RESUMO
PURPOSE: This study aimed to establish a nomogram using routinely available clinicopathological parameters to predict the pathological response in patients with locally advanced gastric cancer (LAGC) undergoing neoadjuvant treatment. MATERIALS AND METHODS: We conducted this study based on the ongoing Neo-CRAG trial, a prospective study focused on preoperative treatment in patients with LAGC. A total of 221 patients who underwent surgery following neoadjuvant chemotherapy (nCT) or neoadjuvant chemoradiotherapy (nCRT) at Sun Yat-sen University Cancer Center between June 2013 and July 2022 were included in the analysis. We defined complete or near-complete pathological regression and ypN0 as good response (GR), and determined the prognostic value of GR by Kaplan-Meier survival analysis. Eventually, a nomogram for predicting GR was developed based on statistically identified predictors through multivariate logistic regression analysis and internally validated by the bootstrap method. RESULTS: GR was confirmed in 54 patients (54/221, 24.4%). Patients who achieved GR had a longer progression-free survival and overall survival. Then, five independent factors, including pretreatment tumor differentiation, clinical T stage, monocyte count, CA724 level, and the use of nCRT, were identified. Based on these predictors, the nomogram was established with an area under the curve (AUC) of 0.777 (95% CI, 0.705-0.850) and a bias-corrected AUC of 0.752. CONCLUSION: A good pathological response after neoadjuvant treatment was associated with an improved prognosis in LAGC patients. The nomogram we established exhibits a high predictive capability for GR, offering potential value in devising personalized and precise treatment strategies for LAGC patients.
Assuntos
Nomogramas , Neoplasias Gástricas , Humanos , Terapia Neoadjuvante/métodos , Estudos Prospectivos , Neoplasias Gástricas/tratamento farmacológicoRESUMO
PURPOSE: The aim of this study was to investigate the treatment results and long-term quality of life in patients with early-stage extranodal natural killer/T-cell lymphoma who were prospectively treated with simultaneous boost intensity modulated radiation therapy (SIB-IMRT) with 3 dose gradients. METHODS AND MATERIALS: Sixty patients with stage I-II nasal cavity natural killer/T-cell lymphoma (NKTCL) and Waldeyer's ring NKTCL were enrolled in a single-arm, prospective, phase 2 clinical trial from August 2011 to April 2015. All patients were treated with definitive radiation therapy combined with short-course induction chemotherapy. A newly designed SIB-IMRT scheme was uniformly adopted, with 54.6 Gy for the gross tumor volume (GTV) of the primary tumor and GTV of the positive lymph nodes, 50.7 Gy for the high-risk clinical target volume (CTV), and 45.5 Gy for the low-risk CTV, all delivered in 26 daily fractions. Before SIB-IMRT, L-asparaginase-based induction chemotherapy was used in 95.0% (57/60) of patients. RESULTS: With a median follow-up time of 95.8 months, the 5-year locoregional recurrence-free survival, progression-free survival, and overall survival rates were 83.3%, 81.7%, and 88.3%, respectively. Dosimetric analysis in the first 21 patients showed satisfying conformality for planning target volume of GTV, high-risk CTV, and low-risk CTV, while the organs at risk were well protected. The results of long-term quality-of-life investigations in patients without progression were favorable, and nasal discomfort was the most common symptom. No grade 3 or 4 acute or late toxicities were observed. CONCLUSIONS: The scheme of target volume delineation and dose setting that we designed has favorable clinical effects with mild side effects in treating patients with stage I-II nasal cavity NKTCL and Waldeyer's ring NKTCL.
Assuntos
Linfoma Extranodal de Células T-NK , Radioterapia de Intensidade Modulada , Humanos , Radioterapia de Intensidade Modulada/métodos , Qualidade de Vida , Estudos Prospectivos , Dosagem Radioterapêutica , Linfoma Extranodal de Células T-NK/radioterapia , Linfoma Extranodal de Células T-NK/tratamento farmacológico , Células Matadoras NaturaisRESUMO
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
BACKGROUND: To explore the hematological toxicity (HT) induced by neoadjuvant chemoradiotherapy (nCRT) compared with neoadjuvant chemotherapy (nCT) and to identify the appropriate vertebral body (VB) dosimetric parameters for predicting HT in patients with locally advanced gastric cancer (GC). METHODS: In the phase III study, 302 patients with GC from an ongoing multi-center randomized clinical trial (NCT01815853) were included. Patients from two major centers were grouped into training and external validation cohorts. The nCT group received three cycles of XELOX chemotherapy, while the nCRT received the same dose-reduced chemotherapy plus 45 Gy radiotherapy. The complete blood counts at baseline, during neoadjuvant treatment, and in the preoperative period were compared between the nCT and nCRT groups. The VB was retrospectively contoured and the dose-volume parameters were extracted in the nCRT group. Patients' clinical characteristics, VB dosimetric parameters, and HTs were statistically analyzed. Instances of HT were graded according to the Common Terminology Criteria for Adverse Events v5.0 (CTCAE v5.0). The receiver operating characteristic (ROC) curves were generated to identify the optimal cut-off points for dosimetric variables and verify the prediction efficiency of the dosimetric index in both training and external validation cohorts. RESULTS: In the training cohort, 27.4% Grade 3 + HTs were noted in the nCRT group and 16.2% in the nCT group (P = 0.042). A similar result was exhibited in the validation cohort, with 35.0% Grade 3 + HTs in the nCRT group and 13.2% in the nCT group (P = 0.025). The multivariate analysis of the training cohort revealed that V5 was associated with Grade 3 + leukopenia (P = 0.000), Grade 3 + thrombocytopenia (P = 0.001), and Grade 3 + total HTs (P = 0.042). The Spearman correlation analysis identified a significant correlation of V5 with the white blood cell nadir (P = 0.0001) and platelet nadir (P = 0.0002). The ROC curve identified the optimal cut-off points for V5 and showed that V5 < 88.75% could indicate a decreased risk of Grade 3 + leukopenia, thrombocytopenia, and total HTs in the training as well as the external validation cohorts. CONCLUSIONS: Compared with nCT, nCRT could increase the risk of Grade 3 + HT in patients with locally advanced GC. Dose constraints of V5 < 88.75% in irradiated VB could reduce the incidence of Grade 3 + HT.
Assuntos
Leucopenia , Neoplasias Gástricas , Trombocitopenia , Humanos , Estudos Retrospectivos , Neoplasias Gástricas/tratamento farmacológico , Neoplasias Gástricas/radioterapia , Quimiorradioterapia/efeitos adversos , Trombocitopenia/induzido quimicamente , Trombocitopenia/complicações , Leucopenia/etiologia , Terapia Neoadjuvante/efeitos adversosRESUMO
OBJECTIVES: To assess LRP5-/6 gene polymorphisms and its association with risk of abnormal bone mass (ABM) in postmenopausal women. METHODS: The study recruited 166 patients with ABM (case group) and 106 patients with normal bone mass (control group) based on bone mineral density (BMD) results. Multi-factor dimensionality reduction (MDR) was used to analyze the interaction between the Low-density lipoprotein receptor-related protein 5 (LRP5) gene (rs41494349, rs2306862) and the Low-density lipoprotein receptor-related protein 6 (LRP6) gene (rs10743980, rs2302685) and the subjects' clinical characteristics of age and menopausal years. RESULTS: (1) Logistic regression analysis showed that the subjects with the CT or TT genotype at rs2306862 had a higher risk of ABM than those with the CC genotype (OR = 2.353, 95%CI = 1.039-6.186; OR = 2.434, 95%CI = 1.071, 5.531; P < 0.05). The subjects with the TC genotype at rs2302685 had a higher risk of ABM than those with the TT genotype (OR = 2.951, 95%CI = 1.030-8.457, P < 0.05). (2) When taking the three Single-nucleotide polymorphisms (SNPs) together, the accuracy was the highest with the cross-validation consistency of 10/10 (OR = 1.504, 95%CI:1.092-2.073, P < 0.05), indicating that the LRP5 rs41494349 and LRP6 rs10743980, rs2302685 were interactively associated with the risk of ABM. (3) Linkage disequilibrium (LD) results revealed that the LRP5 (rs41494349,rs2306862) were in strong LD (D' > 0.9, r2 > 0.3). AC and AT haplotypes were significantly more frequently distributed in the ABM group than in the control group, indicating that subjects carrying the AC and AT haplotypes were associated with an increased risk of ABM (P < 0.01). (4) MDR showed that rs41494349 & rs2302685 & rs10743980 & age were the best model for ABM prediction. The risk of ABM in "high-risk combination" was 1.00 times that of "low-risk combination"(OR = 1.005, 95%CI: 1.002-1.008, P < 0.05). (5) MDR showed that there was no significant association between any of the SNPs and menopausal years and ABM susceptibility. CONCLUSION: These findings indicate that LRP5-rs2306862 and LRP6-rs2302685 polymorphisms and gene-gene and gene-age interactions may increase the risk of ABM in postmenopausal women. There was no significant association between any of the SNPs and menopausal years and ABM susceptibility.
Assuntos
Densidade Óssea , Proteína-5 Relacionada a Receptor de Lipoproteína de Baixa Densidade , Feminino , Humanos , Densidade Óssea/genética , Genótipo , Proteína-5 Relacionada a Receptor de Lipoproteína de Baixa Densidade/genética , Polimorfismo de Nucleotídeo Único/genética , Pós-Menopausa/genéticaRESUMO
Background: Few studies concentrate on spleen dosimetry of radiotherapy for gastric cancer (GC). Although there is no consensus on the spleen dose-volume threshold for lymphopenia, several studies indicated that the higher the spleen dose, the higher the risk of lymphopenia. This study aimed to identify the appropriate spleen dosimetric parameters for predicting grade 4 + lymphopenia in patients with locally advanced GC. Material and methods: A total of 295 patients treated with nCRT and nChT from June 2013 to December 2021 at two major centers were included, of whom 220 were assigned to the training cohort and 75 to the external validation cohort. Results: Grade 4 + lymphopenia was more common in the nCRT than in the nChT group (49.5% vs. 0, P < 0.001 in the training cohort; 25.0% vs. 0, P = 0.001 in the external validation cohort). Age ≥ 60 years (P = 0.006), lower pretreatment absolute lymphocyte count (P = 0.001), higher spleen volume (SPV) (P = 0.001), and higher V20 (P = 0.003) were significant risk factors of grade 4 + lymphopenia for patients treated with nCRT. Patients with grade 4 + lymphopenia had significantly worse PFS (P = 0.043) and showed a negative correlation trend with OS (P = 0.07). Limiting V20 to < 84.5% could decrease the incidence of grade 4 + lymphopenia by 35.7%. The predictive effectiveness of the multivariable model in the training and external validation cohorts was 0.880 and 0.737, respectively. Conclusion: Grade 4 + lymphopenia during nCRT was more common than nChT, and was associated with a worse PFS in GC patients. Constraining the spleen V20 to < 84.5% may indirectly improve outcomes through lymphocyte preservation.
RESUMO
BACKGROUND: Herbal medicine has a long history of use in the prevention and treatment of disease and is becoming increasingly popular globally. However, there are also widespread concerns about its safety. Among them, the cardiotoxicity of aconitine has been described. CASE SUMMARY: We report a case of a 61-year-old male with aconitine poisoning presenting with malignant arrhythmia and severe cardiogenic shock, which was successfully managed with aggressive advanced life support and heart transplantation. CONCLUSION: This is the first case wherein in vivo cardiac pathology was obtained, confirming that aconitine caused acute myocardial necrosis.
RESUMO
BACKGROUND: Cardiac dysfunction is the most common clinical complication of sepsis. Herein, the study explored the clinical importance of long non-coding RNA (lncRNA) HOXA terminal transcript antisense RNA (HOTTIP) in the onset of sepsis and the development of cardiac dysfunction. METHODS: 120 patients with sepsis were recruited and divided into cardiac dysfunction group and non-cardiac dysfunction group. Serum HOTTIP levels were measured via RT-qPCR. AC16 cells were treated with lipopolysaccharide (LPS) for cell experiments and detected for cell viability and apoptosis. RESULTS: High serum HOTTIP levels were tested in sepsis patients, which was associated with procalcitonin (PCT) level. Serum HOTTIP can identify sepsis cases from healthy people with the AUC of 0.927. 72 cases developed into cardiac dysfunction, accompanied by elevated levels of HOTTIP. ROC curve displayed the predictive ability of serum HOTTIP in the development of cardiac dysfunction in patients with sepsis. After adjusting for other clinical parameters, HOTTIP can independently affect the development of cardiac dysfunction. In vitro, HOTTIP knockdown promoted the recovery of cell viability and reversed LPS-induced cell apoptosis and excessive interleukin-6 (IL-6) release. CONCLUSION: LncRNA HOTTIP is closely related to the condition of patients with sepsis and the development of cardiac dysfunction, possibly owing to its function in LPS-induced myocardial apoptosis and inflammation.
Assuntos
MicroRNAs , RNA Longo não Codificante , Sepse , Humanos , Interleucina-6 , Lipopolissacarídeos , MicroRNAs/genética , Pró-Calcitonina , RNA Antissenso , RNA Longo não Codificante/genética , Sepse/genéticaRESUMO
OBJECTIVE: The present study explored the risk factors of postoperative mortality in patients with acute Stanford type A aortic dissection (AD). METHODS: The study included 149 patients with acute Stanford type A AD who were treated at the Fourth Hospital of Hebei Medical University, China, from October 2016 to October 2018. The patients were divided into a death (n = 42) and survival group (n = 107) according to individual prognosis. Univariate analysis of all possible related risk factors was conducted; multivariate logistic regression analysis of the potential risk factors that showed statistical differences in the univariate analysis was also performed. RESULTS: The results of the univariate analysis showed that a body mass index (BMI) ≥25 kg/m2, surgery duration, duration of cardiopulmonary bypass, duration of cardiopulmonary bypass assistance, total transfusion of red blood cells, postoperative APACHE II score, sequential organ failure assessment (SOFA) score, low cardiac output, acute kidney injury (AKI), hypoxemia, diffuse intravascular coagulation (DIC), hepatic failure and other related complications, as well as postoperative stay duration in the intensive care unit (ICU), were closely correlated with a poor prognosis among patients. Multivariate logistic regression analysis showed that a BMI ≥25 kg/m2, SOFA score >8, duration of cardiopulmonary bypass assistance >70 minutes, postoperative low cardiac output, and postoperative DIC were independent risk factors for postoperative death in patients with acute Stanford type A AD. CONCLUSION: A BMI ≥25 kg/m2, SOFA score >8, duration of cardiopulmonary bypass assistance >70 min, postoperative DIC, and postoperative low cardiac output were the independent risk factors for postoperative death in acute Stanford type A AD. Intraoperative blood transfusion, postoperative hepatic failure, and AKI, among others, correlated with an increased risk of death but were not independent risk factors for death.
RESUMO
Purpose: We aimed to develop a prognostic immunohistochemistry (IHC) signature for patients with head and neck mucosal melanoma (MMHN). Methods: In total, 190 patients with nonmetastatic MMHN with complete clinical and pathological data before treatment were included in our retrospective study. Results: We extracted five IHC markers associated with overall survival (OS) and then constructed a signature in the training set (n=116) with the least absolute shrinkage and selection operator (LASSO) regression model. The validation set (n=74) was further built to confirm the prognostic significance of this classifier. We then divided patients into high- and low-risk groups according to the IHC score. In the training set, the 5-year OS rate was 22.0% (95% confidence interval [CI]: 11.2%- 43.2%) for the high-risk group and 54.1% (95% CI: 41.8%-69.9%) for the low-risk group (P<0.001), and in the validation set, the 5-year OS rate was 38.1% (95% CI: 17.9%-81.1%) for the high-risk group and 43.1% (95% CI: 30.0%-61.9%) for the low-risk group (P=0.26). Multivariable analysis revealed that IHC score, T stage, and primary tumor site were independent variables for predicting OS (all P<0.05). We developed a nomogram incorporating clinicopathological risk factors (primary site and T stage) and the IHC score to predict 3-, 5-, and 10-year OS. Conclusions: A nomogram was generated and confirmed to be of clinical value. Our IHC classifier integrating five IHC markers could help clinicians make decisions and determine optimal treatments for patients with MMHN.
Assuntos
Biomarcadores Tumorais/metabolismo , Neoplasias de Cabeça e Pescoço/patologia , Melanoma/patologia , Adulto , Idoso , Idoso de 80 Anos ou mais , Feminino , Humanos , Imuno-Histoquímica , Masculino , Pessoa de Meia-Idade , Nomogramas , Prognóstico , Estudos RetrospectivosRESUMO
BACKGROUND: Preoperative prognostic biomarkers to guide individualized therapy are still in demand in esophageal squamous cell cancer (ESCC). Some studies reported that radiomic analysis based on CT images has been successfully performed to predict individual survival in EC. The aim of this study was to assess whether combining radiomics features from primary tumor and regional lymph nodes predicts overall survival (OS) better than using single-region features only, and to investigate the incremental value of the dual-region radiomics signature. METHODS: In this retrospective study, three radiomics signatures were built from preoperative enhanced CT in a training cohort (n = 200) using LASSO Cox model. Associations between each signature and survival was assessed on a validation cohort (n = 107). Prediction accuracy for the three signatures was compared. By constructing a clinical nomogram and a radiomics-clinical nomogram, incremental prognostic value of the radiomics signature over clinicopathological factors in OS prediction was assessed in terms of discrimination, calibration, reclassification and clinical usefulness. RESULTS: The dual-region radiomic signature was an independent factor, significantly associated with OS (HR: 1.869, 95% CI: 1.347, 2.592, P = 1.82e-04), which achieved better OS (C-index: 0.611) prediction either than the single-region signature (C-index:0.594-0.604). The resulted dual-region radiomics-clinical nomogram achieved the best discriminative ability in OS prediction (C-index:0.700). Compared with the clinical nomogram, the radiomics-clinical nomogram improved the calibration and classification accuracy for OS prediction with a total net reclassification improvement (NRI) of 26.9% (P=0.008) and integrated discrimination improvement (IDI) of 6.8% (P<0.001). CONCLUSION: The dual-region radiomic signature is an independent prognostic marker and outperforms single-region signature in OS for ESCC patients. Integrating the dual-region radiomics signature and clinicopathological factors improves OS prediction.
Assuntos
Carcinoma de Células Escamosas , Neoplasias Esofágicas , Carcinoma de Células Escamosas/diagnóstico por imagem , Neoplasias Esofágicas/diagnóstico por imagem , Humanos , Linfonodos/diagnóstico por imagem , Estudos Retrospectivos , Tomografia Computadorizada por Raios XRESUMO
BACKGROUND: To explore prognostic value of the pre-treatment primary lesion apparent diffusion coefficient (ADC) in locoregionally advanced nasopharyngeal carcinoma (LA-NPC). METHODS: A total of 843 patients with newly diagnosed LA-NPC were enrolled from January 2011 to April 2014 and divided into two groups based on ADC values: the low-ADC group and high-ADC group. The 3-year local relapse-free survival (LRFS), distant metastasis free survival (DMFS), disease-free survival (DFS) and overall survival (OS) rates between two groups were compared using Kaplan-Meier curve, and Cox regression analyses were performed to test prognostic value of the pretreatment ADC in LA-NPC. RESULTS: The cut-off value of the pretreatment ADC for predicting local relapse was 784.5 × 10- 6 mm2/s (AUC [area under curve] = 0.604; sensitivity = 0.640; specificity = 0.574), thus patients were divided into low-ADC (< 784.5 × 10- 6; n = 473) group and high-ADC (≥784.5 × 10- 6; n = 370) group. The low-ADC group had significantly higher 3-year LRFS rate and DFS rate than the high-ADC group (LRFS: 96.2% vs. 91.4%, P = 0.003; DFS: 81.4% vs. 73.0%, P = 0.0056). Multivariate analysis showed that the pretreatment ADC is an independent prognostic factor for LRFS (HR, 2.04; 95% CI, 1.13-3.66; P = 0.017) and DFS (HR, 1.41; 95% CI, 1.04-1.89; P = 0.024). CONCLUSIONS: The pretreatment ADC of the primary lesion is an independent prognostic factor for LRFS and DFS in LA-NPC patients.
Assuntos
Imagem de Difusão por Ressonância Magnética , Carcinoma Nasofaríngeo/diagnóstico , Neoplasias Nasofaríngeas/diagnóstico , Adolescente , Adulto , Idoso , Criança , Intervalo Livre de Doença , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Prognóstico , Estudos Retrospectivos , Adulto JovemRESUMO
Osteocytes' mechano-regulation of bone formation and resorption is key to maintaining appropriate bone health. Although extensive in vitro studies have explored osteocyte mechanobiology using the well-established MLO-Y4 cell model, the low amount of sclerostin secreted by this cell line renders it inadequate for studying cross-talk between osteocytes and osteoblasts under mechanical loading. Here, we investigated the potential of the sclerostin-expressing OCY454 osteocyte cell model in fulfilling this role. Fully differentiated OCY454 cells were tested for mechano-sensitivity by measuring changes in protein secretion, total adenosine triphosphate (ATP) content, and intracellular calcium in response to oscillatory fluid flow. Increases in sclerostin expression and total ATP content were observed. However, very low levels of receptor activator of the nuclear factor κ-B ligand were detected, and there was a great inconsistency in calcium response. Conditioned medium (CM) from OCY454 cells was then used to culture osteoblast and osteoclast precursors. Osteoblast activity was quantified with alkaline phosphatase (ALP) and Alizarin Red S stain, while osteoclast differentiation was quantified with tartrate-resistant acid phosphatase (TRAP) staining. We demonstrated that mechanically stimulated OCY454 cells released soluble factors that increased osteoblasts' ALP activity (p < 0.05) and calcium deposition (p < 0.05). There was also a significant decrease of large-sized TRAP-positive osteoclasts when osteoclast precursors were treated with CM from flow-stimulated OCY454 cells (p < 0.05). Results from this study suggest that OCY454 cells respond to mechanical loading with the release of key factors such as sclerostin to regulate downstream bone cells, thus demonstrating its potential as a novel cell model for in vitro osteocyte mechanobiology studies. © 2019 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 37:1681-1689, 2019.
Assuntos
Remodelação Óssea , Mecanotransdução Celular , Osteócitos/fisiologia , Proteínas Adaptadoras de Transdução de Sinal/metabolismo , Trifosfato de Adenosina/metabolismo , Animais , Sinalização do Cálcio , Diferenciação Celular , Linhagem Celular , Camundongos , Suporte de CargaRESUMO
OBJECTIVE:: The purpose of this study is to compare contrast-enhanced ultrasound (CEUS) to MRI for evaluating local invasion of cervical cancer. METHODS:: A total of 108 patients with cervical cancer were included in this study. All the enrolled patients were Stage IIA2-IVB according to the International Federation of Obstetrics and Gynecology and treated with volumetric modulated arc therapy. Tumour size in different dimensions was compared between MRI and CEUS. The correlation coefficients (r) between MRI and CEUS for diagnosing local invasion, parametrial extension, and invasion to vagina, uterine corpus and adjacent organs were assessed. RESULTS:: Measurements by MRI and CEUS were strongly correlated in the three dimensions: left-right r = 0.84, craniocaudal r = 0.86 and anteroposterior r = 0.88. Vaginal and parametrial invasion were detected by both MRI and CEUS with moderate concordance, and invasion of uterine corpus, bladder and rectum with good concordance. CONCLUSION:: CEUS is comparable to MRI for measuring tumour size, with good concordance for evaluating invasion of cervical cancer. ADVANCES IN KNOWLEDGE:: CEUS is a less expensive non-invasive modality for assessment of tumour size and invasion of cervical cancer.
Assuntos
Meios de Contraste , Neoplasias do Colo do Útero/diagnóstico por imagem , Adulto , Idoso , Quimiorradioterapia/métodos , Feminino , Humanos , Imageamento por Ressonância Magnética/métodos , Pessoa de Meia-Idade , Invasividade Neoplásica , Neoplasias Pélvicas/diagnóstico por imagem , Neoplasias Pélvicas/patologia , Neoplasias Retais/diagnóstico por imagem , Neoplasias Retais/patologia , Estudos Retrospectivos , Carga Tumoral , Ultrassonografia/métodos , Neoplasias da Bexiga Urinária/diagnóstico por imagem , Neoplasias da Bexiga Urinária/patologia , Neoplasias do Colo do Útero/patologia , Neoplasias do Colo do Útero/terapia , Neoplasias Vaginais/diagnóstico por imagem , Neoplasias Vaginais/patologiaRESUMO
OBJECTIVE: To study the clinical effect and mechanism of hemoperfusion (HP) in the treatment of children with severe abdominal Henoch-Schönlein purpura (HSP). METHODS: A total of 24 children with severe abdominal HSP were divided into two groups: conventional treatment and HP (n=12 each). Ten healthy children who underwent physical examination were enrolled as the control group. Before and after treatment, chemiluminescence was used to measure the serum levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α); thiobarbituric acid colorimetry was used to measure the plasma level of malondialdehyde (MDA); the hydroxylamine method was used to measure the plasma level of superoxide dismutase (SOD); chemical colorimetry was used to measure the plasma level of total anti-oxidant capability (T-AOC). RESULTS: Compared with the control group, the conventional treatment and HP groups had significantly higher IL-6, TNF-α, and MDA levels and significantly lower SOD and T-AOC levels before treatment (P<0.05), but there were no significant differences between the conventional treatment and HP groups (P>0.05). After treatment, the conventional treatment and HP groups had significant reductions in IL-6, TNF-α, and MDA levels and significant increases in SOD and T-AOC levels (P<0.05). The HP group had significantly greater changes than the conventional treatment group; however, there were still significant differences in these indices between the HP and control groups (P<0.05). Compared with the HP group, the conventional treatment group had a significantly lower percentage of children with disappearance of digestive tract symptoms at 4 days after treatment and significantly longer time to disappearance of rash and digestive tract symptoms (P<0.05). Compared with the conventional treatment group, the HP group had a significantly lower amount of glucocorticoid used during treatment and a significantly lower percentage of children who experienced hematuria and/or proteinuria within 6 months of the disease course (P<0.05). There were no significant differences between the two groups in length of hospital stay and recurrence rates of rash and abdominal pain within 6 months of the disease course. CONCLUSIONS: HP can reduce the amount of glucocorticoid used during treatment and the incidence rate of kidney injury in children with severe abdominal HSP, possibly by eliminating IL-6, TNF-α, and MDA.
Assuntos
Hemoperfusão , Vasculite por IgA/terapia , Adolescente , Criança , Pré-Escolar , Feminino , Humanos , Vasculite por IgA/metabolismo , Interleucina-6/sangue , Masculino , Malondialdeído/sangue , Superóxido Dismutase/sangue , Fator de Necrose Tumoral alfa/sangueRESUMO
Multifunctional, low-cost electrodes and catalysts are desirable for next-generation electrochemical energy-storage and sensor applications. In this study, we demonstrate the fabrication of Ni3(PO4)2·8H2O nano/microflakes layer on nickel foam (NF) by a facile one-pot hydrothermal approach and investigate this electrode for multiple applications, including sweat-based glucose and pH sensor as well as hybrid energy-storage device, e.g., supercapattery. The electrode displays a specific capacity of 301.8 mAh g-1 (1552 F g-1) at an applied current of 5 mA cm-2 and can retain 84% of its initial capacity after 10 000 cycles. Furthermore, the supercapattery composed of Ni3(PO4)2·8H2O/NF as positive electrode and activated carbon as negative electrode can offer a high specific energy of 33.4 Wh kg-1 with the power of 165.5 W kg-1. As an electrocatalyst for nonenzymatic glucose sensor, Ni3(PO4)2·8H2O/NF shows an exceptional sensitivity (24.39 mA mM-1cm-2) with a low detection limit of 97 nM (S/N = 3). Moreover, as a sweat-based pH sensor, the electrode is capable of detecting human sweat pH values ranging from 4 to 7. Therefore, this three-dimensional nanoporous Ni3(PO4)2·8H2O/NF electrode, due to its excellent electrochemical performance, can be successfully applied in electrochemical energy-storage and biosensor applications.
Assuntos
Eletrodos , Técnicas Eletroquímicas , Glucose , Humanos , Concentração de Íons de Hidrogênio , Níquel , Fosfatos , SuorRESUMO
A previous study by our group found that inhibition of nischarin promotes neurite outgrowth and neuronal regeneration in Neuro-2a cells and primary cortical neurons. In recent years, more and more studies have shown that nanomaterials have good prospects in treatment of spinal cord injury. We proposed that small interfering RNA targeting nischarin (Nis-siRNA) delivered by polyethyleneimine-alginate (PEI-ALG) nanoparticles promoted motor function recovery in rats with spinal cord injury. Direct microinjection of 5 µL PEI-ALG/Nis-siRNA into the spinal cord lesion area of spinal cord injury rats was performed. From day 7 after surgery, Basso, Beattie and Bresnahan score was significantly higher in rats from the PEI-ALG/Nis-siRNA group compared with the spinal cord injury group and PEI-ALG/Control-siRNA group. On day 21 after injection, hematoxylin-eosin staining showed that the necrotic area was reduced in the PEI-ALG/Nis-siRNA group. Immunohistochemistry and western blot assay results confirmed successful inhibition of nischarin expression and increased protein expression of growth-associated protein-43 in the PEI-ALG/Nis-siRNA group. These findings suggest that a complex of PEI-ALG nanoparticles and Nis-siRNA effectively suppresses nischarin expression, induces expression of growth-associated protein-43, and accelerates motor function recovery after spinal cord injury.
RESUMO
BACKGROUND: Orthotopic liver transplantation (OLT) improves the prognosis of patients with hepatocellular carcinoma (HCC). Moreover, the complement system is a powerful immune effector that can affect liver function and process of liver cirrhosis. However, studies correlating the complement system with tacrolimus metabolism after OLT are scarce. In this study, the role of single nucleotide polymorphisms (SNPs) associated with the sixth complement component (C6) in tacrolimus metabolism was investigated during the early stages of liver transplantation. METHODS: The study enrolled 135 adult patients treated with OLT for HCC between August 2011 and October 2013. Ten SNPs in C6 gene and rs776746 in cytochrome P450 3A5 (CYP3A5) gene were investigated. The tacrolimus levels were monitored daily during 4 weeks after transplantation. RESULTS: Both donor and recipient CYP3A5 rs776746 allele A were correlated with decreased concentration/dose (C/D) ratios. Recipient C6 rs9200 allele G and donor C6 rs10052999 homozygotes were correlated with lower C/D ratios. Recipient CYP3A5 rs776746 allele A (yielded median tacrolimus C/D ratios of 225.90 at week 1 and 123.61 at week 2), C6 rs9200 allele G (exhibited median tacrolimus C/D ratios of 211.31 at week 1, 110.23 at week 2, and 99.88 at week 3), and donor CYP3A5 rs776746 allele A (exhibited median C/D ratios of 210.82 at week 1, 111.06 at week 2, 77.49 at week 3, and 85.60 at week 4) and C6 rs10052999 homozygote (exhibited median C/D ratios of 167.59 at week 2, 157.99 at week 3, and 155.36 at week 4) were associated with rapid tacrolimus metabolism. With increasing number of these alleles, patients were found to have lower tacrolimus C/D ratios at various time points during the 4 weeks after transplantation. In multiple linear regression analysis, recipient C6 rs9200 group (AA vs. GG/GA) was found to be related to tacrolimus metabolism at weeks 1, 2, and 3 (P = 0.005, P = 0.045, and P = 0.033, respectively), whereas donor C6 rs10052999 group (CC/TT vs. TC) was demonstrated to be correlated with tacrolimus metabolism only at week 4 (P = 0.001). CONCLUSIONS: Recipient C6 gene rs9200 polymorphism and donor C6 gene rs10052999 polymorphism are new genetic loci that affect tacrolimus metabolism in patients with HCC after OLT.
Assuntos
Carcinoma Hepatocelular/metabolismo , Carcinoma Hepatocelular/cirurgia , Neoplasias Hepáticas/metabolismo , Neoplasias Hepáticas/cirurgia , Tacrolimo/metabolismo , Adulto , Idoso , Carcinoma Hepatocelular/genética , Citocromo P-450 CYP3A/genética , Feminino , Genótipo , Humanos , Imunossupressores/metabolismo , Neoplasias Hepáticas/genética , Transplante de Fígado , Masculino , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único/genéticaRESUMO
A binder-free cobalt phosphate hydrate (Co3(PO4)2·8H2O) multilayer nano/microflake structure is synthesized on nickel foam (NF) via a facile hydrothermal process. Four different concentrations (2.5, 5, 10, and 20 mM) of Co2+ and PO4-3 were used to obtain different mass loading of cobalt phosphate on the nickel foam. The Co3(PO4)2·8H2O modified NF electrode (2.5 mM) shows a maximum specific capacity of 868.3 C g-1 (capacitance of 1578.7 F g-1) at a current density of 5 mA cm-2 and remains as high as 566.3 C g-1 (1029.5 F g-1) at 50 mA cm-2 in 1 M NaOH. A supercapattery assembled using Co3(PO4)2·8H2O/NF as the positive electrode and activated carbon/NF as the negative electrode delivers a gravimetric capacitance of 111.2 F g-1 (volumetric capacitance of 4.44 F cm-3). Furthermore, the device offers a high specific energy of 29.29 Wh kg-1 (energy density of 1.17 mWh cm-3) and a specific power of 4687 W kg-1 (power density of 187.5 mW cm-3).