Niclosamide and its derivative DK-520 inhibit RANKL-induced osteoclastogenesis.

Niclosamide is a potent inhibitor of osteoclastogenesis and bone remodeling. DK-520 is an acyl derivative of Niclosamide and significantly increased both the plasma concentration and the duration of exposure of Niclosamide when dosed orally. However, at present the effect of DK-520 on osteoclastogenesis has not been reported. Here, we investigated whether DK-520 can regulate receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis of bone marrow macrophages (BMMs) in vitro. Following induction of BMMs with RANKL for three days, we detected differentiated osteoclasts with typical morphology and high levels of tartrate-resistant acid phosphatase (TRAP), RANKL, and cathepsin K (CTSK) expression. Treatment with either Niclosamide or DK-520 did not affect the viability of osteoclast precursors (OCPs), but significantly inhibited RANKL-induced transdifferentiation of macrophages into OCPs, particularly in the early stage of osteoclastogenesis. Both Niclosamide and DK-520 significantly decreased the relative levels of transcription factor PU.1 mRNA transcripts and dendritic cell-specific transmembrane protein (DC-STAMP), but not v-ATPasev0 d2 protein expression in OCPs. In addition, the inhibitory effect of DK-520 on osteoclastogenesis is realized through impairment of the NF-kB (nuclear factor-κB) and MAPK (mitogen-activated protein kinase) signaling pathways. These results demonstrate that DK-520, like Niclosamide, effectively inhibits the early stage of osteoclastogenesis. The findings presented here, together with its increased oral plasma concentrations and bioavailability, suggest that DK-520 may be a promising drug candidate for treatment of osteoclast-related diseases.

Specific RANK Cytoplasmic Motifs Drive Osteoclastogenesis.

Upon receptor activator of NF-κB ligand (RANKL) binding, RANK promotes osteoclast formation through the recruitment of tumor necrosis factor (TNF) receptor-associated factors (TRAFs). In vitro assays identified two RANK intracellular motifs that bind TRAFs: PVQEET560-565 (Motif 2) and PVQEQG604-609 (Motif 3), which potently mediate osteoclast formation in vitro. To validate the in vitro findings, we have generated knock-in (KI) mice harboring inactivating mutations in RANK Motifs 2 and 3. Homozygous KI (RANKKI/KI ) mice are born at the predicted Mendelian frequency and normal in tooth eruption. However, RANKKI/KI mice exhibit significantly more trabecular bone mass than age- and sex-matched heterozygous KI (RANK+/KI ) and wild-type (RANK+/+ ) counterparts. Bone marrow macrophages (BMMs) from RANKKI/KI mice do not form osteoclasts when they are stimulated with macrophage colony-stimulating factor (M-CSF) and RANKL in vitro. RANKL is able to activate the NF-κB, ERK, p38, and JNK pathways in RANKKI/KI BMMs, but it cannot stimulate c-Fos or NFATc1 in the RANKKI/KI cells. Previously, we showed that RANK signaling plays an important role in Porphyromonas gingivalis (Pg)-mediated osteoclast formation by committing BMMs into the osteoclast lineage. Here, we show that RANKL-primed RANKKI/KI BMMs are unable to differentiate into osteoclasts in response to Pg stimulation, indicating that the two RANK motifs are required for Pg-induced osteoclastogenesis. Mechanistically, RANK Motifs 2 and 3 facilitate Pg-induced osteoclastogenesis by stimulating c-Fos and NFATc1 expression during the RANKL pretreatment phase as well as rendering c-Fos and NFATc1 genes responsive to subsequent Pg stimulation. Cell-penetrating peptides (CPPs) conjugated with RANK segments containing Motif 2 or 3 block RANKL- and Pg-mediated osteoclastogenesis. The CPP conjugates abrogate RANKL-stimulated c-Fos and NFATc1 expression but do not affect RANKL-induced activation of NF-κB, ERK, p38, JNK, or Akt signaling pathway. Taken together, our current findings demonstrate that RANK Motifs 2 and 3 play pivotal roles in osteoclast formation in vivo and mediate Pg-induced osteoclastogenesis in vitro.

The IVVY Motif and Tumor Necrosis Factor Receptor-associated Factor (TRAF) Sites in the Cytoplasmic Domain of the Receptor Activator of Nuclear Factor κB (RANK) Cooperate to Induce Osteoclastogenesis.

Receptor activator of NF-κB (RANK) activation by RANK ligand (RANKL) mediates osteoclastogenesis by recruiting TNF receptor-associated factors (TRAFs) via three cytoplasmic motifs (motif 1, PFQEP(369-373); motif 2, PVQEET(559-564); and motif 3, PVQEQG(604-609)) to activate the NF-κB and MAPK signaling pathways. RANK also has a TRAF-independent motif (IVVY(535-538)), which is dispensable for the activation of TRAF-induced signaling pathways but essential for osteoclast lineage commitment by inducing the expression of nuclear factor of activated T-cells c1 (NFATc1) to regulate osteoclast gene expression. Notably, TNF/IL-1-mediated osteoclastogenesis requires RANK ligand assistance, and the IVVY motif is also critical for TNF/IL-1-mediated osteoclastogenesis by rendering osteoclast genes responsive to these two cytokines. Here we show that the two types of RANK cytoplasmic motifs have to be on the same RANK molecule to mediate osteoclastogenesis, suggesting a functional cooperation between them. Subsequent osteoclastogenesis assays with TNF or IL-1 revealed that, although all three TRAF motifs play roles in TNF/IL-1-mediated osteoclastogenesis, motifs 2 and 3 are more potent than motif 1. Accordingly, inactivation of motifs 2 and 3 blocksTNF/IL-1-mediated osteoclastogenesis. Mechanistically, double mutation of motifs 2 and 3, similar to inactivation of the IVVY motif, abrogates the expression of nuclear factor of activated T-cells c1 and osteoclast genes in assays reflecting RANK-initiated and TNF/IL-1-mediated osteoclastogenesis. In contrast, double inactivation of motifs 2 and 3 did not affect the ability of RANK to activate the NF-κB and MAPK signaling pathways. Collectively, these results indicate that the RANK IVVY motif cooperates with the TRAF-binding motifs to promote osteoclastogenesis, which provides novel insights into the molecular mechanism of RANK signaling in osteoclastogenesis.

Molecular mechanism of thiazolidinedione-mediated inhibitory effects on osteoclastogenesis.

Thiazolidinediones are synthetic peroxisome proliferator-activated receptor γ agonists used to treat type 2 diabetes mellitus. Clinical evidence indicates that thiazolidinediones increase fracture risks in type 2 diabetes mellitus patients, but the mechanism by which thiazolidinediones augment fracture risks is not fully understood. Several groups recently demonstrated that thiazolidinediones stimulate osteoclast formation, thus proposing that thiazolidinediones induce bone loss in part by prompting osteoclastogenesis. However, numerous other studies showed that thiazolidinediones inhibit osteoclast formation. Moreover, the molecular mechanism by which thiazolidinediones modulate osteoclastogenesis is not fully understood. Here we independently address the role of thiazolidinediones in osteoclastogenesis in vitro and furthermore investigate the molecular mechanism underlying the in vitro effects of thiazolidinediones on osteoclastogenesis. Our in vitro data indicate that thiazolidinediones dose-dependently inhibit osteoclastogenesis from bone marrow macrophages, but the inhibitory effect is considerably reduced when bone marrow macrophages are pretreated with RANKL. In vitro mechanistic studies reveal that thiazolidinediones inhibit osteoclastogenesis not by impairing RANKL-induced activation of the NF-κB, JNK, p38 and ERK pathways in bone marrow macrophages. Nonetheless, thiazolidinediones inhibit osteoclastogenesis by suppressing RANKL-induced expression of NFATc1 and c-Fos, two key transcriptional regulators of osteoclastogenesis, in bone marrow macrophages. In addition, thiazolidinediones inhibit the RANKL-induced expression of osteoclast genes encoding matrix metalloproteinase 9, cathepsin K, tartrate-resistant acid phosphatase and carbonic anhydrase II in bone marrow macrophages. However, the ability of thiazolidinediones to inhibit the expression of NFATc1, c-Fos and the four osteoclast genes is notably weakened in RANKL-pretreated bone marrow macrophages. These in vitro studies have not only independently demonstrated that thiazolidinediones exert inhibitory effects on osteoclastogenesis but have also revealed crucial new insights into the molecular mechanism by which thiazolidinediones inhibit osteoclastogenesis.

Interleukin-3 plays dual roles in osteoclastogenesis by promoting the development of osteoclast progenitors but inhibiting the osteoclastogenic process.

Interleukin (IL)-3, a multilineage hematopoietic growth factor, is implicated in the regulation of osteoclastogenesis. However, the role of IL-3 in osteoclastogenesis remains controversial; whereas early studies showed that IL-3 stimulates osteoclastogenesis, recent investigations demonstrated that IL-3 inhibits osteoclast formation. The objective of this work is to further address the role of IL-3 in osteoclastogenesis. We found that IL-3 treatment of bone marrow cells generated a population of cells capable of differentiating into osteoclasts in tissue culture dishes in response to the stimulation of the monocyte/macrophage-colony stimulating factor (M-CSF) and the receptor activator of nuclear factor kappa B ligand (RANKL). The IL-3-dependent hematopoietic cells were able to further proliferate and differentiate in response to M-CSF stimulation and the resulting cells were also capable of forming osteoclasts with M-CSF and RANKL treatment. Interestingly, IL-3 inhibits M-CSF-/RANKL-induced differentiation of the IL-3-dependent hematopoietic cells into osteoclasts. The flow cytometry analysis indicates that while IL-3 treatment of bone marrow cells slightly affected the percentage of osteoclast precursors in the surviving populations, it considerably increased the percentage of osteoclast precursors in the populations after subsequent M-CSF treatment. Moreover, osteoclasts derived from IL-3-dependent hematopoietic cells were fully functional. Thus, we conclude that IL-3 plays dual roles in osteoclastogenesis by promoting the development of osteoclast progenitors but inhibiting the osteoclastogenic process. These findings provide a better understanding of the role of IL-3 in osteoclastogenesis.

Molecular basis of requirement of receptor activator of nuclear factor κB signaling for interleukin 1-mediated osteoclastogenesis.

IL-1, a proinflammatory cytokine, is implicated in bone loss in various pathological conditions by promoting osteoclast formation, survival, and function. Although IL-1 alone can sufficiently prolong osteoclast survival and activate osteoclast function, IL-1-mediated osteoclastogenesis requires the receptor activator of NF-κB (RANK) ligand (RANKL). However, the molecular basis of the dependence of IL-1-mediated osteoclastogenesis on RANKL is not fully understood. Here we show that although IL-1 cannot activate the expression of the osteoclast genes encoding matrix metalloproteinase 9, cathepsin K, tartrate-resistant acid phosphatase, and carbonic anhydrase II in bone marrow macrophages (BMMs), RANKL renders these osteoclast genes responsive to IL-1. We further demonstrate that IL-1 alone fails to induce the expression of nuclear factor of activated T cell cytoplasmic 1 (NFATc1), a master transcriptional regulator of osteoclastogenesis), in BMMs but can up-regulate its expression in the presence of permissive levels of RANKL or with RANKL pretreatment. The RANK IVVY motif, which has been previously shown to commit BMMs to the osteoclast lineage in RANKL- and TNF α-mediated osteoclastogenesis, also plays a crucial role in IL-1-mediated osteoclastogenesis by changing the four osteoclast marker and NFATc1 genes to an IL-1-inducible state. Finally, we show that MyD88, a known critical component of the IL-1 receptor I signaling pathway, plays a crucial role in IL-1-mediated osteoclastogenesis from RANKL-primed BMMs by up-regulating the expression of the osteoclast marker and NFATc1 genes. This study reveals a novel mechanism of IL-1-mediated osteoclastogenesis and supports the promising potential of the IVVY motif to serve as a therapeutic target for inflammatory bone loss.

Molecular mechanisms of the biphasic effects of interferon-γ on osteoclastogenesis.

Although interferon-γ (IFN-γ) potently inhibits osteoclastogenesis, the suppressive effect is significantly reduced when osteoclast precursors are pre-exposed to the receptor activator of NF-κB (RANK) ligand (RANKL). However, the molecular mechanism underlying the biphasic effects of IFN-γ on osteoclastogenesis remains elusive. Here, we recapitulate the biphasic functions of IFN-γ in osteoclastogenesis in both tissue culture dishes and on bone slices. We further demonstrate that IFN-γ markedly suppresses the RANKL-induced expression of nuclear factor of activated T-cells c1 (NFATc1) in normal, but not RANKL-pretreated bone marrow macrophages (BMMs). Similarly, IFN-γ impairs the activation of the nuclear factor-κB (NF-κB) and c-Jun N-terminal kinase (JNK) pathways in normal, but not RANKL-pretreated, BMMs. These findings indicate that IFN-γ inhibits osteoclastogenesis partially by suppressing the expression of NFATc1 and the activation of the NF-κB and JNK pathways. Moreover, IFN-γ inhibits the RANKL-induced expression of osteoclast genes, but RANKL pretreatment reprograms osteoclast genes into a state in which they can no longer be suppressed by IFN-γ, indicating that IFN-γ inhibits osteoclastogenesis by blocking the expression of osteoclast genes. Finally, the IVVY(535-538) motif in the cytoplasmic domain of RANK is responsible for rendering BMMs refractory to the inhibitory effect of IFN-γ. Taken together, these findings provide important mechanistic insights into the biphasic effects of IFN-γ on osteoclastogenesis.

Genetic ablation of CD68 results in mice with increased bone and dysfunctional osteoclasts.

CD68 is a member of the lysosome associated membrane protein (LAMP) family that is restricted in its expression to cells of the monocyte/macrophage lineage. This lineage restriction includes osteoclasts, and, while previous studies of CD68 in macrophages and dendritic cells have proposed roles in lipid metabolism, phagocytosis, and antigen presentation, the expression and function of CD68 in osteoclasts have not been explored. In this study, we investigated the expression and localization of CD68 in macrophages and osteoclasts in response to the monocyte/macrophage-colony stimulating factor (M-CSF) and the receptor activator of NF-κB ligand (RANKL). We found that M-CSF stimulates CD68 expression and RANKL alters the apparent molecular weight of CD68 as measured by Western immunoblotting. In addition, we explored the significance of CD68 expression in osteoclasts by generating mice that lack expression of CD68. These mice have increased trabecular bone, and in vitro assessment of CD68(-/-) osteoclasts revealed that, in the absence of CD68, osteoclasts demonstrate an accumulation of intracellular vesicle-like structures, and do not efficiently resorb bone. These findings demonstrate a role for CD68 in the function of osteoclasts, and future studies will determine the mechanistic nature of the defects seen in CD68(-/-) osteoclasts.

Interleukin-4 inhibits RANKL-induced NFATc1 expression via STAT6: a novel mechanism mediating its blockade of osteoclastogenesis.

Interleukin-4 (IL-4) is an important immune regulatory protein that possesses potent anti-osteoclastogenic properties, and does so via the transcription factor STAT6. Previous studies have shown that IL-4 selectively blocks RANKL-induced activation of NF-κB and mitogen-activated protein kinase (MAPK) pathway molecules, suggesting that the cytokine arrests osteoclastogenesis by blockade of these signaling cascades. However, the fact that the inhibitory effect on these pathways requires prolonged IL-4 pretreatment, and that the cytokine fails to exert an anti-osteoclastogenic effect after short-term pre-exposure of RANKL to osteoclast precursors, suggests that an additional, more immediate mechanism may also be involved. In this study, we found that simultaneous exposure of IL-4 did not alter RANKL-dependent activation of NF-κB or MAPKs, whereas the cytokine did block RANKL-induced nuclear factor activated T cells c1 (NFATc1), a master osteoclastogenic transcription factor. This inhibitory effect of IL-4 required STAT6, consistent with its functional role in osteoclastogenesis. In addition, the cytokine also partially impaired RANKL-stimulated bone resorption. Furthermore, IL-4 suppressed expression of RANKL-induced osteoclast specific genes in a STAT6-dependent manner, but failed to do so when osteoclast precursors were pre-exposed to RANKL. Thus, we provide the first evidence that IL-4 inhibits osteoclast formation by inhibiting RANKL induction of NFATc1 via STAT6 as an early event, in addition to its suppression of other signaling pathways. The inhibitory effect is ultimately regulated at the gene expression transcriptional level.

Development of cell-based high-throughput assays for the identification of inhibitors of receptor activator of nuclear factor-kappa B signaling.

Bone loss due to metabolic or hormonal disorders and osteolytic tumor metastasis continues to be a costly health problem, but current therapeutics offer only modest efficacy. Unraveling of the critical role for the receptor activator of nuclear factor-kappa B (RANK) and its ligand, RANK ligand (RANKL), in osteoclast biology provides an opportunity to develop more effective antiresorptive drugs. The in vivo effectiveness of RANKL inhibitors demonstrates the potency of the RANKL/RANK system as a drug target. Here, we report the development of cell-based assays for high-throughput screening to identify compounds that inhibit signaling from two RANK cytoplasmic motifs (PVQEET(559-564) and PVQEQG(604-609)), which play potent roles in osteoclast formation and function. Inhibitors of these motifs' signaling have the potential to be developed into new antiresorptive drugs that can complement current therapies. The cell-based assays consist of cell lines generated from RAW264.7 macrophages stably expressing a nuclear factor-kappa B-responsive luciferase reporter and a chimeric receptor containing the human Fas external domain linked to a murine RANK transmembrane and intracellular domain in which only one of the RANK motifs is functional. With these cells, specific RANK motif activation after chimeric receptor stimulation can be measured as an increase in luciferase activity. These assays demonstrated >300% increases in luciferase activity after RANK motif activation and Z '-factor values over 0.55. Our assays will be used to screen compound libraries for molecules that exhibit inhibitory activity. Follow-up assays will refine hits to a smaller group of more specific inhibitors of RANK signaling.

Receptor activator of NF-{kappa}B (RANK) cytoplasmic IVVY535-538 motif plays an essential role in tumor necrosis factor-{alpha} (TNF)-mediated osteoclastogenesis.

Tumor necrosis factor-α (TNF) enhances osteoclast formation and activity leading to bone loss in various pathological conditions, but its precise role in osteoclastogenesis remains controversial. Although several groups showed that TNF can promote osteoclastogenesis independently of the receptor activator of NF-κB (RANK) ligand (RANKL), others demonstrated that TNF-mediated osteoclastogenesis needs permissive levels of RANKL. Here, we independently reveal that although TNF cannot stimulate osteoclastogenesis on bone slices, it can induce the formation of functional osteoclasts on bone slices in the presence of permissive levels of RANKL or from bone marrow macrophages (BMMs) pretreated by RANKL. TNF can still promote the formation of functional osteoclasts 2 days after transient RANKL pretreatment. These data have confirmed that TNF-mediated osteoclastogenesis requires priming of BMMs by RANKL. Moreover, we investigated the molecular mechanism underlying the dependence of TNF-mediated osteoclastogenesis on RANKL. RANK, the receptor for RANKL, contains an IVVY(535-538) motif that has been shown to play a vital role in osteoclastogenesis by committing BMMs to the osteoclast lineage. We show that TNF-induced osteoclastogenesis depends on RANKL to commit BMMs to the osteoclast lineage and RANKL regulates the lineage commitment through the IVVY motif. Mechanistically, the IVVY motif controls the lineage commitment by reprogramming osteoclast genes into an inducible state in which they can be activated by TNF. Our findings not only provide important mechanistic insights into the action of RANKL in TNF-mediated osteoclastogenesis but also establish that the IVVY motif may serve as an attractive therapeutic target for bone loss in various bone disorders.

TGF-beta1-induced migration of bone mesenchymal stem cells couples bone resorption with formation.

Bone remodeling depends on the precise coordination of bone resorption and subsequent bone formation. Disturbances of this process are associated with skeletal diseases, such as Camurati-Engelmann disease (CED). We show using in vitro and in vivo models that active TGF-beta1 released during bone resorption coordinates bone formation by inducing migration of bone marrow stromal cells, also known as bone mesenchymal stem cells, to the bone resorptive sites and that this process is mediated through a SMAD signaling pathway. Analyzing mice carrying a CED-derived mutant TGFB1 (encoding TGF-beta1), which show the typical progressive diaphyseal dysplasia seen in the human disease, we found high levels of active TGF-beta1 in the bone marrow. Treatment with a TGF-beta type I receptor inhibitor partially rescued the uncoupled bone remodeling and prevented the fractures. Thus, as TGF-beta1 functions to couple bone resorption and formation, modulation of TGF-beta1 activity could be an effective treatment for bone remodeling diseases.

YY1 is involved in RANKL-induced transcription of the tartrate-resistant acid phosphatase gene in osteoclast differentiation.

Receptor activator of nuclear factor kappa B (NF-kappaB) ligand (RANKL), a critical activator of osteoclast differentiation, plays a pivotal role in tartrate-resistant acid phosphatase (TRAP) gene expression. Previously, we showed that upstream stimulatory factors (USF) 1 and 2 are implicated in the RANKL-induced TRAP transcriptional activation via a 12-bp USF binding site in the TRAP promoter. In that study, we also demonstrated that a RANKL-induced nuclear protein binds to a 50-bp oligonucleotide (Oligo IV) corresponding to a distinct TRAP promoter region. Here we report the identification and functional characterization of the nuclear protein binding to Oligo IV. We identified a 21-bp sequence CTGTTTATGATGGCGAGGGGG in Oligo IV that specifically binds the RANKL-induced nuclear protein from RAW264.7 cells by performing a series of competition assays. Computer analysis of the 21-bp sequence revealed that the sequence contains a putative Yin Yang 1 (YY1) binding site overlapped with a putative activator protein-2 (AP-2) binding site. Competition and supershift assays indicated that the nuclear protein binding to the 21-bp sequence is YY1, not AP-2. Functionally, mutation of the YY1-binding site resulted in a reduction in the RANKL-induced TRAP transcription in RAW264.7 cells, demonstrating that YY1 positively regulates RANKL-induced TRAP transcriptional activation. In conclusion, our data demonstrated that YY1 plays a functional role in RANKL-mediated TRAP gene expression during osteoclast differentiation.

Functional identification of three receptor activator of NF-kappa B cytoplasmic motifs mediating osteoclast differentiation and function.

Receptor activator of NF-kappa B ligand (RANKL) and its receptor activator of NF-kappa B (RANK) play pivotal roles in osteoclast differentiation and function. However, the structural determinants of the RANK that mediate osteoclast formation and function have not been definitively identified. To address this issue, we developed a chimeric receptor approach that permits a structure/function study of the RANK cytoplasmic domain in osteoclasts. Using this approach, we examined the role of six RANK putative tumor necrosis factor receptor-associated factor-binding motifs (PTM) (PTM1, ILLMT-REE(286-293); PTM2, PSQPS(349-353); PTM3, PFQEP(369-373); PTM4, VYVSQTSQE(537-545); PTM5, PVQEET(559-564); and PTM6, PVQEQG(604-609)) in osteoclast formation and function. Our data revealed that the RANK cytoplasmic domain possesses three functional motifs (PFQEP(369-373), PVQEET(559-564), and PVQEQG(604-609)) capable of mediating osteoclast formation and function. Moreover, we demonstrated that these motifs play distinct roles in activating intracellular signaling. PFQEP(369-373) initiates NF-kappa B, c-Jun N-terminal kinase, extracellular signal-regulated kinase, and p38 signaling pathways and PVQEET(559-564) activates NF-kappa B and p38 pathways in osteoclasts, whereas PVQEQG(604-609) is only capable of activating NF-kappa B pathway. Significantly, the revelation of these functional RANK cytoplasmic motifs has not only laid a foundation for further delineating RANK signaling pathways in osteoclasts, but, more importantly, these RANK motifs themselves represent potential therapeutic targets for bone disorders such as osteoporosis.

Development of a chimaeric receptor approach to study signalling by tumour necrosis factor receptor family members.

Members of the tumour necrosis factor receptor family play a pivotal role in cell differentiation, function and apoptosis. However, signalling by many members of the family remains to be elucidated. In the present study, we developed a chimaeric receptor approach for studying signalling by receptors belonging to this family. The chimaeric receptor comprises the human Fas external domain linked to the transmembrane and cytoplasmic domains of a tumour necrosis factor receptor family member of interest. When the chimaera is expressed in mouse cells, the clustering of the chimaera induced by a human Fas-activating antibody activates the intracellular domain of the chimaera without affecting its endogenous counterpart. Since the antibody recognizes only human Fas, this approach can be used to dissect signalling by any tumour necrosis factor family member using any type of mouse cell including those endogenously expressing Fas. Moreover, we also showed that the chimaeric receptor approach can be used to study signalling at any stage of cell differentiation or function.

Involvement of upstream stimulatory factors 1 and 2 in RANKL-induced transcription of tartrate-resistant acid phosphatase gene during osteoclast differentiation.

Tartrate-resistant acid phosphatase (TRAP) plays an important role in bone resorption. TRAP expression in osteoclasts is regulated by receptor activator of NF-kappaB (RANKL), a potent activator of osteoclast differentiation. However, the molecular mechanism underlying the RANKL-induced TRAP expression remains unknown. Here we show that two regions in the mouse TRAP promoter (one at -1858 to -1239 and the other at -1239 to -1039, relative to the translation start site) are implicated in RANKL-induced TRAP transcription in RAW264.7 cells. A detailed characterization of the region at -1239 to -1039 identifies a 12-bp sequence, AGCCACGTGGTG, that specifically binds nuclear proteins from RAW264.7 cells and primary bone marrow macrophages (BMMs) in an electrophoretic mobility shift assay (EMSA). Moreover, the binding is significantly enhanced in EMSA with nuclear extracts from RANKL-treated RAW264.7 cells and BMMs, suggesting that the 12-bp sequence may be involved in RANKL-induced TRAP transcription. Various assays reveal that nuclear proteins binding to the 12-bp sequence are upstream stimulatory factors (USF) 1 and 2. Importantly, mutation of the USF-binding site partially blocks RANKL-induced TRAP transcription in RAW264.7 cells, confirming that USF1 and USF2 are functionally involved in RANKL-induced TRAP transcription. In summary, our data show that USF1 and USF2 play a functional role in RANKL-dependent TRAP expression during osteoclast differentiation.

Antisense oligonucleotide targeted to RIalpha subunit of cAMP-dependent protein kinase (GEM231) enhances therapeutic effectiveness of cancer chemotherapeutic agent irinotecan in nude mice bearing human cancer xenografts: in vivo synergistic activity, pharmacokinetics and host toxicity.

The RIalpha-subunit of cAMP-dependent protein kinase (PKA) is overexpressed in various human cancers and PKA has been suggested to be a potential target for cancer therapy. We have shown an antisense oligonucleotide with advanced chemistry (mixed-backbone oligonucleotide) targeted to PKA RIalpha-subunit (GEM231) to have anti-tumor activity in vitro and in vivo. In the present study, we demonstrated synergistic effects between the anti-PKA antisense oligonucleotide and the clinically used anticancer agent irinotecan, using nude mouse models of human cancers of colon (LS174T and DLD-1), breast (MCF-7), prostate (DU-145 and PC-3) and lung (H1299). To elucidate the underlying mechanisms, in vivo pharmacokinetics of irinotecan was determined following pre-treatment of oligo GEM 231 in CD-1 mice and nude mice bearing LS174T xenografts. GEM 231 increased tissue uptake of irinotecan. However, no significant change in host toxicity was observed following combination treatment of irinotecan and GEM231 compared with irinotecan alone. These results suggest that GEM231 have a role in irinotecan metabolism and its antitumor activity, providing a basis for future development of this oligonucleotide as a chemosensitizer for irinotecan-based therapy.