Changes in the GN/GCof the M segment show positive selection and recombination of one aggressive isolate and two mild isolates of tomato spotted wilt virus.

We isolated and compared three tomato spotted wilt virus (TSWV) isolates from lettuce (TSWV-Let), pepper (TSWV-Pep), and tomato (TSWV-Tom) from central Mexico to determine their ability to infect a set of eighteen differential plant species from seven families. TWSV-Let was an aggressive isolate with the ability to infect up to 52% of the differential plants, including maize, under greenhouse conditions. The nucleotide (nt) sequences of the three isolates are more than 90% similar in the M and S RNA segments. In the M segment of the TSWV-Let isolate, we detected nt changes in their intergenic region (IGR) and, in the Gc gene, a region containing a recombination site, as well as a synapomorphy associated with one of three sites under positive selection with a change in one aa residue (a cysteine-to-valine mutation). We speculate on the association of these features in the Gc gene with host selection, adaptation, aggressiveness, and ability to infect maize plants.

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants.

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavric et al. Plant Dis. 85:12, 2001.

Analysis of transgenic tobacco plants expressing a truncated form of a potyvirus coat protein nucleotide sequence.

Transgenic Nicotiana tabacum cv. Burley 49 plants were generated which expressed a tobacco etch virus (TEV) coat protein (CP) gene construct containing a stop codon positioned at codon 147. This gene construct was expected to produce a TEV CP lacking the carboxy-terminal 118 amino acids of the full-length 264 amino acid CP. TEV CP gene transcripts of the expected size could be detected in transgenic plants but the expected truncated CP could not be detected. Ten independent transgenic lines expressing this form of the TEV CP gene were examined in detail. Two transgenic plant lines were resistant to aphid- or mechanically transmitted TEV and one line was highly resistant. Protoplasts derived from the highly resistant plant line did not support virus replication. The data suggested that the expression of this mutated form of the TEV CP gene could interfere with TEV replication and displayed features associated with RNA-mediated virus resistance.

Induction of a Highly Specific Antiviral State in Transgenic Plants: Implications for Regulation of Gene Expression and Virus Resistance.

Transgenic tobacco plants expressing either a full-length form of the tobacco etch virus (TEV) coat protein or a form truncated at the N terminus of the TEV coat protein were initially susceptible to TEV infection, and typical systemic symptoms developed. However, 3 to 5 weeks after a TEV infection was established, transgenic plants "recovered" from the TEV infection, and new stem and leaf tissue emerged symptom and virus free. A TEV-resistant state was induced in the recovered tissue. The resistance was virus specific. Recovered plant tissue could not be infected with TEV, but was susceptible to the closely related virus, potato virus Y. The resistance phenotype was functional at the single-cell level because protoplasts from recovered transgenic tissue did not support TEV replication. Surprisingly, steady state transgene mRNA levels in recovered tissue were 12-to 22-fold less than transgene mRNA levels in uninoculated transgenic tissue of the same developmental stage. However, nuclear run-off studies suggested that transgene transcription rates in recovered and uninoculated plants were similar. We propose that the resistant state and reduced steady state levels of transgene transcript accumulation are mediated at the cellular level by a cytoplasmic activity that targets specific RNA sequences for inactivation.