Development of a Pseudocellular System to Quantify Specific Interactions Determining the G-Quadruplex Function in Cells.

Intracellular chemical microenvironments, including ion concentrations and molecular crowding, play pivotal roles in cell behaviors, such as proliferation, differentiation, and cell death via regulation of gene expression. However, there is no method for quantitative analysis of intracellular environments due to their complexity. Here, we have developed a system for highlighting the environment inside of the cell (SHELL). SHELL is a pseudocellular system, wherein small molecules are removed from the cell and a crowded intracellular environment is maintained. SHELL offers two prominent advantages: (1) It allows for precise quantitative biochemical analysis of a specific factor, and (2) it enables the study of any cell, thereby facilitating the study of target molecule effects in various cellular environments. Here, we used SHELL to study G-quadruplex formation, an event that implicated cancer. We show that G-quadruplexes are more stable in SHELL compared with in vitro conditions. Although malignant transformation perturbs cellular K+ concentrations, environments in SHELL act as buffers against G-quadruplex destabilization at lower K+ concentrations. Notably, the buffering effect was most pronounced in SHELL derived from nonaggressive cancer cells. Stable G-quadruplexes form due to the binding of the G-quadruplex with K+ in different cancer cells. Furthermore, the observed pattern of G-quadruplex-induced transcriptional inhibition in SHELL is consistent with that in living cells at different cancer stages. Our results indicate that ion binding to G-quadruplexes regulates gene expression during pathogenesis.

Association of circulating CD34+ cells level and prognosis after ischemic stroke.

BACKGROUND: CD34 is a transmembrane phosphoglycoprotein and a marker of hematopoietic and nonhematopoietic stem/progenitor cells. In experimental studies, CD34+ cells are rich sources of endothelial progenitor cells and can promote neovascularization and endothelial repair. The potential role of CD34+ cells in stroke patients remains unclear. AIMS: We aimed to assess the prognostic effect of circulating CD34+ cell levels on the risk of vascular events and functional prognosis in stroke patients. PATIENTS AND METHODS: In this prospective observational study, patients with ischemic stroke were consecutively enrolled within 1 week of onset and followed up for 1 year. Patients were divided into three groups according to tertiles of the level of circulating CD34+ cells (Tertile 1, <0.51/µL; Tertile 2, 0.51-0.96/µL; and Tertile 3, >0.96/µL). The primary outcome was a composite of major adverse cardiovascular events (MACEs), including nonfatal stroke, nonfatal acute coronary syndrome, major peripheral artery disease, and vascular death. The secondary outcomes included the modified Rankin scale (mRS) scores. RESULTS: A total of 524 patients (mean age, 71.3 years; male, 60.1%) were included. High CD34+ cell levels were associated with younger age (p < 0.001) and low National Institutes of Health Stroke Scale scores at admission (p = 0.010). No significant differences were found in the risk of MACEs among the three groups (annual rates: 15.0%, 13.4%, and 12.6% in Tertiles 1, 2, and 3, respectively; log-rank p = 0.70). However, there were significant differences in the mRS scores at 3 months (median (interquartile range); 2 (1-4), 1 (1-3), and 1 (0-2) in Tertiles 1, 2, and 3, respectively; p = 0.010) and 1 year (3 (1-4), 2 (1-4), and 1 (0-3); p < 0.001) among these groups. After multivariable adjustments, a higher CD34+ cell level was independently associated with good functional outcomes (mRS score of 0-2) at 3 months (adjusted odds ratio (OR), 1.43; 95% confidence interval (CI), 1.01-2.05) and 1 year (adjusted OR, 1.53; 95% CI, 1.09-2.16). CONCLUSION: Although no correlations were found between circulating CD34+ cell levels and vascular event risk, elevated CD34+ cell levels were associated with favorable functional recovery in stroke patients. DATA ACCESS STATEMENT: Data supporting the findings of this study are available from the corresponding author on reasonable request. CLINICAL TRIAL REGISTRATION: The TWMU Stroke Registry is registered at https://upload.umin.ac.jp as UMIN000031913.

Theranostic approach to specifically targeting the interloop region of BCL2 i-motif DNA by crystal violet.

Ligands that recognise specific i-motif DNAs are helpful in cancer diagnostics and therapeutics, as i-motif formation can cause cancer. Although the loop regions of i-motifs are promising targets for ligands, the interaction between a ligand and the loop regions based on sequence information remains unexplored. Herein, we investigated the loop regions of various i-motif DNAs to determine whether these regions specifically interact with fluorescent ligands. Crystal violet (CV), a triphenylmethane dye, exhibited strong fluorescence with the i-motif derived from the promoter region of the human BCL2 gene in a sequence- and structure-specific manner. Our systematic sequence analysis indicated that CV was bound to the site formed by the first and third loops through inter-loop interactions between the guanine bases present in these loops. As the structural stability of the BCL2 i-motif was unaffected by CV, the local stabilisation of the loops by CV could inhibit the interaction of transcription factors with these loops, repressing the BCL2 expression of MCF-7 cells. Our finding suggests that the loops of the i-motif can act as a novel platform for the specific binding of small molecules; thus, they could be utilised for the theranostics of diseases associated with i-motif DNAs.

Replication Control of Human Telomere G-Quadruplex DNA by G-Quadruplex Ligands Dependent on Solution Environment.

The human telomere region is known to contain guanine-rich repeats and form a guanine-quadruplex (G4) structure. As telomeres play a role in the regulation of cancer progression, ligands that specifically bind and stabilize G4 have potential therapeutic applications. However, as the human telomere sequence can form G4 with various topologies due to direct interaction by ligands and indirect interaction by the solution environment, it is of great interest to study the topology-dependent control of replication by ligands. In the present study, a DNA replication assay of a template with a human telomere G4 sequence in the presence of various ligands was performed. Cyclic naphthalene diimides (cNDI1 and cNDI2) efficiently increased the replication stall of the template DNA at G4 with an anti-parallel topology. This inhibition was stability-dependent and topology-selective, as the replication of templates with hybrid or parallel G4 structures was not affected by the cNDI and cNDI2. Moreover, the G4 ligand fisetin repressed replication with selectivity for anti-parallel and hybrid G4 structures without stabilization. Finally, the method used, referred to as quantitative study of topology-dependent replication (QSTR), was adopted to evaluate the correlation between the replication kinetics and the stability of G4. Compared to previous results obtained using a modified human telomere sequence, the relationship between the stability of G4 and the effect on the topology-dependent replication varied. Our results suggest that native human telomere G4 is more flexible than the modified sequence for interacting with ligands. These findings indicate that the modification of the human telomeric sequence forces G4 to rigidly form a specific structure of G4, which can restrict the change in topology-dependent replication by some ligands.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

Preferential targeting cancer-related i-motif DNAs by the plant flavonol fisetin for theranostics applications.

The relationship of i-motif DNAs with cancer has prompted the development of specific ligands to detect and regulate their formation. Some plant flavonols show unique fluorescence and anti-cancer properties, which suggest the utility of the theranostics approach to cancer therapy related to i-motif DNA. We investigated the effect of the plant flavonol, fisetin (Fis), on the physicochemical property of i-motif DNAs. Binding of Fis to the i-motif from the promoter region of the human vascular endothelial growth factor (VEGF) gene dramatically induced the excited state intramolecular proton transfer (ESIPT) reaction that significantly enhanced the intensity of the tautomer emission band of Fis. This unique response was due to the coincidence of the structural change from i-motif to the hairpin-like structure which is stabilized via putative Watson-Crick base pairs between some guanines within the loop region of the i-motif and cytosines in the structure. As a result, the VEGF i-motif did not act as a replication block in the presence of Fis, which indicates the applicability of Fis for the regulation of gene expression of VEGF. The fluorescence and biological properties of Fis may be utilised for theranostics applications for cancers related to a specific cancer-related gene, such as VEGF.

Design and Properties of Ligand-Conjugated Guanine Oligonucleotides for Recovery of Mutated G-Quadruplexes.

The formation of a guanine quadruplex DNA structure (G4) is known to repress the expression of certain cancer-related genes. Consequently, a mutated G4 sequence can affect quadruplex formation and induce cancer progression. In this study, we developed an oligonucleotide derivative consisting of a ligand-containing guanine tract that replaces the mutated G4 guanine tract at the promoter of the vascular endothelial growth factor (VEGF) gene. A ligand moiety consisting of three types of polyaromatic hydrocarbons, pyrene, anthracene, and perylene, was attached to either the 3' or 5' end of the guanine tract. Each of the ligand-conjugated guanine tracts, with the exception of anthracene derivatives, combined with other intact guanine tracts to form an intermolecular G4 on the mutated VEGF promoter. This intermolecular G4, exhibiting parallel topology and high thermal stability, enabled VEGF G4 formation to be recovered from the mutated sequence. Stability of the intramolecular G4 increased with the size of the conjugated ligand. However, suppression of intermolecular G4 replication was uniquely dependent on whether the ligand was attached to the 3' or 5' end of the guanine tract. These results indicate that binding to either the top or bottom guanine quartet affects unfolding kinetics due to polarization in DNA polymerase processivity. Our findings provide a novel strategy for recovering G4 formation in case of damage, and fine-tuning processes such as replication and transcription.

Recovery of the Formation and Function of Oxidized G-Quadruplexes by a Pyrene-Modified Guanine Tract.

Oxidation is one of the frequent causes of DNA damage, especially to guanine bases. Guanine bases in the G-quadruplex (G4) are sensitive to damage by oxidation, resulting in transformation to 8-oxo-7,8-dihydroguanine (8-oxoG). Because the formation of G4 represses the expression of some cancer-related genes, the presence of 8-oxoG in a G4 sequence might affect G4 formation and induce cancer progression. Thus, oxidized-G4 formation must be controlled using a chemical approach. In the present study, we investigated the effect of introduction of 8-oxoG into a G4 sequence on the formation and function of the G4 structure. The 8-oxoG-containing G4 derived from the promoter region of the human vascular endothelial growth factor ( VEGF) gene differed topologically from unoxidized G4. The oxidized VEGF G4 did not act as a replication block and was not stabilized by the G4-binding protein nucleolin. To recover G4 function, we developed an oligonucleotide consisting of a pyrene-modified guanine tract that replaces the oxidized guanine tract and forms stable intermolecular G4s with the other intact guanine tracts. When this oligonucleotide was used, the oxidized G4 stalled replication and was stabilized by nucleolin as with the unmodified G4. This strategy generally enables recovery of the function of any oxidized G4s and therefore has potential for cancer therapy.

Traveling Time of a translating ribosome along messenger RNA monitored directly on a quartz crystal microbalance.

During translation, the biosynthesis of polypeptides is dynamically regulated. The translation rate along messenger RNA (mRNA), which is dependent on the codon, structure, and sequence, is not always constant. However, methods for measuring the duration required for polypeptide elongation on an mRNA of interest have not been developed. In this work, we used a quartz crystal microbalance (QCM) technique to monitor mRNA translation in an Escherichia coli cell-free translation system in real time. This method permitted us to evaluate the translation of proteins of interest fused upstream of a streptavidin-binding peptide (SBP) fusion protein. The translation of mRNA encoding the SBP fusion protein alone was observed as a mass increase on a streptavidin-modified QCM plate. Addition of the protein of interest resulted in a delay in the mass change corresponding to the traveling time of the ribosome along the coding region of the protein of interest. With this technique, the lengths of coding sequences, codon usages, influences of unique sequences, and various protein-coding sequences were evaluated. The results showed that the traveling time of the translating ribosome depends on the length of the coding region translated but is also affected by the sequence itself. Differences in the time lags for various proteins imply that mRNA coding sequences may regulate gene expression.

Real-time monitoring of cell-free translation on a quartz-crystal microbalance.

The efficiency of protein synthesis is often regulated post-transcriptionally by sequences within the mRNA. To investigate the reactions of protein translation, we established a system that allowed real-time monitoring of protein synthesis using a cell-free translation mixture and a 27 MHz quartz-crystal microbalance (QCM). Using an mRNA that encoded a fusion polypeptide comprising the streptavidin-binding peptide (SBP) tag, a portion of Protein D as a spacer, and the SecM arrest sequence, we could follow the binding of the SBP tag, while it was displayed on the 70S ribosome, to a streptavidin-modified QCM over time. Thus, we could follow a single turnover of protein synthesis as a change in mass. This approach allowed us to evaluate the effects of different antibiotics and mRNA sequences on the different steps of translation. From the results of this study, we have determined that both the formation of the initiation complex from the 70S ribosome, mRNA, and fMet-tRNA(fMet) and the accommodation of the second aminoacyl-tRNA to the initiation complex are rate-limiting steps in protein synthesis.