Interaction of aloe active compounds with calf thymus DNA.

Natural anthraquinone compounds have emerged as potent anticancer chemotherapeutic agents because of their promising DNA-binding properties. Aloe vera is among one of the very well-known medicinal plants, and the anthraquinone derivatives like aloe emodin (ALM), aloins (ALN), and aloe emodin-8-glucoside (ALMG) are known to have immense biological activities. Here, we have used biophysical methods to elucidate the comparative DNA-binding abilities of these three molecules. Steady-state fluorescence study indicated complexation between calf thymus DNA (ctDNA) and both the molecules ALM and ALMG whereas ALN showed very weak interaction with DNA. Displacement assays with ctDNA-bound intercalator (ethidium bromide) and a groove binder (Hoechst 33258) indicated preferential binding of both ALM and ALMG to minor groove of DNA. Isothermal titration calorimetric (ITC) data suggested spontaneous exothermic single binding mode of both the molecules: ALM and ALMG. Entropy is the most important factor which contributed to the standard molar Gibbs energy associated with relatively small favorable enthalpic contribution. The equilibrium constants of binding to ctDNA were (6.02 ± 0.10) × 104  M-1 and (4.90 ± 0.11) × 104  M-1 at 298.15 K, for ALM and ALMG, respectively. The enthalpy vs temperature plot yielded negative standard molar heat capacity value, and a strong negative correlation between enthalpy and entropy terms was observed which indicates the enthalpy entropy compensation behavior in both systems. All these thermodynamic phenomena indicate that hydrophobic force is the key factor which is involved in the binding process. Moreover, the enhancement of thermal stability of DNA helix by ALM and ALMG fully agreed to the complexation of these molecules with DNA.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Exploring the binding interaction of potent anticancer drug topotecan with human serum albumin: spectroscopic, calorimetric and fibrillation study.

This manuscript describes the interaction of the topoisomerase I inhibitor anticancer drug topotecan with human serum albumin using microcalorimetry, circular dichroism, and atomic force microscopy imaging techniques. Conformational change in albumin was ascertained from circular dichroism and synchronous fluorescence study that revealed a small but definitive partial unfolding of the protein structure upon drug binding. Isothermal titration calorimetry study indicated a favorable exothermic interaction with a binding affinity of the order of ~105 M-1 at 293.15 K. A 1:1 binding stoichiometry was established. The binding reaction was largely enthalpy dominated with negative standard molar Gibbs energy change. Ionic strength variation study revealed that non-polyelectrolytic forces played dominant role in the interaction and remained almost invariant at all salt concentrations. Upon complex formation, the stabilization of the protein structure against thermal denaturation occurred. Atomic force microscopy study enabled imaging of fibrils of the protein and its complex with topotecan.

Small molecule-RNA recognition: Binding of the benzophenanthridine alkaloids sanguinarine and chelerythrine to single stranded polyribonucleotides.

Single stranded RNAs are biologically potent as they participate in various key cellular processes. The binding efficacy of two potent anticancer alkaloids, sanguinarine (here after SANG) and chelerythrine (here after CHEL), with single-stranded ribonucleic acids poly(rI), poly(rG), and poly(rC) were studied using spectroscopic and thermodynamic tools. Results reveal that both SANG and CHEL binds well with single stranded RNAs with affinity in the order poly(rI)>poly(rG)>poly(rC). CHEL showed slightly higher affinity compared to SANG with all the single stranded RNAs. Both SANG and CHEL showed association affinity of the lower 106 order with poly(rI), higher 105 order binding with poly(rG) and lower 105 order with poly(rC). The binding mode was partial intercalation due to the staking interaction between the bases and the alkaloids. The complexation of both the SANG and CHEL to the RNAs were mainly enthalpy driven and also favoured by entropy changes. Perturbation was observed in the RNA conformation due to binding of the alkaloids. In this present study we have deciphered the fundamental structural and calorimetric aspects of the interaction of the natural benzophenanthridine alkaloids with single stranded RNAs and these results may help to develop new generation alkaloid based therapeutics targeting single stranded RNAs.

Targeting human telomeric G-quadruplex DNA with antitumour natural alkaloid aristololactam-ß-D-glucoside and its comparison with daunomycin.

Study on anticancer agents that act via stabilization of telomeric G-quadruplex DNA has emerged as novel and exciting field for anticancer drug discovery. The interaction of carbohydrate containing anticancer alkaloid aristololactam-ß-D-glucoside (ADG) with human telomeric G-quadruplex DNA sequence was characterized by different biophysical techniques. The binding parameters were compared with daunomycin (DAN), a well-known chemotherapeutic drug. The Scatchard binding isotherms revealed noncooperative binding for both with the binding affinity values of (1.01 ± 0.05) × 106 and (1.78 ± 0.18) × 106 M-1 for ADG and DAN, respectively. Circular dichroism, ferrocyanide quenching study, anisotropy study, thiazole orange displacement, optical melting, differential scanning calorimetry study, and molecular docking study suggest significant stacking and stabilizing efficiency of ADG with comparison to DAN. The energetics of the interaction for ADG and DAN revealed that both reactions were predominantly entropy driven. Negative heat capacity values were obtained from the temperature dependence of the enthalpy change. The standard molar Gibbs energy change exhibited only marginal alterations with temperature suggesting the occurrence of enthalpy-entropy compensation. These findings indicate that ADG can act as a stabilizer of telomeric G-quadruplex DNA and thereby can be considered as a potential telomerase inhibitor.

Small molecule induced poly(A) single strand to self-structure conformational switching: evidence for the prominent role of H-bonding interactions.

All messenger RNAs (mRNAs) have a polyadenylic acid tail that is added during post transcriptional RNA processing. Investigation of the structure-function and interactions of polyadenylic acid is an important area to target for cancer and related diseases. Jatrorrhizine and coptisine are two important isoquinoline alkaloids that are structurally very similar, differing only in the substituents on the isoquinoline chromophore. Here we demonstrate that these alkaloids differentially induce a self-structure in single stranded poly(A) using absorbance, thermal melting and differential scanning calorimetry experiments. Jatrorrhizine was found to be more effective than coptisine in binding to poly(A) from spectroscopy and calorimetry data. Molecular modeling results suggested the involvement of more H-bonds in the complexation of the former with poly(A). It appears that the presence of substituents on the alkaloid that can form H-bonding interactions with the adenine nucleotides may play a critical role in the binding and structural rearrangement of poly(A) into the self-structure. The atomic force microscopy data directly visualized the poly(A) self-structured network. We propose a plausible mechanism of the small molecule induced self-structure formation in poly(A). The results presented here may help in the design of effective poly(A) targeted molecules for therapeutic use.

Naphthalenediimide-Linked Bisbenzimidazole Derivatives as Telomeric G-Quadruplex-Stabilizing Ligands with Improved Anticancer Activity.

Human telomeric G-quadruplex DNA stabilization has emerged as an exciting novel approach for anticancer drug development. In the present study, we have designed and synthesized three C2-symmetric bisubstituted bisbenzimidazole naphthalenediimide (NDI) ligands, ALI-C3 , BBZ-ARO, and BBZ-AROCH2 , which stabilize human telomeric G-quadruplex DNA with high affinity. Herein, we have studied the binding affinities and thermodynamic contributions of each of these molecules with G-quadruplex DNA and compared the same to those of the parent NDI analogue, BMSG-SH-3. Results of fluorescence resonance energy transfer and surface plasmon resonance demonstrate that these ligands have a higher affinity for G4-DNA over duplex DNA and induce the formation of a G-quadruplex. The binding equilibrium constants obtained from the microcalorimetry studies of BBZ-ARO, ALI-C3 , and BBZ-AROCH2 were 8.47, 6.35, and 3.41 µM, respectively, with h-telo 22-mer quadruplex. These showed 10 and 100 times lower binding affinity with h-telo 12-mer and duplex DNA quadruplexes, respectively. Analysis of the thermodynamic parameters obtained from the microcalorimetry study suggests that interactions were most favorable for BBZ-ARO among all of the synthesized compounds. The ΔGfree obtained from molecular mechanics Poisson-Boltzmann surface area calculations of molecular dynamics (MD) simulation studies suggest that BBZ-ARO interacted strongly with G4-DNA. MD simulation results showed the highest hydrogen bond occupancy and van der Waals interactions were between the side chains of BBZ-ARO and the DNA grooves. A significant inhibition of telomerase activity (IC50 = 4.56 µM) and induced apoptosis in cancer cell lines by BBZ-ARO suggest that this molecule has the potential to be developed as an anticancer agent.

Molecular Recognition of tRNA with 1-Naphthyl Acetyl Spermine, Spermine, and Spermidine: A Thermodynamic, Biophysical, and Molecular Docking Investigative Approach.

The role of tRNA in protein translational machinery and the influence of polyamines on the interaction of acylated and deacylated tRNA with ribosomes make polyamine-tRNA interaction conspicuous. We studied the interaction of two biogenic polyamines, spermine (SPM) and spermidine (SPD), with tRNAPhe and compared the results to those of the analogue 1-naphthyl acetyl spermine (NASPM). The binding affinity of SPM was comparable to that of NASPM; both were higher than that of SPD. The interactions led to significant thermal stabilization of tRNAPhe and an increase in the enthalpy of transition. All the interactions were exothermic in nature and displayed prominent enthalpy-entropy compensation behavior. The entropy-driven nature of the interaction, the structural perturbations observed, and docking results proved that the polyamines were bound in the groove of the anticodon arm of tRNAPhe. The amine groups of polyamines were involved in extensive electrostatic, H-bonding, and van der Waals interactions with tRNAPhe. The naphthyl group of NASPM showed an additional stacking interaction with G24 and G26 of tRNAPhe, which was absent in others. The results demonstrate that 1-naphthyl acetyl spermine can target the same binding sites as the biogenic polyamines without substituting for the functions played by them, which may lead to exhibition of selective anticancer cytotoxicity.

Structural and thermodynamic analysis of the binding of tRNA(phe) by the putative anticancer alkaloid chelerythrine: Spectroscopy, calorimetry and molecular docking studies.

The interaction of the putative anticancer alkaloid chelerythrine with tRNA(phe) was characterized by spectroscopy, calorimetry and molecular docking studies. The charged iminium form of chelerythrine binds with tRNA(phe) in a cooperative mode with a binding affinity value of (4.06±0.01)×10(5)M(-1). The neutral alkanolamine form does not bind to tRNA(phe) but in the presence of high concentration of tRNA(phe) this form gets converted to the iminium form and then binds with tRNA(phe). The partial intercalative mode of binding of chelerythrine to the tRNA(phe) was characterized from the steady state anisotropy, iodide ion-induced fluorescence quenching and viscosity measurements. Chelerythrine binding induced conformational perturbations in tRNA(phe) as observed from the circular dichroism spectroscopy. The strong binding was also supported by the ethidium bromide displacement assay. The binding was favoured by both enthalpy and entropy contributions. Although the binding was dependent on the [Na(+)], non-electrostatic forces contributed predominantly to the Gibbs energy change. The negative value of the heat capacity change proposed the involvement of hydrophobic forces in the binding. Molecular docking study was carried out to decipher the details of the recognition of tRNA(phe) by chelerythrine. The study provided insights about the chelerythrine binding pockets on tRNA(phe) and marked the necessary interactions for binding of chelerythrine molecule. Partially intercalative mode of the alkaloid binding was supported by docking studies. In total, docking studies corroborated well with our experiential observations. The structural and thermodynamic results of chelerythrine binding to tRNA(phe) may be helpful to develop new RNA therapeutic agents.

Binding of the alkaloid aristololactam-ß-D-glucoside and daunomycin to human hemoglobin: spectroscopy and calorimetry studies.

The interaction of the plant alkaloid aristololactam-ß-D-glucoside (ADG) and the anticancer agent daunomycin (DAN) with human hemoglobin was studied by different spectroscopic and calorimetric methods. The binding affinity values of ADG and DAN, estimated from spectroscopic experiments, were 3.79 × 10(4) and 6.68 × 10(4) M(-1), respectively. From circular dichroism, 3D fluorescence, and FTIR studies it was observed that, DAN induced stronger conformational changes than ADG in the protein. From synchronous fluorescence spectroscopy results, a pronounced shift in the maximum emission wavelength of tyrosine residues was observed in both cases suggesting that the drugs changed the polarity around tyrosine residues with marginal change around the tryptophan residues. The thermodynamics of the binding interaction analyzed using microcalorimetry presented single binding events that were exothermic in nature in both cases. The binding was driven by large positive standard molar entropy changes with small favorable enthalpy contributions. Negative heat capacity changes in both cases are correlated to the involvement of significant hydrophobic forces in the complexation process. The affinity of DAN to Hb was higher than that of ADG.

Natural isoquinoline alkaloids: binding aspects to functional proteins, serum albumins, hemoglobin, and lysozyme.

The putative anticancer alkaloids berberine, palmatine, jatrorrhizine, and sanguinarine are known to bind to nucleic acids. To develop them as potential drugs for therapeutic use, their binding affinity to functional proteins and mode of transport in the circulatory system need to be clearly understood. Towards this, many studies on their binding aspects to proteins have been reported and a considerable amount of data, mostly of biophysical nature, exists in the literature. The importance of these natural isoquinoline alkaloids and the recent literature on their interaction phenomena with functional proteins, serum albumins, hemoglobin, and lysozyme are presented in this review.

Binding of the iminium and alkanolamine forms of sanguinarine to lysozyme: spectroscopic analysis, thermodynamics, and molecular modeling studies.

Sanguinarine (SGR) exists in charged iminium (SGRI) and neutral alkanolamine (SGRA) forms. The binding of these two forms to the protein lysozyme (Lyz) was investigated by fluorescence, UV-vis absorbance and circular dichroism spectroscopy, and in silico molecular docking approaches. Binding thermodynamics were studied by microcalorimetry. Both forms of sanguinarine quenched the intrinsic fluorescence of Lyz, but the quenching efficiencies varied on the basis of binding that was derived after correction for an inner-filter effect. The equilibrium binding constants at 25 ± 1.0 °C for the iminium and alkanolamine forms were 1.17 × 10(5) and 3.32 × 10(5) M(-1), respectively, with approximately one binding site for both forms of the protein. Conformational changes of the protein in the presence of SGR were confirmed by absorbance, circular dichroism, three-dimensional fluorescence, and synchronous fluorescence spectroscopy. Microcalorimetry data revealed that SGRI binding is endothermic and predominantly involves electrostatic and hydrophobic interactions, whereas SGRA binding is exothermic and dominated by hydrogen-bonding interactions. The molecular distances (r) of 3.27 and 3.04 nm between the donor (Lyz) and the SGRI and SGRA acceptors, respectively, were calculated according to Förster's theory. These data suggested that both forms were bound near the Trp-62/63 residues of Lyz. Stronger binding of SGRA than SGRI was apparent from the results of both structural and thermodynamic experiments. Molecular docking studies revealed that the putative binding site for the SGR analogues resides at the catalytic site. The docking results are in accordance with the spectroscopic and thermodynamic data, further validating the stronger binding of SGRA over SGRI to Lyz. The binding site is situated near a deep crevice on the protein surface and is close to several crucial amino acid residues, including Asp-52, Glu-35, Trp-62, and Trp-63. This study advances our knowledge of the structural nature and thermodynamic aspects of binding between the putative anticancer alkaloid sanguinarine and lysozyme.

Targeting double-stranded RNA with spermine, 1-naphthylacetyl spermine and spermidine: a comparative biophysical investigation.

RNA targeting is an evolving new approach to anticancer therapeutics that requires identification of small molecules to selectively target specific RNA structures. In this report, the interaction of biogenic polyamines spermine, spermidine and the synthetic analogue 1-naphthylacetyl spermine with three double-stranded RNA polynucleotides--poly(I)·poly(C), poly(C)·poly(G), and poly(A)·poly(U)--has been described to understand the structural and thermodynamic basis of the binding and the comparative efficacy of the analogue over the natural polyamines. Circular dichroism spectroscopy, thermal melting experiments, and ethidium bromide displacement assay were used to characterize the interaction. Microcalorimetry studies were performed to deduce the energetics of the interaction and atomic force microscopy experiments done to gain insight into the interaction at the molecular level. The experiments demonstrated structural perturbations in the polynucleotides on binding of the polyamines. Thermal melting studies showed enhanced stabilization of RNA-polyamine complexes with increase in the total standard molar enthalpy of transition. The binding affinity was strongest for poly(I)·poly(C) as revealed by microcalorimetry results and varied as poly(I)·poly(C) > poly(C)·poly(G) > poly(A)·poly(U). The order of affinity for the polyamines was spermine >1-naphthylacetyl spermine > spermidine. Total enthalpy-entropy compensation and high standard molar heat capacity values characterized the interactions. The results of the study on the binding of polyamines to dsRNAs presented here have been compared to those reported earlier with dsDNAs. The present findings advance our knowledge on the mechanism of interaction of polyamines with RNA and may help in the search for analogues that can interfere with biogenic polyamine metabolism and function.

Elucidation of the DNA binding specificity of the natural plant alkaloid chelerythrine: a biophysical approach.

Interaction of the anticancer plant alkaloid chelerythrine with four sequence specific synthetic polynucleotides was studied by spectroscopy and calorimetry experiments. The binding resulted in strong hypochromic and bathochromic effects in the absorption spectrum of the alkaloid, enhancement in the fluorescence with the AT polynucleotides and the homo-GC polynucleotide and quenching with the hetero-GC polynucleotide. Cooperative binding was observed with all the polynucleotides. Fluorescence polarization anisotropy, iodide quenching and viscosity results confirmed intercalative binding of the alkaloid. The binding resulted in the thermal stabilization of the polynucleotides and moderate perturbations in the B-conformation of the DNA. The high binding affinity values (∼10(6) M(-1)) evaluated from the spectroscopic data was in excellent agreement with those obtained from calorimetry. The binding was exothermic and favoured by negative standard molar enthalpy and positive standard molar entropic contributions in all cases other than homo-AT polynucleotide, where it was endothermic and entropy driven. Salt-dependent calorimetry data revealed that the binding reaction was driven mostly by non-polyelectrolytic forces. The magnitude of the negative heat capacity values confirmed the role of significant hydrophobic effects in the interaction profile of the alkaloid with the polynucleotides. The results revealed the specificity of chelerythrine to follow homo-GC>hetero-GC>hetero-AT=homo-AT polynucleotide.

Structural and thermodynamic studies on the interaction of iminium and alkanolamine forms of sanguinarine with hemoglobin.

Binding of the iminium and alkanolamine forms of the benzophenanthridine anticancer alkaloid sanguinarine to hemoglobin (Hb) was investigated by absorbance, fluorescence, and circular dichroism spectral techniques, and by calorimetry. The binding affinity of the charged iminium was found to be of the order of 10(6) M(-1), higher by one order than that of the neutral alkanolamine, from the analysis of the absorbance data. The fluorescence spectral data revealed that the quenching of Hb fluorescence by both forms of sanguinarine is due to the formation of a complex in the ground state and is of an unusual, static nature. Thermodynamic data revealed that the binding of the iminium form was exothermic in nature while that of the alkanolamine was endothermic; the former case predominantly involved electrostatic and hydrogen bonding interactions but the latter was dominated by mostly hydrophobic interactions. Calculation of the molecular distances (r) between the donor (ß-Trp37) and acceptor (iminium and alkanolamine) according to Förster's theory suggests both forms of the alkaloid to be bound close to ß-Trp37 at the α1ß2 interface of the protein. The iminium form induced greater secondary structural changes in Hb than the alkanolamine as revealed by synchronous fluorescence, circular dichroism and three-dimensional fluorescence spectroscopic studies. These results are consistent with a stronger binding of the iminium over the alkanolamine form. Nevertheless, the hydrophobic probe ANS was displaced from hemoglobin more easily by the alkanolamine form than by the iminium. The study showed that Hb binds more strongly to the biologically active iminium form than the alkanolamine, in contrast to the stronger binding of the latter to plasma protein serum albumin. Overall, this study presents insights on the interaction dynamics and energetics of the binding of the two forms of sanguinarine to hemoglobin.

Biophysical characterization of the strong stabilization of the RNA triplex poly(U)•poly(A)*poly(U) by 9-O-(ω-amino) alkyl ether berberine analogs.

BACKGROUND: Binding of two 9-O-(ω-amino) alkyl ether berberine analogs BC1 and BC2 to the RNA triplex poly(U)(•)poly(A)(*)poly(U) was studied by various biophysical techniques. METHODOLOGY/PRINCIPAL FINDINGS: Berberine analogs bind to the RNA triplex non-cooperatively. The affinity of binding was remarkably high by about 5 and 15 times, respectively, for BC1 and BC2 compared to berberine. The site size for the binding was around 4.3 for all. Based on ferrocyanide quenching, fluorescence polarization, quantum yield values and viscosity results a strong intercalative binding of BC1 and BC2 to the RNA triplex has been demonstrated. BC1 and BC2 stabilized the Hoogsteen base paired third strand by about 18.1 and 20.5 °C compared to a 17.5 °C stabilization by berberine. The binding was entropy driven compared to the enthalpy driven binding of berbeine, most likely due to additional contacts within the grooves of the triplex and disruption of the water structure by the alkyl side chain. CONCLUSIONS/SIGNIFICANCE: Remarkably higher binding affinity and stabilization effect of the RNA triplex by the amino alkyl berberine analogs was achieved compared to berberine. The length of the alkyl side chain influence in the triplex stabilization phenomena.

Binding of the anticancer alkaloid sanguinarine with tRNA(phe): spectroscopic and calorimetric studies.

The interaction of the natural plant alkaloid and anticancer agent sanguinarine with tRNA(phe) has been investigated by spectroscopic and calorimetric techniques. Sanguinarine iminium binds to tRNA(phe) cooperatively; alkanolamine does not bind but in presence of large tRNA(phe) concentration, a conversion from alkanolamine to iminium occurs resulting in concomitant binding of the latter. The binding affinity of the iminium to tRNA(phe) obtained from isothermal titration calorimetry was of the order of 10(5) M(-1), which is close to that evaluated from spectroscopy. The binding was driven largely by negative enthalpy and a smaller but favourable positive entropy change. The binding was dependent on the [Na(+)] concentration, but had a larger non-electrostatic contribution to the Gibbs energy. A small heat capacity value and the enthalpy-entropy compensation in the energetics of the interaction characterized the binding of the iminium form to tRNA(phe). This study confirms that the tRNA(phe) binding moiety is the iminium form of sanguinarine.

Probing the binding of two sugar bearing anticancer agents aristololactam-ß-(D)-glucoside and daunomycin to double stranded RNA polynucleotides: a combined spectroscopic and calorimetric study.

The plant alkaloid aristololactam-ß-d-glucoside and the anticancer chemotherapy drug daunomycin are two sugar bearing DNA binding antibiotics. The binding of these molecules to three double stranded ribonucleic acids, poly(A)·poly(U), poly(I)·poly(C) and poly(C)·poly(G), was studied using various biophysical techniques. Absorbance and fluorescence studies revealed that these molecules bound non-cooperatively to these ds RNAs with the binding affinities of the order 10(6) for daunomycin and 10(5) M(-1) for aristololactam-ß-d-glucoside. Fluorescence quenching and viscosity studies gave evidence for intercalative binding. The binding enhanced the melting temperature of poly(A)·poly(U) and poly(I)·poly(C) and the binding affinity values evaluated from the melting data were in agreement with that obtained from other techniques. Circular dichroism results suggested minor conformational perturbations of the RNA structures. The binding was characterized by negative enthalpy and positive entropy changes and the affinity constants derived from calorimetry were in agreement with that obtained from spectroscopic data. Daunomycin bound all the three RNAs stronger than aristololactam-ß-d-glucoside and the binding affinity varied as poly(A)·poly(U) > poly(I)·poly(C) > poly(C)·poly(G). The temperature dependence of the enthalpy changes yielded negative values of heat capacity changes for the complexation suggesting substantial hydrophobic contribution to the binding process. Furthermore, an enthalpy-entropy compensation behavior was also seen in all systems. These results provide new insights into binding of these small molecule drugs to double stranded RNA sequences.

Targeting RNA by small molecules: comparative structural and thermodynamic aspects of aristololactam-ß-D-glucoside and daunomycin binding to tRNA(phe).

BACKGROUND: Interaction of aristololactam-ß-D-glucoside and daunomycin with tRNA(phe) was investigated using various biophysical techniques. METHODOLOGY/PRINCIPAL FINDINGS: Absorption and fluorescence studies revealed that both the compounds bind tRNA(phe) non-cooperatively. The binding of daunomycin was about one order of magnitude higher than that of aristololactam-ß-D-glucoside. Stronger binding of the former was also inferred from fluorescence quenching data, quantum efficiency values and circular dichroic results. Results from isothermal titration calorimetry experiments suggested that the binding of both compounds was predominantly entropy driven with a smaller but favorable enthalpy term that increased with temperature. A large favorable electrostatic contribution to the binding of daunomycin to tRNA(phe) was revealed from salt dependence data and the dissection of the free energy values. The electrostatic component to the free energy change for aristololactam-ß-D-glucoside-tRNA(phe) interaction was smaller than that of daunomycin. This was also inferred from the slope of log K versus [Na(+)] plots. Both compounds enhanced the thermal stability of tRNA(phe). The small heat capacity changes of -47 and -99 cal/mol K, respectively, observed for aristololactam-ß-D-glucoside and daunomycin, and the observed enthalpy-entropy compensation phenomenon confirmed the involvement of multiple weak noncovalent interactions. Molecular aspects of the interaction have been revealed. CONCLUSIONS/SIGNIFICANCE: This study presents the structural and energetic aspects of the binding of aristololactam-ß-D-glucoside and daunomycin to tRNA(phe).

Interaction of the anticancer plant alkaloid sanguinarine with bovine serum albumin.

BACKGROUND: Interaction of the iminium and alkanolamine forms of sanguinarine with bovine serum albumin (BSA) was characterized by spectroscopic and calorimetric techniques. METHODOLOGY/PRINCIPAL FINDINGS: Formation of strong complexes of BSA with both iminium and alkanolamine forms was revealed from fluorescence quenching of sanguinarine. Binding parameters calculated from Stern-Volmer quenching method revealed that the neutral alkanolamine had higher affinity to BSA compared to the charged iminium form. Specific binding distances of 3.37 and 2.38 nm between Trp 212 (donor) and iminium and alkanolamine forms (acceptor), respectively, were obtained from Forster resonance energy transfer studies. Competitive binding using the site markers warfarin and ibuprofen, having definite binding sites, demonstrated that both forms of sanguinarine bind to site I (subdomain IIA) on BSA. Sanguinarine binding alters protein conformation by reducing the α-helical organization and increasing the coiled structure, indicating a small but definitive partial unfolding of the protein. Thermodynamic parameters evaluated from isothermal titration calorimetry suggested that the binding was enthalpy driven for the iminium form but favoured by negative enthalpy and strong favourable entropy contributions for the alkanolamine form, revealing the involvement of different molecular forces in the complexation. CONCLUSIONS/SIGNIFICANCE: The results suggest that the neutral alkanolamine form binds to the protein more favourably compared to the charged iminium, in stark contrast to the reported DNA binding preference of sanguinarine.