Hsp70 expression in N18 cells at both mRNA and protein levels, with a concomitant upregulation of c-Jun N-terminal kinase (JNK). 3. Under HBO treatment, luciferase reporter constructs of the rat PrP(C) promoter, containing the heat shock element (HSE) also present in Hsp70, expressed higher luciferase activity (3- to 10-fold) than those constructs without HSE. 4. In summary, these data suggest that PrP(C) and Hsp 70 may be regulated by HBO, through the activation of JNK. Thus, the activated heat shock transcriptional factor 1, phosphorylated by JNK interacted with HSE in the promoter of PrP(C) resulted in increased gene expression. These findings are vital for future therapeutic approaches in transmissible spongiform encephalopathies and the understanding of the function of the PrP(C).

Effects of tacrolimus (FK506) on encephalomyocarditic virus-induced diabetes in mice.

The effects of tacrolimus on insulin-dependent diabetes mellitus (IDDM) induced by the D-variant of encephalomyocarditis virus (D-EMCV) have been investigated. Male BALB/c mice were treated with tacrolimus before viral inoculation, and then were inoculated with 10 plaque forming units (PFU) of DEMCV. The mice continued to be treated with tacrolimus until the animals were sacrificed. D-EMCV-infected mice, which were treated with saline as controls, showed abnormal glucose tolerance test (GTT) values, whereas all infected mice with tacrolimus pretreatment were normal on 7 days-post inoculation (DPI). Histological observations revealed that non-treated tacrolimus D-EMCV-infected mice and which developed diabetes showed severe insulitis in their islets of Langerhans. On the other hand, D-EMCV-infected mice treated with tacrolimus were normal. In D-EMCV-infected mice, viruses in the pancreata were detected at the same level regardless of treatment with tacrolimus or saline. Expressions of TNF-alpha and IFN-gamma mRNA in spleens of tacrolimus-treated D-EMCV-infected mice were lower than that of non-treated tacrolimus DEMCV-infected mice on 7 DPI. The results suggest that tacrolimus suppresses expressions of TNF-alpha and IFN-gamma mRNAs to prevent the onset of D-EMCV-induced IDDM.

Suppressor mechanism of serum thymic factor on tumor necrosis factor-alpha-induced apoptosis in the mouse pancreatic beta-cell line.

Tumor necrosis factor-alpha (TNF-alpha) is a cytokine considered to play a key role in beta-cell destruction in insulin-dependent diabetes mellitus (IDDM). Serum thymic factor (Facteur thymique serique; FTS) is a nonapeptide thymus hormone known to inhibit IDDM in a mouse model. In this study, the effect of TNF-alpha on the murine pancreatic beta-cell line MIN6 was examined. Cell shrinkage and detachment were seen in cells treated with 0-50 ng/ml TNF-alpha for 12h. Oligonucleosomal DNA fragmentation was determined from non-adherent cells, indicating that the TNF-alpha-induced cell destruction was attributed to apoptosis. Fragmented DNA was quantified by enzyme-linked immunosorbent assay to measure the amount of histone-bound oligonucleosomes. FTS was treated with TNF-alpha and the percentage of fragmented DNA was analyzed. The data indicate a distinct reduction of fragmented DNA at a concentration of 1 ng/ml FTS. Expression of TNF receptor I, inducible form of nitric oxide synthase (iNOS), interleukin-1 beta-converting enzyme (ICE), Bcl-2, and nuclear factor kappa B (NF-kappa B) was analyzed by reverse transcriptase-polymerase chain reaction to investigate the suppressor mechanism of FTS on TNF-alpha-induced apoptosis. FTS treatment suppressed the expression of iNOS and Bcl-2 mRNA in TNF-alpha-treated cells. The expression of NF-kappa B mRNA in TNF-alpha-treated cells was enhanced after FTS treatment, while that of ICE mRNA did not change in TNF-alpha-treated cells with or without FTS treatment. These results suggest that the inhibition of MIN6 cell death by FTS on TNF-alpha-induced apoptosis is caused by a negative feedback mechanism involving the inhibition of iNOS induction.

Tumor necrosis factor attenuates prion protein-deficient neuronal cell death by increases in anti-apoptotic Bcl-2 family proteins.

Prion protein gene (Prnp)-deficient(Prnp(-/-)) neuronal cells are more susceptible to serum deprivation compared to Prnp(+/+) neuronal cells. However, little is known about the cell death of Prnp(-/-) neuronal cells under serum deprivation. In this study, as a known neuroprotective agent we analyzed the effect of tumor necrosis factor-alpha (TNF-alpha) on the cell death of Prnp(-/-) neuronal cells. Although expression of Bcl-2 and Bcl-x(L) decreased in a time-dependent manner under serum deprivation, treatment with TNF-alpha protected Prnp(-/-) neuronal cells from serum deprivation with an increase in anti-apoptotic proteins Bcl-2 and Bcl-x(L). Nuclear morphological analysis using fluorescence microscopy and flow cytometry analysis showed that gene transfer of bcl-2 or bcl-x(L) significantly inhibited apoptosis induced by serum deprivation. These findings indicate that TNF-alpha attenuated cell death of Prnp(-/-) neuronal cells by induction of Bcl-2 and Bcl-x(L),and that decreases in Bcl-2 and Bcl-x(L) played crucial roles in the apoptosis of Prnp(-/-) neuronal cells.

Impairment of superoxide dismutase activation by N-terminally truncated prion protein (PrP) in PrP-deficient neuronal cell line.

Previous studies have reported a neuroprotective role for cellular prion protein (PrP(C)) against apoptosis induced by serum deprivation in an immortalized prion protein gene (Prnp)-deficient neuronal cell line, but the mechanisms remain unclear. In this study, to investigate the mechanisms by which PrP(C) prevents apoptosis, the authors compared apoptosis of Prnp(-/-) cells with that of Prnp(-/-) cells expressing the wild-type PrP(C) or PrP(C) lacking N-terminal octapeptide repeat region under serum-free conditions. Re-introduction of Prnp rescued cells from apoptosis, upregulated superoxide dismutase (SOD) activity, enhanced superoxide anion elimination, and inhibited caspase-3/9 activation. On the other hand, N-terminally truncated PrP(C) enhanced apoptosis accompanied by potentiation of superoxide production and caspase-3/9 activation due to inhibition of SOD. These results suggest that PrP(C) protects Prnp(-/-) cells from apoptosis via superoxide- and caspase-3/9-dependent pathways by upregulating SOD activity. Furthermore, the octapeptide repeat region of PrP(C) plays an essential role in regulating apoptosis and SOD activity.

Molecular modulation of expression of prion protein by heat shock.

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrP(Sc). The conversion of PrP(C) to PrP(Sc) is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP70) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.