Prevalence of TMJ pain symptom in adults and its association with predisposing factors / Prevalência do sintoma de dor na ATM em adultos e sua associação com fatores predisponentes

To estimate the prevalence of temporomandibular joint (TMJ) pain symptom and to verify its association with predisposing or perpetuating factors. Cross-sectional study of adult patients, with 488 medical records of patients assisted at the Clinics of the School of Dentistry of IMED, in the city of Passo Fundo, RS, Brazil. The data were collected through the anamnestic record based on patient self-report. The chi-square test at 5% significance level was used to evaluate the relationship between the outcome of TMJ pain and the variables. In addition, bivariate and multivariate Poisson analyses were performed at 5% significance level to confirm the associations, including to the multivariate analysis the variables with p ≤ 0.20 in the bivariate analysis. The prevalence of TMJ pain in this adult population was 21.52% (n=105).There was an association between TMJ pain and the variables of teeth clenching and habit of biting objects (p<0.05). This study concluded that the prevalence of TMJ pain symptom agrees with the mean prevalence found in the literature for studies with convenience samples, and teeth clenching and the habit of biting objects may represent perpetuating or predisposing factors for such condition.

Estimar a prevalência do sintoma dor na articulação temporomandibular (ATM) e verificar sua associação com fatores predisponentes ou perpetuantes. Estudo transversal de pacientes adultos, com 488 prontuários de pacientes atendidos na Clínica de graduação da Escola de Odontologia da IMED do município de Passo Fundo. Os dados foram coletados através da ficha anamnésica baseando-se no auto relato, do paciente. O teste do qui-quadrado, com nível de significância de 5%, foi utilizado para avaliar a relação entre o desfecho dor na ATM e as variáveis. E para confirmar as associações, foram realizadas análises de Poisson, bivariada e multivariada, com nível de significância de 5%, sendo incluídas na análise multivariada as variáveis com p ≤ 0,20 na análise bivariada. A prevalência de dor na ATM nessa população adulta foi de 21,52% (n=105).Encontrou-se associação entre dor na ATM e as variáveis apertamento dental e hábito de morder objetos (p<0.05). Neste estudo pode - se concluir que a prevalência do sintoma dor na ATM está de acordo com a média de prevalência encontrada na literatura para estudos com amostra de conveniência e os fatores apertamento dental e hábito de morder objetos podem ser perpetuantes ou predisponentes para tal condição.

Systems biology-based analysis implicates a novel role for vitamin D metabolism in the pathogenesis of age-related macular degeneration.

Vitamin D has been shown to have anti-angiogenic properties and to play a protective role in several types of cancer, including breast, prostate and cutaneous melanoma. Similarly, vitamin D levels have been shown to be protective for risk of a number of conditions, including cardiovascular disease and chronic kidney disease, as well as numerous autoimmune disorders such as multiple sclerosis, inflammatory bowel diseases and type 1 diabetes mellitus. A study performed by Parekh et al. was the first to suggest a role for vitamin D in age-related macular degeneration (AMD) and showed a correlation between reduced serum vitamin D levels and risk for early AMD. Based on this study and the protective role of vitamin D in diseases with similar pathophysiology to AMD, we examined the role of vitamin D in a family-based cohort of 481 sibling pairs. Using extremely phenotypically discordant sibling pairs, initially we evaluated the association of neovascular AMD and vitamin D/sunlight-related epidemiological factors. After controlling for established AMD risk factors, including polymorphisms of the genes encoding complement factor H (CFH) and age-related maculopathy susceptibility 2/HtrA serine peptidase (ARMS2/HTRA1), and smoking history, we found that ultraviolet irradiance was protective for the development of neovascular AMD (p = 0.001). Although evaluation of serum vitamin D levels (25-hydroxyvitamin D [25(OH)D]) was higher in unaffected individuals than in their affected siblings, this finding did not reach statistical significance. Based on the relationship between ultraviolet irradiance and vitamin D production, we employed a candidate gene approach for evaluating common variation in key vitamin D pathway genes (the genes encoding the vitamin D receptor [VDR]; cytochrome P450, family 27, subfamily B, polypeptide 1 [CYP27B1]; cytochrome P450, family 24, subfamily A, polypeptide 1 [CYP24A1]; and CYP27A1) in this same family-based cohort. Initial findings were then validated and replicated in the extended family cohort, an unrelated case-control cohort from central Greece and a prospective nested case-control population from the Nurse's Health Study and Health Professionals Follow-Up Studies, which included patients with all subtypes of AMD for a total of 2,528 individuals. Single point variants in CYP24A1 (the gene encoding the catabolising enzyme of the vitamin D pathway) were demonstrated to influence AMD risk after controlling for smoking history, sex and age in all populations, both separately and, more importantly, in a meta-analysis. This is the first report demonstrating a genetic association between vitamin D metabolism and AMD risk. These findings were also supplemented with expression data from human donor eyes and human retinal cell lines. These data not only extend previous biological studies in the AMD field, but further emphasise common antecedents between several disorders with an inflammatory/immunogenic component such as cardiovascular disease, cancer and AMD.

Over-expression of the BRMS1 family member SUDS3 does not suppress metastasis of human cancer cells.

BRMS1 and SUDS3 are related members of SIN3-HDAC chromatin remodeling complexes. We hypothesized that they might have overlapping functions and that SUDS3 over-expression could compensate for BRMS1 deficiency. SUDS3 expression was ubiquitous in seven breast cell lines, regardless of metastatic potential. SUDS3 over-expression in BRMS1-non-expressing metastatic cells did not suppress metastasis, motility, osteopontin secretion, or EGF receptor expression, phenotypes associated with BRMS1-mediated metastasis suppression. This study demonstrates functional differences for BRMS1 family members and highlights how the composition of SIN3-HDAC (BRMS1/SUDS3) complexes uniquely affects protein expression and biological behaviors.

Alterations of BRMS1-ARID4A interaction modify gene expression but still suppress metastasis in human breast cancer cells.

The BRMS1 metastasis suppressor interacts with the protein AT-rich interactive domain 4A (ARID4A, RBBP1) as part of SIN3.histone deacetylase chromatin remodeling complexes. These transcriptional co-repressors regulate diverse cell phenotypes depending upon complex composition. To define BRMS1 complexes and their roles in metastasis suppression, we generated BRMS1 mutants (BRMS1(mut)) and mapped ARID4A interactions. BRMS1(L174D) disrupted direct interaction with ARID4A in yeast two-hybrid genetic screens but retained an indirect association with ARID4A in MDA-MB-231 and -435 human breast cancer cell lines by co-immunoprecipitation. Deletion of the first coiled-coil domain (BRMS1(DeltaCC1)) did not disrupt direct interaction in yeast two-hybrid screens but did prevent association by co-immunoprecipitation. These results suggest altered complex composition with BRMS1(mut). Although basal transcription repression was impaired and the pro-metastatic protein osteopontin was differentially down-regulated by BRMS1(L174D) and BRMS1(DeltaCC1), both down-regulated the epidermal growth factor receptor and suppressed metastasis in MDA-MB-231 and -435 breast cancer xenograft models. We conclude that BRMS1(mut), which modifies the composition of a SIN3.histone deacetylase chromatin remodeling complex, leads to altered gene expression profiles. Because metastasis requires the coordinate expression of multiple genes, down-regulation of at least one important gene, such as the epidermal growth factor receptor, had the ability to suppress metastasis. Understanding which interactions are necessary for particular biochemical/cellular functions may prove important for future strategies targeting metastasis.

Prevalência de portadores de DTM em pacientes avaliados no setor de otorrinolaringologia / Prevalence of patients harboring temporomandibular disorders in an otorhinolaryngology departament

A interação entre disfunção temporomandibular e otalgia é, mesmo nos dias atuais, motivo para especulações e hipóteses. Vários pesquisadores sugerem causas, conseqüências e supostos tratamentos. OBJETIVO: Verificar a prevalência de pacientes portadores de DTM em um serviço de otorrinolaringologia. TIPO DE ESTUDO: Este é um estudo epidemiológico do tipo descritivo com amostra transversal. MATERIAL E MÉTODO: Foram avaliados 221 pacientes do Serviço de Otorrinolaringologia do Hospital da Cidade, em Passo Fundo, Rio Grande do Sul, durante um período de dois meses. Para captação e interpretação dos dados, bem como verificação da disfunção temporomandibular, foi utilizado um questionário auto-aplicado previamente validado. RESULTADO: Após coleta e interpretação dos dados de 221 pacientes, os resultados obtidos foram: 48 pacientes (21.72 por cento) considerados como necessitando de tratamento para DTM (índice de DTM moderada e severa), dos quais 35 pertenciam ao gênero feminino (72.9 por cento) e 13 ao masculino (21.1 por cento). Apenas 15 indivíduos do total (7.24 por cento) estavam totalmente livres de sintomas de DTM. Quanto aos demais, apresentaram: dor de cabeça (33,5 por cento), dor no pescoço e ombro (28,5 por cento), dor na região do ouvido (29 por cento) e ruídos articulares (25 por cento). CONCLUSÃO: A prevalência de DTM foi de 21.72 por cento sendo significantemente maior no gênero feminino (p: 0.0001); e as prevalências, em relação aos índices, foram: DTM ausente 37.56 por cento; DTM leve 40.72 por cento; DTM moderada 19 por cento, e DTM severa 2.72 por cento.

The interaction between Temporomandibular disorders (TMD) and otalgia is, even nowadays, a reason for speculation and hypotheses raising. Several researchers suggest causes, consequences and alleged treatments. STUDY DESIGN: This is an epidemiological, sectional cohort study of prevalence. AIM: The study demonstrates the prevalence of patients harboring TMDs in an otorhinolaryngology department. MATERIAL AND METHODOS: During a two-month period, 221 patients from the Otorhinolaryngology Department of the Hospital da Cidade de Passo Fundo, State of Rio Grande do Sul, Brazil were analyzed. A previously validated questionnaire was applied for data collection. RESULTS: In the present study, the need for dental assessment was observed in 48 patients ( 21.72 percent). In this group there were 35 female (72.9 percent) and 13 males (27.1 percent). Only 15 patients (7.24 percent) were entirely free of TMD symptoms. The remaining patients reported the following TMD symptoms: headaches: 34.39 percent, neck and shoulder pain: 28.50 percent, pain on the ear region: 30.32 percent and joint noises in 23.98 percent. CONCLUSION: The prevalence of Temporomandibular disorders was 21.72 percent, being significantly higher among female subjects (p:0.0001). The prevalence regarding the indexes, was: TMD absent: 37.56 percent; mild TMD: 40.72 percent; moderate TMD 19 percent and severe TMD: 2.72 percent.

YY1 is involved in RANKL-induced transcription of the tartrate-resistant acid phosphatase gene in osteoclast differentiation.

Receptor activator of nuclear factor kappa B (NF-kappaB) ligand (RANKL), a critical activator of osteoclast differentiation, plays a pivotal role in tartrate-resistant acid phosphatase (TRAP) gene expression. Previously, we showed that upstream stimulatory factors (USF) 1 and 2 are implicated in the RANKL-induced TRAP transcriptional activation via a 12-bp USF binding site in the TRAP promoter. In that study, we also demonstrated that a RANKL-induced nuclear protein binds to a 50-bp oligonucleotide (Oligo IV) corresponding to a distinct TRAP promoter region. Here we report the identification and functional characterization of the nuclear protein binding to Oligo IV. We identified a 21-bp sequence CTGTTTATGATGGCGAGGGGG in Oligo IV that specifically binds the RANKL-induced nuclear protein from RAW264.7 cells by performing a series of competition assays. Computer analysis of the 21-bp sequence revealed that the sequence contains a putative Yin Yang 1 (YY1) binding site overlapped with a putative activator protein-2 (AP-2) binding site. Competition and supershift assays indicated that the nuclear protein binding to the 21-bp sequence is YY1, not AP-2. Functionally, mutation of the YY1-binding site resulted in a reduction in the RANKL-induced TRAP transcription in RAW264.7 cells, demonstrating that YY1 positively regulates RANKL-induced TRAP transcriptional activation. In conclusion, our data demonstrated that YY1 plays a functional role in RANKL-mediated TRAP gene expression during osteoclast differentiation.

Involvement of upstream stimulatory factors 1 and 2 in RANKL-induced transcription of tartrate-resistant acid phosphatase gene during osteoclast differentiation.

Tartrate-resistant acid phosphatase (TRAP) plays an important role in bone resorption. TRAP expression in osteoclasts is regulated by receptor activator of NF-kappaB (RANKL), a potent activator of osteoclast differentiation. However, the molecular mechanism underlying the RANKL-induced TRAP expression remains unknown. Here we show that two regions in the mouse TRAP promoter (one at -1858 to -1239 and the other at -1239 to -1039, relative to the translation start site) are implicated in RANKL-induced TRAP transcription in RAW264.7 cells. A detailed characterization of the region at -1239 to -1039 identifies a 12-bp sequence, AGCCACGTGGTG, that specifically binds nuclear proteins from RAW264.7 cells and primary bone marrow macrophages (BMMs) in an electrophoretic mobility shift assay (EMSA). Moreover, the binding is significantly enhanced in EMSA with nuclear extracts from RANKL-treated RAW264.7 cells and BMMs, suggesting that the 12-bp sequence may be involved in RANKL-induced TRAP transcription. Various assays reveal that nuclear proteins binding to the 12-bp sequence are upstream stimulatory factors (USF) 1 and 2. Importantly, mutation of the USF-binding site partially blocks RANKL-induced TRAP transcription in RAW264.7 cells, confirming that USF1 and USF2 are functionally involved in RANKL-induced TRAP transcription. In summary, our data show that USF1 and USF2 play a functional role in RANKL-dependent TRAP expression during osteoclast differentiation.