METTL14 downregulation drives S100A4+ monocyte-derived macrophages via MyD88/NF-κB pathway to promote MAFLD progression.

Without intervention, a considerable proportion of patients with metabolism-associated fatty liver disease (MAFLD) will progress from simple steatosis to metabolism-associated steatohepatitis (MASH), liver fibrosis, and even hepatocellular carcinoma. However, the molecular mechanisms that control progressive MAFLD have yet to be fully determined. Here, we unraveled that the expression of the N6-methyladenosine (m6A) methyltransferase METTL14 is remarkably downregulated in the livers of both patients and several murine models of MAFLD, whereas hepatocyte-specific depletion of this methyltransferase aggravated lipid accumulation, liver injury, and fibrosis. Conversely, hepatic Mettl14 overexpression alleviated the above pathophysiological changes in mice fed on a high-fat diet (HFD). Notably, in vivo and in vitro mechanistic studies indicated that METTL14 downregulation decreased the level of GLS2 by affecting the translation efficiency mediated by YTHDF1 in an m6A-depedent manner, which might help to form an oxidative stress microenvironment and accordingly recruit Cx3cr1+Ccr2+ monocyte-derived macrophages (Mo-macs). In detail, Cx3cr1+Ccr2+ Mo-macs can be categorized into M1-like macrophages and S100A4-positive macrophages and then further activate hepatic stellate cells (HSCs) to promote liver fibrosis. Further experiments revealed that CX3CR1 can activate the transcription of S100A4 via CX3CR1/MyD88/NF-κB signaling pathway in Cx3cr1+Ccr2+ Mo-macs. Restoration of METTL14 or GLS2, or interfering with this signal transduction pathway such as inhibiting MyD88 could ameliorate liver injuries and fibrosis. Taken together, these findings indicate potential therapies for the treatment of MAFLD progression.

Gender dimorphism in hepatocarcinogenesis-DNA methylation modification regulated X-chromosome inactivation escape molecule XIST.

BACKGROUND: Sex disparities constitute a significant issue in hepatocellular carcinoma (HCC). However, the mechanism of gender dimorphism in HCC is still not completely understood. METHODS: 5-Hydroxymethylcytosine (5hmC)-Seal technology was utilised to detect the global 5hmC levels from four female and four male HCC samples. Methylation of XIST was detected by Sequenom MassARRAY methylation profiling between HCC tissues (T) and adjacent normal liver tissues (L). The role of Tet methylcytosine dioxygenase 2 (TET2) was investigated using diethylnitrosamine (DEN)-administered Tet2-/- female mice, which regulated XIST in hepatocarcinogenesis. All statistical analyses were carried out by GraphPad Prism 9.0 and SPSS version 19.0 software. RESULTS: The results demonstrated that the numbers of 5hmC reads in the first exon of XIST from female HCC tissues (T) were remarkably lower than that in female adjacent normal liver tissues (L). Correspondingly, DNA methylation level of XIST first exon region was significantly increased in female T than in L. By contrast, no significant change was observed in male HCC patients. Compared to L, the expression of XIST in T was also significantly downregulated. Female patients with higher XIST in HCC had a higher overall survival (OS) and more extended recurrence-free survival (RFS). Moreover, TET2 can interact with YY1 binding to the promoter region of XIST and maintain the hypomethylation state of XIST. In addition, DEN-administered Tet2-/- mice developed more tumours than controls in female mice. CONCLUSIONS: Our study provided that YY1 and TET2 could interact to form protein complexes binding to the promoter region of XIST, regulating the methylation level of XIST and then affecting the expression of XIST. This research will provide a new clue for studying sex disparities in hepatocarcinogenesis. HIGHLIGHTS: XIST was significantly downregulated in HCC tissues and had gender disparity. Methylation levels in the XIST first exon were higher in female HCC tissues, but no significant change in male HCC patients. The TET2-YY1 complex regulate XIST expression in female hepatocytes. Other ways regulate XIST expression in male hepatocytes.

Circular RNA cFAM210A, degradable by HBx, inhibits HCC tumorigenesis by suppressing YBX1 transactivation.

Hepatitis B protein x (HBx) has been reported to promote tumorigenesis in hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC), but the mechanism awaits further investigation. In this study, we found that cFAM210A (a circular RNA derived from the third exon of transcript NM_001098801 of the FAM210A gene; CircBase ID: hsa_circ_0003979) can be silenced by HBx. cFAM210A expression was downregulated and negatively correlated with tumorigenesis in patients with HBV-related HCC. Furthermore, cFAM210A reduced the proliferation, stemness, and tumorigenicity of HCC cells. Mechanistically, HBx increased the N6-methyladenosine (m6A) level of cFAM210A by promoting the expression of RBM15 (an m6A methyltransferase), thus inducing the degradation of cFAM210A via the YTHDF2-HRSP12-RNase P/MRP pathway. cFAM210A bound to YBX1 and inhibited its phosphorylation, suppressing its transactivation function toward MET. These findings suggest the important role of circular RNAs in HBx-induced hepatocarcinogenesis and identify cFAM210A a potential target in the prevention and treatment of HBV-related HCC.

The ligation between ERMAP, galectin-9 and dectin-2 promotes Kupffer cell phagocytosis and antitumor immunity.

Kupffer cells, the liver tissue resident macrophages, are critical in the detection and clearance of cancer cells. However, the molecular mechanisms underlying their detection and phagocytosis of cancer cells are still unclear. Using in vivo genome-wide CRISPR-Cas9 knockout screening, we found that the cell-surface transmembrane protein ERMAP expressed on various cancer cells signaled to activate phagocytosis in Kupffer cells and to control of liver metastasis. ERMAP interacted with ß-galactoside binding lectin galectin-9 expressed on the surface of Kupffer cells in a manner dependent on glycosylation. Galectin-9 formed a bridging complex with ERMAP and the transmembrane receptor dectin-2, expressed on Kupffer cells, to induce the detection and phagocytosis of cancer cells by Kupffer cells. Patients with low expression of ERMAP on tumors had more liver metastases. Thus, our study identified the ERMAP-galectin-9-dectin-2 axis as an 'eat me' signal for Kupffer cells.

Spatial maps of hepatocellular carcinoma transcriptomes reveal spatial expression patterns in tumor immune microenvironment.

Rationale: Hepatocellular carcinoma (HCC) is a highly heterogeneous and malignant disease with the complex immune microenvironment, which ultimately influence clinic outcomes of patients. However, the spatial expression patterns of diverse immune cells among tumor microenvironment remain to be further deciphered. Methods: Spatial transcriptomics sequencing (ST) was implemented on two portions of HCC specimens. Differentially expressed genes, cell cycle phases, epithelial-mesenchymal features, pseudo-time and immune infiltration analysis were applied to demonstrate the intratumor heterogeneity and define the specific immune-related regions, and the results were further validated by a second analysis on another ST study. In vitro and in vivo experiments were conducted to confirm the functional mechanisms of key molecules such as CCL15, CCL19 and CCL21. Clinical tissue samples were used to assess their potential prognostic and therapeutic values. Results: Totally, 7553 spots were categorized into 15 subsets by hierarchical clustering, and malignant subsets with intratumor heterogeneity phenotypes were identified. Spatial heterogeneity from distinct sectors highlights specific chemokines: CCL15 is remarkable in the core region of the carcinoma sector and facilitates the immunosuppressive microenvironment by recruiting and polarizing M2-like macrophages in vitro and in vivo; High expression of CCL15 and CD163 respectively predicts poor prognosis of HCC patients, and the combined application of them has better predictive value. CCL19 and CCL21, sharing similar spatial expression patterns, are highly-correlated and prominent in the immune infiltration enrichment and recruit CD3+ T cells and CD20+ B cells to inhibit the growth of HCC, indicating a good prognosis of HCC patients. Conclusions: Taken together, our studies preliminarily reveal intratumor heterogeneity of HCC based on ST techniques and unravel the previously unexplored spatial expression patterns in the immune microenvironment. We also highlight the clinical significance and spatial discrepancy of key molecules, providing novel insight for further developing therapeutic strategies in HCC.

METTL16 promotes hepatocellular carcinoma progression through downregulating RAB11B-AS1 in an m6A-dependent manner.

BACKGROUND: The molecular mechanisms driving hepatocellular carcinoma (HCC) remain largely unclear. As one of the major epitranscriptomic modifications, N6-methyladenosine (m6A) plays key roles in HCC. The aim of this study was to investigate the expression, roles, and mechanisms of action of the RNA methyltransferase methyltransferase-like protein 16 (METTL16) in HCC. METHODS: The expression of METTL16 and RAB11B-AS1 was determined by RT-qPCR. The regulation of RAB11B-AS1 by METTL16 was investigated by RNA immunoprecipitation (RIP), methylated RIP (MeRIP), and RNA stability assays. In vitro and in vivo gain- and loss-of-function assays were performed to investigate the roles of METTL16 and RAB11B-AS1. RESULTS: METTL16 was upregulated in HCC, and its increased expression was correlated with poor prognosis of HCC patients. METTL16 promoted HCC cellular proliferation, migration, and invasion, repressed HCC cellular apoptosis, and promoted HCC tumoral growth in vivo. METTL16 directly bound long noncoding RNA (lncRNA) RAB11B-AS1, induced m6A modification of RAB11B-AS1, and decreased the stability of RAB11B-AS1 transcript, leading to the downregulation of RAB11B-AS1. Conversely to METTL16, RAB11B-AS1 is downregulated in HCC, and its decreased expression was correlated with poor prognosis of patients with HCC. Furthermore, the expression of RAB11B-AS1 was negatively correlated with METTL16 in HCC tissues. RAB11B-AS1 repressed HCC cellular proliferation, migration, and invasion, promoted HCC cellular apoptosis, and inhibited HCC tumoral growth in vivo. Functional rescue assays revealed that overexpression of RAB11B-AS1 reversed the oncogenic roles of METTL16 in HCC. CONCLUSIONS: This study identified the METTL16/RAB11B-AS1 regulatory axis in HCC, which represented novel targets for HCC prognosis and treatment.

SLC38A4 functions as a tumour suppressor in hepatocellular carcinoma through modulating Wnt/ß-catenin/MYC/HMGCS2 axis.

BACKGROUND: Many molecular alterations are shared by embryonic liver development and hepatocellular carcinoma (HCC). Identifying the common molecular events would provide a novel prognostic biomarker and therapeutic target for HCC. METHODS: Expression levels and clinical relevancies of SLC38A4 and HMGCS2 were investigated by qRT-PCR, western blot, TCGA and GEO datasets. The biological roles of SLC38A4 were investigated by functional assays. The downstream signalling pathway of SLC38A4 was investigated by qRT-PCR, western blot, immunofluorescence, luciferase reporter assay, TCGA and GEO datasets. RESULTS: SLC38A4 silencing was identified as an oncofetal molecular event. DNA hypermethylation contributed to the downregulations of Slc38a4/SLC38A4 in the foetal liver and HCC. Low expression of SLC38A4 was associated with poor prognosis of HCC patients. Functional assays demonstrated that SLC38A4 depletion promoted HCC cellular proliferation, stemness and migration, and inhibited HCC cellular apoptosis in vitro, and further repressed HCC tumorigenesis in vivo. HMGCS2 was identified as a critical downstream target of SLC38A4. SLC38A4 increased HMGCS2 expression via upregulating AXIN1 and repressing Wnt/ß-catenin/MYC axis. Functional rescue assays showed that HMGCS2 overexpression reversed the oncogenic roles of SLC38A4 depletion in HCC. CONCLUSIONS: SLC38A4 downregulation was identified as a novel oncofetal event, and SLC38A4 was identified as a novel tumour suppressor in HCC.

Folic acid supplementation acts as a chemopreventive factor in tumorigenesis of hepatocellular carcinoma by inducing H3K9Me2-dependent transcriptional repression of LCN2.

The effects and mechanisms of folic acid (FA) as a chemopreventive agent for tumorigenesis of hepatocellular carcinoma (HCC) remain unclear. In this study, the QSG-7701, a human normal liver cell line, was cultured in different FA levels (High, Normal or No) for 6 months. Then, the biological characteristics, the expression of main stem cell-like genes or epithelial-mesenchymal transition (EMT) related genes and the tumorigenicity in vivo of cells cultured in different treatment groups were detected. Our results showed that No FA improved the malignant transformation of cells but High FA depressed the malignant transformation. Meanwhile, cells in different treatment groups were mapped by transcriptome sequencing. Then the relativity of increased LCN2 and decreased FA level was identified and confirmed in vitro and vivo. We also revealed that intracellular control of LCN2 would recover the effects of FA on cell proliferation, cell cycle and tumor formation in vitro and vivo. Finally, our studies displayed that increased FA level induced the down-regulation of LCN2 not by DNA hypermethylation of LCN2 promoter but by promoting the level of histone H3 lysine 9 di-methylation (H3K9Me2) in LCN2 promoter. In conclusion, our studies disclosed the chemopreventive effect of FA supplementation on hepatocarcinogenesis, which partial attributed to the inhibition of LCN2 by regulating histone methylation in promoter. Our results provide a potential mechanism of the chemoprevention of FA supplementation on tumorigenesis of HCC and may be helpful in developing treatment target against HCC.

Plasma circular RNA panel to diagnose hepatitis B virus-related hepatocellular carcinoma: A large-scale, multicenter study.

To explore whether plasma circular RNAs (circRNAs) can diagnose hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC), microarray and qPCR were used to identify plasma circRNAs that were increased in HBV-related HCC patients compared to controls (including healthy controls, chronic hepatitis B and HBV-related liver cirrhosis). A logistic regression model was constructed using a training set (n = 313) and then validated using another two independent sets (n = 306 and 526, respectively). Area under the receiver operating characteristic curve (AUC) was used to evaluate diagnostic accuracy. We identified a plasma circRNA panel (CircPanel) containing three circRNAs (hsa_circ_0000976, hsa_circ_0007750 and hsa_circ_0139897) that could detect HCC. CircPanel showed a higher accuracy than AFP (alpha-fetoprotein) to distinguish individuals with HCC from controls in all three sets (AUC, 0.863 [95% confidence interval, CI: 0.819-0.907] vs. 0.790 [0.738-0.842], p = 0.036 in training set; 0.843 [0.796-0.890] vs. 0.747 [0.691-0.804], p = 0.011 in validation set 1 and 0.864 [0.830-0.898] vs. 0.769 [0.728-0.810], p < 0.001 in validation set 2). CircPanel also performed well in detecting Small-HCC (solitary, ≤3 cm), AFP-negative HCC and AFP-negative Small-HCC.

CD24: a marker of granulosa cell subpopulation and a mediator of ovulation.

Granulosa cells (GCs) play a critical role in driving the formation of ovarian follicles and building the cumulus-oocyte complex surrounding the ovum. We are particularly interested in assessing oocyte quality by examining the detailed gene expression profiles of human cumulus single cells. Using single-cell RNAseq techniques, we extensively investigated the single-cell transcriptomes of the cumulus GC populations from two women with normal ovarian function. This allowed us to elucidate the endogenous heterogeneity of GCs by uncovering the hidden GC subpopulation. The subsequent validation results suggest that CD24(+) GCs are essential for triggering ovulation. Treatment with human chorionic gonadotropin (hCG) significantly increases the expression of CD24 in GCs. CD24 in cultured human GCs is associated with hCG-induced upregulation of prostaglandin synthase (ARK1C1, PTGS2, PTGES, and PLA2G4A) and prostaglandin transporter (SLCO2A1 and ABCC4) expression, through supporting the EGFR-ERK1/2 pathway. In addition, it was observed that the fraction of CD24(+) cumulus GCs decreases in PCOS patients compared to that of controls. Altogether, the results support the finding that CD24 is an important mediator of ovulation and that it may also be used for therapeutic target of ovulatory disorders.

Genome-wide screening identifies oncofetal lncRNA Ptn-dt promoting the proliferation of hepatocellular carcinoma cells by regulating the Ptn receptor.

Oncofetal genes are genes that express abundantly in both fetal and tumor tissues yet downregulated or undetected in adult tissues, and can be used as tumor markers for cancer diagnosis and treatment. Meanwhile, long noncoding RNAs (lncRNAs) are known to play crucial roles in the pathogenesis of hepatocellular carcinoma (HCC), including tumor growth, proliferation, metastasis, invasion, and recurrence. We performed a genome-wide screening using microarrays to detect the lncRNA expression profiles in fetal livers, adult livers, and liver cancer tissues from mice to identify oncofetal lncRNAs in HCC. From the microarray data analysis, we identified lncRNA Ptn-dt as a possible oncofetal gene. Both in vitro and in vivo experiments results confirmed that overexpression of Ptn-dt significantly promoted the proliferation of mouse HCC cells. RNA pulldown assay showed that Ptn-dt could interact with the HuR protein. Interestingly, miR-96 binds with HuR to maintain its stability as well. Overexpression of lncRNA Ptn-dt led to the downregulation of miR-96, which might be due to the interaction between Ptn-dt and HuR. Meanwhile, previous studies have reported that Ptn can promote tumor growth and vascular abnormalization via anaplastic lymphoma kinase (Alk) signaling. In our study, we found that overexpression of Ptn-dt could promote the expression of Alk through repressing miR-96 via interacting with HuR, thus enhancing the biologic function of Ptn. In summary, a new oncofetal lncRNA Ptn-dt is identified, and it can promote the proliferation of HCC cells by regulating the HuR/miR-96/Alk pathway and Ptn-Alk axis.

A novel HBx genotype serves as a preoperative predictor and fails to activate the JAK1/STATs pathway in hepatocellular carcinoma.

BACKGROUND & AIMS: Genetic variability in the hepatitis B virus X gene (HBx) is frequently observed and is associated with hepatocellular carcinoma (HCC) progression. However, a genotype classification based on the full-length HBx sequence and the impact of genotypes on hepatitis B virus (HBV)-related HCC prognosis remain unclear. We therefore aimed to perform this genotype classification and assess its clinical impact. METHODS: We classified the genotypes of the full-length HBx gene through sequencing and a cluster analysis of HBx DNA from a cohort of patients with HBV-related HCC, which served as the primary cohort (n = 284). Two independent HBV-related HCC cohorts, a validation cohort (n = 171) and a serum cohort (n = 168), were used to verify the results. Protein microarray assay analysis was performed to explore the underlying mechanism. RESULTS: In the primary cohort, the HBx DNA was classified into 3 genotypes: HBx-EHBH1, HBx-EHBH2, and HBx-EHBH3. HBx-EHBH2 (HBx-E2) indicated better recurrence-free survival and overall survival for patients with HCC. HBx-E2 was significantly correlated with the absence of liver cirrhosis, a small tumor size, a solitary tumor, complete encapsulation and Barcelona Clinic Liver Cancer (BCLC) stage A-0 tumors. Additionally, HBx-E2 served as a significant prognostic factor for patients with BCLC stage B HCC after hepatectomy. Mechanistically, HBx-E2 is unable to promote proliferation in HCC cells and normal hepatocytes. It also fails to activate the Janus kinase 1 (JAK1)/signal transducer and activator of transcription 3 (STAT3)/STAT5 pathway. CONCLUSION: Our study identifies a novel HBx genotype that is unable to promote the proliferation of HCC cells and suggests a potential marker to preoperatively predict the prognosis of patients with BCLC stage B, HBV-associated, HCC. LAY SUMMARY: We classified a novel genotype of the full-length hepatitis B virus X gene (HBx), HBx-E2. This genotype was identified in tumor and nontumor tissues from patients with hepatitis B virus-related hepatocellular carcinoma. HBx-E2 could preoperatively predict the prognosis of patients with intermediate stage hepatocellular carcinoma, after resection.

The altered activity of P53 signaling pathway by STK11 gene mutations and its cancer phenotype in Peutz-Jeghers syndrome.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.

Overactivated neddylation pathway in human hepatocellular carcinoma.

Dysregulation of the neddylation pathway is related to various cancers. However, the specific role of the neddylation pathway in human hepatocellular carcinoma (HCC) remains largely unclear. In this study, the neddylation pathway in HCC and adjacent noncancerous liver (ANL) tissues was evaluated by immunohistochemistry (IHC), Western blotting, and qRT-PCR (quantitative real-time polymerase chain reaction). The results showed that the entire neddylation pathway, including NEDD8 (the IHC staining of NEDD8 represents the global-protein neddylation), E1 NEDD8-activating enzymes (NAE1 and UBA3), E2 NEDD8-conjugating enzymes (UBE2F and UBE2M), E3 NEDD8-ligases (MDM2, RBX1 and RNF7), and deneddylation enzymes (COPS5, UCHL1 and USP21), was overactivated in HCC. Furthermore, the upregulation of NEDD8 in HCC was correlated with aggressive characteristics and was an independent risk factor for overall survival (OS) and recurrence-free survival (RFS) in patients with HCC after hepatectomy. The upregulation of NAE1, UBE2M, and UCHL1 in HCC was associated with aggressive characteristics and poor OS and RFS in patients with HCC after hepatectomy. In conclusion, our research reveals that the entire neddylation pathway is overactivated in HCC and associated with clinical characteristics and prognosis of patients with HCC.

Circular RNA cSMARCA5 inhibits growth and metastasis in hepatocellular carcinoma.

BACKGROUND & AIMS: In recent years, circular RNAs (circRNAs) have been shown to have critical regulatory roles in cancer biology. However, the contributions of circRNAs to hepatocellular carcinoma (HCC) remain largely unknown. METHODS: cSMARCA5 (a circRNA derived from exons 15 and 16 of the SMARCA5 gene, hsa_circ_0001445) was identified by RNA-sequencing and validated by quantitative reverse transcription PCR. The role of cSMARCA5 in HCC progression was assessed both in vitro and in vivo. circRNAs in vivo precipitation, luciferase reporter assay, biotin-coupled microRNA capture and fluorescence in situ hybridization were conducted to evaluate the interaction between cSMARCA5 and miR-17-3p/miR-181b-5p. RESULTS: The expression of cSMARCA5 was lower in HCC tissues, because of the regulation of DExH-Box Helicase 9, an abundant nuclear RNA helicase. The downregulation of cSMARCA5 in HCC was significantly correlated with aggressive characteristics and served as an independent risk factor for overall survival and recurrence-free survival in patients with HCC after hepatectomy. Our in vivo and in vitro data indicated that cSMARCA5 inhibits the proliferation and migration of HCC cells. Mechanistically, we found that cSMARCA5 could promote the expression of TIMP3, a well-known tumor suppressor, by sponging miR-17-3p and miR-181b-5p. CONCLUSION: These results reveal an important role of cSMARCA5 in the growth and metastasis of HCC and provide a fresh perspective on circRNAs in HCC progression. LAY SUMMARY: Herein, we studied the role of cSMARCA5, a circular RNA, in hepatocellular carcinoma. Our in vitro and in vivo data showed that cSMARCA5 inhibits the growth and migration of hepatocellular carcinoma cells, making it a potential therapeutic target.

A novel germline mutation (c.A527G) in STK11 gene causes Peutz-Jeghers syndrome in a Chinese girl: A case report.

RATIONALE: Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. PATIENT CONCERNS: A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. DIAGNOSES: She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. INTERVENTIONS: Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. OUTCOMES: A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. LESSONS: PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.

Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

LncRNA-PAGBC acts as a microRNA sponge and promotes gallbladder tumorigenesis.

Long noncoding RNAs (lncRNAs) play roles in the development and progression of many cancers; however, the contributions of lncRNAs to human gallbladder cancer (GBC) remain largely unknown. In this study, we identify a group of differentially expressed lncRNAs in human GBC tissues, including prognosis-associated gallbladder cancer lncRNA (lncRNA-PAGBC), which we find to be an independent prognostic marker in GBC Functional analysis indicates that lncRNA-PAGBC promotes tumour growth and metastasis of GBC cells. More importantly, as a competitive endogenous RNA (ceRNA), lncRNA-PAGBC competitively binds to the tumour suppressive microRNAs miR-133b and miR-511. This competitive role of lncRNA-PAGBC is required for its ability to promote tumour growth and metastasis and to activate the AKT/mTOR pathway. Moreover, lncRNA-PAGBC interacts with polyadenylate binding protein cytoplasmic 1 (PABPC1) and is stabilized by this interaction. This work provides novel insight on the molecular pathogenesis of GBC.