Intracranial aneurysm as a possible complication of osteogenesis imperfecta: a case series and literature review.

Osteogenesis imperfecta (OI) is an inherited disease characterized by bone fragility due to impaired type I collagen. Although orthopedic management is improving, other complications are poorly understood. We describe three patients with OI with unruptured intracranial aneurysm (IA) detected by magnetic resonance angiography (MRA) screening of 14 patients. Case 1 was a 73-year-old woman with type 1 OI with blue sclera, vertebral compression fractures, and impaired hearing. Lumbar spine bone mineral density (BMD) was preserved (young adult mean (YAM): 86%). MRA revealed an IA in the right internal carotid artery. Case 2 was a 43-year-old man with type 4 OI and leg-length discrepancy due to left femoral neck fracture. Lumbar spine BMD was decreased (YAM: 61%). MRA showed an IA in the left anterior cerebral artery. Case 3 was a 35-year-old woman with type 3 OI with blue sclera, dentinogenesis imperfecta, deformity of the long bones, and severe scoliosis. She had undergone spine surgery and needed wheelchair assistance. The YAM of the femoral neck BMD was 71%. MRA indicated an IA in the right posterior communicating artery. The prevalence of IA in our series of patients with OI was 21%, which is higher than the reported prevalence of unruptured IA in the Japanese general population (2.2%), suggesting that IA may be a complication of OI. Our literature review revealed no cases of OI with unruptured IA, but 11 cases of OI with subarachnoid hemorrhage. IA seems unrelated to OI type, sex, or age. We recommend MRA of adults with OI.

Clinical performance of a novel chemiluminescent enzyme immunoassay for FGF23.

INTRODUCTION: Measurement of fibroblast growth factor 23 (FGF23) has been reported to be clinically useful for the differential diagnosis of chronic hypophosphatemia. However, assays for research use only are available in Japan. Thus, the objective of this study was to examine the clinical utility of a novel and automated chemiluminescent enzyme immunoassay for the measurement of FGF23. MATERIALS AND METHODS: Participants were recruited from July 2015 to January 2017 at six facilities in Japan. Thirty-eight patients with X-linked hypophosphatemic rickets (XLH 15 males, 23 females, age 0-66 years), five patients with tumour-induced osteomalacia (TIO 3 males, 2 females, age 60-73 years), and twenty-two patients with hypophosphatemia (11 males, 11 females, age 1-75 years) caused due to other factors participated in this study. RESULTS: With the clinical cut-off value of FGF23 at 30.0 pg/mL indicated in the Diagnostic Guideline of Rickets/Osteomalacia in Japan, the sensitivity and specificity of FGF23-related hypophosphatemic rickets/osteomalacia without vitamin D deficiency (disease group-1) were 100% and 81.8%, respectively, which distinguished it from non-FGF23-related hypophosphatemia (disease group-2). Furthermore, the diagnostic sensitivity of FGF23-related hypophosphatemia with vitamin D deficiency remained at 100%. Among the four patients with FGF23 levels ≥ 30.0 pg/mL in disease group-2, two patients with relatively higher FGF23 values were suspected to have genuine FGF23-related hypophosphatemia, due to the ectopic production of FGF23 in pulmonary and prostate small cell carcinomas. CONCLUSION: The novel FGF23 assay tested in this study is useful for the differential diagnosis of hypophosphatemic rickets/osteomalacia in a clinical setting.

Interim Analysis of a Phase 2 Open-Label Trial Assessing Burosumab Efficacy and Safety in Patients With Tumor-Induced Osteomalacia.

Patients with tumor-induced osteomalacia (TIO), an acquired paraneoplastic condition characterized by osteomalacia due to hypophosphatemia, exhibit a similar clinical picture to those with X-linked hypophosphatemic rickets/osteomalacia (XLH). The human monoclonal anti-fibroblast growth factor 23 (FGF23) antibody burosumab (KRN23) increases serum phosphate and improves bone turnover, fracture healing, pain, and physical function in XLH patients by inhibiting circulating FGF23; thus, burosumab is expected to be an effective treatment for TIO. We report here an interim analysis of a multicenter, open-label, intraindividual dose-adjustment study of burosumab (0.3 to 2.0 mg/kg every 4 weeks) in Japanese and Korean TIO patients. The primary endpoint was the fasting serum phosphate level at each visit. Key secondary endpoints were changes over time in bone biomarkers, pharmacodynamic markers, bone histomorphometric parameters, motor function, and patient-reported outcomes. Safety was assessed based on treatment-emergent adverse events (TEAEs). Thirteen patients received burosumab treatment, of whom 4 underwent bone biopsy. The mean dose after week 112 was approximately 1.0 mg/kg. After the first burosumab administration, mean serum phosphate levels increased and remained above the lower limit of normal and in the normal range from weeks 14 to 112. Bone biomarkers initially increased, reaching maximum values at week 16 or 24, and then gradually decreased. After burosumab treatment, patients were able to walk further (evaluated by the 6-minute walk test), reported decreased pain levels, and showed a tendency toward healing of baseline fractures and pseudofractures. Two patients discontinued, one each due to disease progression and consent withdrawal. Burosumab was generally well tolerated, with no treatment-related TEAEs of grade ≥3 and no treatment-related serious AEs. In conclusion, the interim results of this first study of burosumab to treat TIO patients indicate that this drug has the potential to provide clinical benefit for patients with unresectable tumors. The full study results are eagerly anticipated. © 2020 The Authors. Journal of Bone and Mineral Research published by Wiley Periodicals LLC on behalf of American Society for Bone and Mineral Research (ASBMR)..

Monthly intravenous alendronate treatment can maintain bone strength in osteogenesis imperfecta patients following cyclical pamidronate treatment.

Objectives Osteogenesis imperfecta (OI) is a skeletal dysplasia characterized by recurrent fractures due to congenital bone fragility. The only bisphosphonate approved for OI in Japan is pamidronate (PAM). To investigate whether monthly intravenous alendronate (ALN) infusions can maintain bone strength in OI children following cyclical PAM treatment. Methods A prospective and non-inferiority study was conducted. Eight school-age OI patients aged 8.5±2.0 years who were treated with cyclical PAM for 6.0±2.3 years were enrolled and switched to monthly intravenous ALN (0.030 mg/kg/month). Changes in L1-4 bone mineral density (BMD) Z-scores, fracture rates, and bone turnover markers for 12 months were analyzed. Results Average BMD Z-scores were -3.0±1.9, -2.9±2.0, and -2.2±2.0 in 12 months before enrollment, at enrollment, and after 12 months of ALN treatment, respectively. BMD Z-scores increased significantly during treatment with both PAM and ALN (p=0.012), and the effect of ALN was not inferior to that of PAM (p=0.67). There was no change in fracture rates (p=0.86) and bone turnover markers during the 12 months before and after enrollment. Additionally, ALN showed no remarkable side effects. Conclusions Our results suggest that monthly intravenous ALN can maintain bone strength after primary usage of cyclical PAM. We concluded that monthly intravenous ALN as a maintenance treatment following cyclical PAM administration can be an option for OI children.

First-in-Asian Phase I Study of the Anti-Fibroblast Growth Factor 23 Monoclonal Antibody, Burosumab: Safety and Pharmacodynamics in Adults With X-linked Hypophosphatemia.

X-linked hypophosphatemia (XLH) is a disease caused by abnormally elevated FGF23 levels, which cause persistent hypophosphatemia accompanied by subsequent reduction in bone mineralization that presents as rickets or osteomalacia. Burosumab is a fully human monoclonal antibody targeting FGF23 that is under development for the treatment of FGF23-related hypophosphatemia including XLH. The safety, tolerability, and proof of concept of burosumab have been evaluated in patients with XLH in previous studies conducted in countries outside of Asia. The objective of this study was to evaluate the safety, tolerability, pharmacokinetics (PK), pharmacodynamics (PD), and expression of anti-drug antibodies in Japanese and Korean adults with XLH. This was a multicenter, sequential dose-escalation, open-label, single-dose study. This study began with cohort 1 (s.c. dose of burosumab 0.3 mg/kg), after which the dose was escalated sequentially in cohort 2 (s.c. dose of burosumab 0.6 mg/kg) and cohort 3 (s.c. dose of burosumab 1.0 mg/kg). The PK of burosumab were linear within the dose range of 0.3 to 1.0 mg/kg. The PD effects such as serum phosphorus concentration, serum 1,25[OH]2D3 concentration, and ratio of tubular maximum reabsorption rate of phosphate to glomerular filtration rate (TmP/GFR) were elevated after a single s.c. administration. The area under the receiver-operating characteristic curve from 0 to t (AUC0-t) values calculated using the change from baseline values of serum phosphorus, serum 1,25(OH)2D3, and TmP/GFR were correlated with the AUC0-t of burosumab. Furthermore, no serious adverse events (AEs), deaths, remarkable increase or decrease in the corrected calcium or intact PTH levels, or signs of nephrocalcinosis or its worsening were observed after treatment. Some AEs and drug-related AEs were observed; however, there were no clinically meaningful tendencies. The positive effects and acceptable safety profile seen in this study are encouraging for Japanese and Korean patients with XLH.

Incidence of diabetes mellitus and neoplasia in Japanese short-statured children treated with growth hormone in the Genetics and Neuroendocrinology of Short Stature International Study (GeNeSIS).

The primary goal of the Genetics and Neuroendocrinology of Short Stature International Study (GeNeSIS) was to assess the safety and effectiveness of Humatrope®, a GH preparation, in the treatment of pediatric patients with short stature. We report our findings in the GH-treated Japanese pediatric population focusing on the incidence of type 2 diabetes (T2D) and occurrence of neoplasms. A total of 2,345 Japanese patients were assessed for safety. During a mean observation period of 3.2 yr, T2D occurred in 3 patients (0.13%) and slowly progressive insulin-dependent diabetes mellitus (SPIDDM) related to underlying mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) in 1 patient (0.04%). Neoplasms were reported in 13 patients (0.56%), including 1 patient with brain tumor (germinoma) and 5 with craniopharyngiomas (4 recurrences); the remainder were benign, typically dermatological, neoplasms. The incidence of diabetes mellitus determined in the study did not differ from previous reports in GH-treated pediatric patients, and there was no apparent increase in the risk of new neoplastic lesions or malignant tumors.

Final adult height in long-term growth hormone-treated achondroplasia patients.

The objective of this study was to evaluate the gain in final height of achondroplasia (ACH) patients with long-term growth hormone (GH) treatment. We analyzed medical data of 22 adult patients (8 males and 14 females) treated with GH at a dose of 0.05 mg/kg/day. Optionally, tibial lengthening (TL) was performed with the Ilizalov method in 15 patients and TL as well as femoral lengthening (FL) in 6 patients. Concomitant gonadal suppression therapy with buserelin acetate was applied in 13 patients. The mean treatment periods with GH were 10.7 ± 4.0 and 9.3 ± 2.5 years for males and females, respectively. GH treatment augmented the final height +0.60 ± 0.52 SD (+3.5 cm) and +0.51 ± 1.29 SD (+2.8 cm) in males and females compared to non-treated ACH patients, respectively. Final height of ACH patients that underwent GH and TL increased +1.72 ± 0.72 SD (+10.0 cm) and +1.95 ± 1.34 SD (+9.8 cm) in males and females, respectively. GH, TL, and FL increased their final height +2.97 SD (+17.2 cm) and +3.41 ± 1.63 SD (+17.3 cm) in males and females, respectively. Gonadal suppression therapy had no impact on final height. CONCLUSIONS: Long-term GH treatment contributes to 2.6 and 2.1% of final adult height in male and female ACH patients, respectively.

Onset of puberty and near adult height in short children born small for gestational age and treated with GH: Interim analysis of up to 10 years of treatment in Japan.

The safety and effectiveness of long-term (10-yr) GH treatment in short Japanese children born small for gestational age (SGA) were evaluated based on interim data analysis from a clinical study, including the findings concerning the influence on the onset of puberty and subjects who achieved near adult height (NAH). Sixty-one subjects were analyzed at baseline in this study. Eleven subjects (6 boys and 5 girls) achieved NAH (mean 157.4 cm and 145.5 cm, respectively), and the Δ height SDS from the start of GH treatment was +1.6 in boys and +1.8 in girls. The median age (yr) at onset of puberty was 11.4 in boys and 9.9 in girls, comparable to healthy children. However, the mean height (cm) at onset of puberty (137.0 in boys; 125.5 in girls) was shorter than that of healthy children. Treatment-related adverse events were generally mild to moderate in severity; however, adenoidal hypertrophy was observed in two subjects as a serious adverse event. One subject had jaw malformation related to GH treatment at a dose of 0.067 mg/kg/d. No notable changes in HbA1c levels were observed, and the levels remained within the reference range. We have confirmed the safety and effectiveness of long-term GH treatment through this ongoing clinical study.

A case of autosomal dominant osteopetrosis type II with a novel TCIRG1 gene mutation.

Osteopetrosis is a rare genetic disorder characterized by increased bone mineral density (BMD) due to osteoclast failure. T-cell immune regulator 1 (TCIRG1) plays crucial roles on osteoclast function, and its mutation causes autosomal recessive osteopetorosis. However, mutations in TCIRG1 have never been identified in autosomal dominant osteopetrosis (ADO). A 3-year-old boy was first presented to the clinic because of spontaneous radius and femur fractures. He has optic atrophy. The areal BMD at the lumbar spine was 1274 g/cm2 (233% of normal). Laboratory tests revealed no remarkable abnormal findings, including anemia, except for extremely elevated serum tartrate-resistant acid phosphatase-5b (14,600 mU/dL). Radiographically, the skull base, pelvis, and vertebrae showed a focal sclerosis. Genetic analysis revealed a novel de novo heterozygous missense mutation (His242Arg). Taken together with the mutation, his mild clinical features were diagnosed as ADO. This case implies that TCIRG1 could become a genetic candidate for ADO in addition to malignant forms such as ARO.

An observational study of the effectiveness and safety of growth hormone (Humatrope(®)) treatment in Japanese children with growth hormone deficiency or Turner syndrome.

This study assessed the effectiveness and safety of growth hormone (GH; Humatrope(®)) therapy in Japanese children with GH deficiency (GHD) or Turner syndrome (TS) enrolled in the Genetics and Neuroendocrinology of Short Stature International Study (GeNeSIS). GeNeSIS is an open-label, multinational, multicenter, observational study conducted in 30 countries. In this interim report, there were 1129 GH treatment-naïve children with GHD, with a mean chronological age (± standard deviation) of 8.75 (3.32) years, and 90 girls with TS, with a mean chronological age of 8.93 (3.67) years. The mean height standard deviation score (SDS) increased from -2.73 (0.63) SD and -2.71 (0.63) SD at study entry to -2.22 (0.68) SD and -2.20 (0.60) SD after 1 year of treatment in the GHD and TS groups, respectively. In both groups, mean height SDS increased further with each year of treatment to 4 years; however, the magnitude of change in height SDS declined with time. The mean insulin-like growth factor-I SDS increased from below the mean of the reference population at study entry to a level similar to (GHD group) or higher than (TS group) the mean of the reference population during the 4-year treatment period. The incidence of serious adverse events (AEs), treatment-related AEs, and AEs related to glucose intolerance was low in both groups (0.1% to 3.0%). In conclusion, GH treatment in Japanese children with GHD or TS resulted in increased growth over a 4-year treatment period with a favorable safety profile; however, the improvements in growth declined with time.

[Updated treatment of achondroplasia].

In achondroplasia, the mutation is an almost non-variable mutation in the transmembrane part of the receptor, G1138A/C, giving rise to a change in the amino acid sequence at position 380 in the protein (glycine to an arginine residue transition- Gly380Arg [G380R] . In hypochondroplasia, about 30-70% of individuals have been reported to be heterozygous for a mutation in the FGFR3 gene. The most common mutation found is the Asn540Lys (asparagine to lysine transition-N540K) in the intracellular tyrosine-kinase (TK1) region. GH Treatment significantly increased height, growth velocity and z-score of growth velocity GH therapy was more effective in hypochondroprasia than in achondroplasia. Increasing stature in individuals with skeletal dysplasias can also be accomplished by surgical leg lengthening.

Impaired pyridinoline cross-link formation in patients with osteogenesis imperfecta.

Patients with osteogenesis imperfecta (OI) show various degrees of bone fragility. Nevertheless, details of the mechanisms causing bone fragility remain unclear. We hypothesized that differences in pyridinoline cross-link formation at the N-and C-termini in type I collagen molecules partly contribute to bone fragility of OI. To verify this hypothesis, urinary N and C terminal telopeptides of type I collagen (uNTx and ubetaCTx, respectively) and urinary hydroxyproline (uHyp) were measured using second morning void urine samples obtained from OI patients and healthy control children. Ratios of uNTx and ubetaTx to uHyp (uNTx/uHyp and ubetaCTx/uHyp, respectively) of OI patients and healthy normal control children were analyzed. Ratios of uNTx to ubetaCTx (uNTx/ubetaCTx) were also analyzed. In OI patients, uNTx and ubetaCTx were lower than in healthy control children. Also, uNTx/uHyp and ubetaCTx/uHyp were significantly lower than in healthy children. Among OI patients, uNTx/uHyp and uNTx/ubetaCTx of type III OI were significantly lower than of either type I or type IV OI. These results show that pyridinoline cross-link formation is lower than in healthy control children and that pyridinoline cross-link formation at the N-and C-termini in type I collagen molecules might be differently disrupted in OI patients according to the severity of OI.

Sustained phosphorylation of mutated FGFR3 is a crucial feature of genetic dwarfism and induces apoptosis in the ATDC5 chondrogenic cell line via PLCgamma-activated STAT1.

The most frequent type of rhizomelic dwarfism, achondroplasia (ACH), is caused by mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. Mutations in FGFR3 result in skeletal dysplasias of variable severity, including mild phenotypic effects in hypochondroplasia (HCH), severe phenotypic effects in thanatophoric dysplasia types I (TDI) and II (TDII), and severe but survivable phenotypic effects in severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN). To explore the molecular mechanisms that result in the different phenotypes, we investigated the kinetics of mutated versions of FGFR3. First, we assayed the phosphorylation states of the mutated FGFR3s and found that the level of phosphorylation in TDI-FGFR3 was lower than in ACH-FGFR3, although the other mutants were phosphorylated according to phenotypic severity. Second, we analyzed the duration of the phosphorylation. TDI-FGFR3 was not highly phosphorylated under ligand-free conditions, but the peak phosphorylation levels of TDI-FGFR3 and ACH-FGFR3 were maintained for 30 min after stimulation with FGF-1. Moreover, ligand-dependent phosphorylation of TDI-FGFR3, but not ACH-FGFR3, lasted for more than 8 h after FGF-1 administration. The other mutant proteins showed sustained phosphorylation independent of ligand presence. Third, we investigated the intracellular localization of the mutant proteins. Immunofluorescence analysis showed accumulations of TDII-FGFR3, SADDAN-FGFR3, and a portion of TDI-FGFR3 in the endoplasmic reticulum (ER). Based on these data, we concluded that sustained phosphorylation of FGFR3 causes chondrodysplasia, and the phenotypic severity depends on the proportion of ER-localized mutant FGFR3. In FGFR3 signaling, the transcription factor, signal transducer and activator of transcription 1 (STAT1) inhibit proliferation and induce apoptosis of chondrocytes. Here we reveal that phospholipase C gamma (PLCgamma) mediates FGFR3-induced STAT1 activation. Both PLCgamma and STAT1 were activated by FGFR3 signaling, but a dominant-negative form of PLCgamma (DN-PLCgamma) remarkably reduced STAT1 phosphorylation. Apoptosis assays revealed that the constitutively active forms of FGFR3 (TDII-FGFR3) and STAT1 (STAT1-C) induce apoptosis of chondrogenic ATDC5 cells via caspase activity. DN-PLCgamma reduced the apoptosis of ATDC5 cells expressing TDII-FGFR3, but over-expression of both DN-PLCgamma and STAT1-C induced apoptosis. Therefore, we conclude that a PLCgamma-STAT1 pathway mediates apoptotic signaling by FGFR3.

PTH has the potential to rescue disturbed bone growth in achondroplasia.

INTRODUCTION: Achondroplasia (Ach), the most common form of short-limb short stature, and related disorders are caused by constitutively active point mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. Recent studies have provided a large body of evidence for the role of the proliferation and differentiation of chondrocytes in these disorders. Furthermore, a G380R mutation in FGFR3 (FGFR3(Ach)), which results in achondroplasia, induces apoptosis in the chondrogenic cell line ATDC5. This is associated with a decrease in the expression of PTHrP, which shares the same receptor with PTH, and it is significant that PTHrP rescues these cells from apoptosis. METHODS: Fetuses derived from transgenic mice expressing FGFR3(Ach) under the control of the type II collagen promoter (AchTG) or from wild-type mice were obtained on the 15th day of pregnancy. The femurs were collected from these specimens and cultured for 4 days with PTH. The effects of PTH treatment were then determined by morphometric and histological analyses, in situ hybridization of type X collagen mRNA, and the TUNEL assay. RESULTS: AchTG femurs showed suppressed growth compared with wild type (0.29+/-0.10 mm vs. 0.46+/-0.06 mm, respectively; p<0.05), particularly in cartilage. PTH treatments improved the growth velocity in the femurs of the AchTG (0.50+/-0.06 mm; p<0.01 vs. control). This was associated with the inhibition of both differentiation and apoptosis in chondrocytes. CONCLUSIONS: Our data suggest that PTH inhibits differentiation and apoptosis in chondrocytes and improves bone growth. These effects thus counterbalance the effects of FGFR3 mutations. PTH therefore is a potential therapeutic agent for achondroplasia.

An effective case of growth hormone treatment on cartilage-hair hypoplasia.

Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.

Comparison of two methods for evaluating bone marrow metastasis of neuroblastoma: Reverse transcription-polymerase chain reaction for tyrosine hydroxylase and magnetic resonance imaging.

BACKGROUND: The presence of bone marrow (BM) metastasis and circulating tumor cells in patients with neuroblastoma is a significant prognostic factor at diagnosis and might antedate detection of a relapse by other diagnostic studies. In this study, the clinical value of reverse transcription-polymerase chain reaction (RT-PCR) to amplify mRNA for tyrosine hydroxylase (TH) and magnetic resonance imaging (MRI) during the clinical course of patients with advanced neuroblastoma, was evaluated. METHODS: Four patients with Stage 1, 4 or 4S neuroblastoma, were studied. BM and peripheral blood (PB), including peripheral blood stem cell (PBSC), samples were examined for TH mRNA using RT-PCR. Concurrently, MRI detection of BM metastasis was used. RESULTS: In all cases, except one that had no evidence of BM invasion, TH mRNA in BM and PB at diagnosis were positive, and TH mRNA at diagnosis disappeared after chemotherapy. In two cases, although involvement in the neurocentrum BM was detected by MRI, TH mRNA in the iliac crest BM was negative. The pathological area still remained on MRI after intensive therapy. CONCLUSION: RT-PCR for TH mRNA might be the most sensitive method for the detection of occult neuroblastoma cells in BM and PB. However, because invasion of the BM by neuroblastoma may have a focal distribution, sampling errors can occur. Therefore, not only RT-PCR but also MRI, need to be used to rule out marrow involvement, especially at diagnosis and BM relapse.

Activated proliferation of B-cell lymphomas/leukemias with the SHP1 gene silencing by aberrant CpG methylation.

Previously we showed reduced protein and mRNA expression of the SHP1 gene in lymphoma/leukemia cell lines and patient specimens by Northern blot, RT-PCR, Western blot, and immunohistochemical analyses. In this study, aberrant methylation in the SHP1 gene promoter was detected in many B-cell leukemia/lymphoma cell lines as well as in patient specimens, including diffuse large B-cell lymphoma (methylation frequency 93%), MALT lymphoma (82%), mantle cell lymphoma (75%), plasmacytoma (100%) and follicular lymphoma (96%) by methylation-specific PCR, bisulfite sequencing, and restriction enzyme-mediated PCR analyses. The methylation frequency was significantly higher in high-grade MALT lymphoma cases (100%) than in low-grade MALT lymphoma cases (70%), which correlated well with the frequency of no expression of SHP1 protein in high-grade (80%) and low-grade MALT lymphoma (54%). It suggests that the SHP1 gene silencing with aberrant CpG methylation relates to the lymphoma progression. SHP1 protein expression was recovered in B-cell lines after the treatment of the demethylating reagent: 5-aza-2'-deoxycytidine. Transfection of the intact SHP1 gene to the hematopoietic cultured cells, which show no expression of the SHP1 gene, induced growth inhibition, indicating that gene silencing of the SHP1 gene by aberrant methylation plays an important role to get the growth advantage of the malignant lymphoma/leukemia cells. The extraordinarily high frequency (75 to 100%) of CpG methylation of the SHP1 gene in B-cell lymphoma/leukemia patient specimens indicates that the SHP1 gene silencing is one of the critical events to the onset of malignant lymphomas/leukemias as well as important implications for the diagnostic or prognostic markers and the target of gene therapy. These data support the possibility that the SHP1 gene is one of the tumor suppressor genes.

Molecular basis for the treatment of achondroplasia.

Achondroplasia (ACH), the most common form of short-limbed dwarfism, and its related disorders are caused by constitutively activated point-mutated fibroblast growth factor receptor 3 (FGFR3). Recent studies have provided a large body of evidence to prove chondrocyte proliferation and differentiation in these disorders. However, little is known about the possible effects of the FGFR3 mutants on apoptosis of chondrocytes. In the present study, we analyzed apoptosis using a chondrogenic cell line, ATDC5, expressing the FGFR3 mutants causing ACH and thanatophoric dysplasia, which is a more severe neonatal lethal form comprising type I and type II. We found that the introduction of these mutated FGFR3s into ATDC5 cells decreased mRNA expression of parathyroid hormone-related peptide (PTHrP) and induced apoptosis. Importantly, replacement of PTHrP prevented the apoptotic changes in ATDC5 cells expressing ACH mutant. Insulin-like growth factor (IGF)-I, which is an important mediator of growth hormone (GH), also reduced apoptosis in ATDC5 cells expressing ACH mutant. IGF-I prevented apoptosis through the phosphatidylinositol 3-kinase and mitogen-activated protein kinase pathways, indicating the mechanisms by which GH treatment improves disturbed bone growth in ACH.

Prevalence and clinico-epidemiology of familial Graves' disease in Japan based on nationwide epidemiologic survey in 2001.

A nationwide epidemiologic survey of familial Graves' disease (GD) was conducted in 2001. "Familial GD" was defined as a patient who had at least one Graves' patient within the proband's first-degree relatives. The primary survey was performed for estimating the prevalence of patients among a random selection of 2367 departments/hospitals of internal medicine, endocrinology, thyroidology and pediatrics. Of those receiving the primary questionnaire, 1361 (57.5%) responded, and 902 familial GD patients who visited them in 2000 were reported. The total number of patients was estimated to be 2850 (95% confidence intervals: 2100-3600). Based on the nationwide survey concerning the prevalence of hyperthyroidism in 1999, 2.1-3.1% of hyperthyroidism appeared to be familial GD and the relative risk of familial GD was roughly estimated to be 19-42. Subsequently, a second survey was carried out for obtaining the clinicoepidemiologic features of those patients. Of 902 patients, 487 (54%) were reported. No significant differences between familial and non-familial GD were found in age and sex distributions, clinical features or laboratory findings. Familial GD possessed the highest association with Hashimoto's thyroiditis, approximately 8% within the first-degree relatives, suggesting a shared genetic predisposition. These findings confirm the familial clustering of GD in the Japanese population, indicating the importance of environmental factors, genetic factors or both in the development of the disease.