Genomic Analysis and Development of Infectious Clone of a Novel Carlavirus Infecting Blueberry.

A new blueberry virus was discovered using high-throughput sequencing. Using sequence identity values, phylogenetics, and serological and biological properties, we propose the virus, putatively named blueberry virus S (BluVS), to be a distinct species within the genus Carlavirus (family Betaflexiviridae). The genome was analyzed in depth, and an infectious clone was developed to initiate studies on virus pathogenicity. Agroinfiltration of the binary vector construct produced severe systemic symptoms in Nicotiana occidentalis. Back-inoculation using sap from agroinfiltrated N. occidentalis produced identical symptoms to the recipient plants (N. occidentalis), and virus purification yielded flexuous carlavirus-like particles. However, unlike blueberry scorch virus (BlScV), BluVS caused symptomless infection in Chenopodium quinoa and reacted weakly to BlScV antibodies in an enzyme-linked immunosorbent assay. Collectively, the results provide evidence for the distinct speciation of BluVS. The availability of an infectious clone provides tools for future studies on the biology of the virus.

First Report of Olive mild mosaic virus and Sowbane mosaic virus in Spinach in Greece.

Uncommon, viruslike symptoms (yellowing, line patterns, leaf deformation, and necrosis), were observed in spinach fields in the Marathon area, Greece in 2004. Seedlings from the same seed lot, grown in the greenhouse, also developed the same viruslike symptoms, indicating that the causal agent(s) of the disorder is seed-transmissible. Spinach seedlings of the same variety but a different lot and herbaceous indicators (Chenopodium quinoa, C. amaranticolor, Sonchus oleraceus, and Nicotiana benthamiana) were mechanically inoculated with infected material. Spinach developed yellowing or necrotic spots whereas indicators showed variety of symptoms including mosaic, vein banding, and necrotic lesions. Virus purifications, double-stranded RNA extractions, cloning, and sequencing (2,3) followed by a combination of molecular (reverse transcription [RT]-PCR and immunocapture RT-PCR) and serological (ELISA) techniques with antisera provided by Dr. Avgelis were performed as described (4), verifying the presence of two viruses in the diseased seedlings: Sowbane mosaic virus (SoMV), a sobemovirus, was present in spinach and indicators with mottling and leaf deformation, whereas Olive mild mosaic virus (OMMV), a necrovirus, was present in plants with necrotic spots. All RT-PCR products amplified with primers SoMV-F (5'-CAAATGGTCTTGGTCAGCAGTC)/SoMV-R (5'-GCATACGCTCGACGATCTG) and OMMV-F (5'-CAAACCCAGCCTGTGTTCGATG)/OMMV-R (5'-CATCAGTTTGGTAATCCATTGA) were sequenced and found to confirm the other results. The SoMV-spinach isolate polyprotein gene sequence (GenBank Accession No. DQ450973) has 95% sequence identity with the type isolate from C. quinoa (GenBank Accession No. GQ845002), whereas the OMMV-spinach isolate (GenBank Accession No. JQ288895) has 92% sequence identity with the OMMV type isolate from olive (GenBank Accession No. AY616760). SoMV has been found to naturally infect spinach in the Netherlands (1) and, to our knowledge, this is the first report on spinach in Greece. The presence of OMMV in spinach is, to our knowledge, the first report worldwide. Its natural host range is limited to olive, tulip, and now spinach. OMMV might be transmitted by Olpidium spp. and may, according to data of its close relatives, persist in the soil for several decades. Pollen- and seedborne viruses (PSVs) like sobemoviruses and necroviruses are of particular importance for a crop like spinach where crop increase takes place in small, seed production-designated areas. If a PSV spreads in such an area it has the potential to become a major problem for the industry, especially when it remains undetected. Infected seed can be shipped worldwide with PSVs, causing diseases and becoming endemic in areas where they were absent. For this reason and the fact that field losses can exceed 50%, rigorous monitoring for the presence of SoMV and OMMV in seed fields is essential to minimize the possibility of the viruses moving to new areas. References: (1) L. Bos and N. Huijberts. Eur. J. Plant Pathol. 102:707, 1996. (2) S. M. Girgis et al., Eur. J. Plant Pathol. 125:203, 2009, (3) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005. (4) I. E. Tzanetakis et al. Virus Res. 121:199, 2006.

Genomic sequences of blackberry chlorotic ringspot virus and strawberry necrotic shock virus and the phylogeny of viruses in subgroup 1 of the genus Ilarvirus.

Three members of subgroup 1 of the genus Ilarvirus: blackberry chlorotic ringspot (BCRV), strawberry necrotic shock (SNSV), and tobacco streak viruses (TSV), may infect Rubus and Fragaria species. All cause symptoms similar to those previously attributed to infection by TSV alone. Although similarities exist among the genomic sequences of the three, phylogenetic analysis shows them to be distinct viruses. These viruses and Parietaria mottle virus, the other currently accepted member of subgroup 1, appear to have evolved from a common ancestral virus, share conserved motifs in the products of the genomic RNAs, and constitute a distinct subgroup within the genus.

First Report of Cucumber mosaic virus Infecting Blephilia hirsuta in North America.

Blephilia hirsuta (Pursh) Benth. var. hirsuta, an ornamental plant known as hairy pagoda or hairy wood mint (Lamiaceae), is native to eastern North America and is listed as an endangered species or a species of special concern in several northeastern states ( http://www.ct.gov/dep/cwp/view.asp?a=2702&q=323482&depNav_GID=1628 and http://www.mass.gov/dfwele/dfw/nhesp/species_info/mesa_list/mesa_list.htm ). B. hirsuta, grown as an ornamental on the University of Arkansas campus in Fayetteville, exhibited mottling symptoms indicative of viral infection. Double-stranded RNA extractions (3) yielded four bands of approximately 3.2, 2.9, 2.2, and 0.9 kb, a pattern identical to that of Cucumber mosaic virus (CMV [2]). Nicotiana benthamiana and Chenopodium quinoa seedlings were mechanically inoculated with sap from symptomatic tissue. N. benthamiana inoculated plants were stunted and developed systemic mosaic and C. quinoa inoculated plants developed local lesions, whereas mock inoculated plants remained symptomless. Dot-blot and indirect ELISA using antisera against CMV (developed by H. A Scott) gave strong reactions when testing symptomatic tissue from B. hirusta, N. benthamiana, and C. quinoa compared with no reaction for symptomless plants. Total nucleic acid extractions (4) from symptomatic tissue was subjected to reverse transcription-PCR using Cucumovirus degenerate primers (1). An amplicon of approximately 940 bases was obtained and sequenced. The sequence, deposited in GenBank under Accession No. GU453918, confirmed the results of the immunological assays that B. hirsuta was infected with CMV. The nucleotide identities between the B. hirsuta isolate and those of the Fny CMV group exceeded 98%. To our knowledge, this is the first report of CMV infecting B. hirsuta, not only in North America, but globally. This finding has major implications for the ornamental industry and the viability of the endangered species. Given the wide range of CMV, B. hirsuta may act as a reservoir for the virus and facilitate transmission to ornamentals and other plants. In addition, the virus may reduce host fitness and undermine the efforts to preserve the species in areas that is threatened. References: (1) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (2) I. E. Tzanetakis. Plant Dis. 93:431, 2009. (3) I. E. Tzanetakis and R. R. Martin. J. Virol. Methods 149:167, 2008. (4) I. E. Tzanetakis et al. Virus Res. 127:26, 2007.

First Report of Cucumber mosaic virus in Anemone sp. in the United States.

In the spring of 2008, more than a dozen, aphid-infested, anemone plants (Anemone sp.) grown at the campus of the University of Arkansas in Fayetteville showed stunting and mosaic, whereas only two were asymptomatic. Leaf homogenates from four symptomatic plants were inoculated onto Nicotiana benthamiana that became stunted and developed severe mosaic approximately 7 days postinoculation, whereas buffer-inoculated plants remained asymptomatic. Double-stranded RNA (dsRNA) extraction (4) from symptomatic anemone revealed the presence of four predominant bands of approximately 3.2, 2.9, 2.2, and 0.9 kbp, a pattern indicative of cucumovirus infection. Cucumber mosaic virus (CMV) is the only cucumovirus reported in anemone in Europe (2) and Israel (3), and for this reason, anemone and N. benthamiana plants were tested by Protein A ELISA with antisera against CMV developed by H. A. Scott. ELISA verified the presence of CMV in symptomatic anemone and inoculated N. benthamiana, while asymptomatic plants were free of the virus. Using cucumovirus degenerate primers, essentially as described by Choi et al. (1), a region of approximately 940 bases that includes the complete coat protein gene of the virus was amplified from symptomatic anemone and N. benthamiana but not asymptomatic plants of either species. This anemone isolate (GenBank Accession No. FJ375723) belongs to the IA subgroup of CMV because it shares 99% nucleotide and 100% amino acid sequence identities with the Fny isolates of the virus. To my knowledge, this is the first report of CMV infecting anemone in the United States and an important discovery for the ornamental industry since anemone is commonly grown together with several ornamental hosts of CMV in nursery and garden settings. References: (1) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (2) M. Hollings. Ann. Appl. Biol. 45:44, 1957 (3) G. Loebenstein. Acta Hortic. 722:31, 2006 (4) I. E. Tzanetakis and R. R. Martin, J. Virol. Methods 149:167, 2008.

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States.

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5'-GTTTCCTGTGCTCCTCA-3') and R (5'-GTCACACCGAGGTACT-3') (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

The use of reverse transcriptase for efficient first- and second-strand cDNA synthesis from single- and double-stranded RNA templates.

Molecular characterization of eight distinct, difficult-to-clone RNA plant viruses was accomplished after the development of a reverse transcriptase-based first- and second-strand cDNA synthesis method. Double-stranded (ds) RNA templates isolated from strawberry and blackberry and several herbaceous hosts (mint, pea and tobacco) were cloned using this method. Templates, combined with random primers, were denatured with methyl mercuric hydroxide. Reverse transcriptase was added followed by the addition of RNase H. The resulting dsDNA was then digested with restriction endonucleases to produce shorter fragments that could be cloned efficiently into a T-tailed vector after adding an A-overhang using Taq polymerase. This procedure resulted in a high number of cloned fragments and allowed insert sizes up to three kilobase-pairs. Unlike traditional cDNA construction methods, there is no need for additional enzymes/steps for second-strand synthesis, PCR amplification or prior sequence information. Synthesis and cloning of cDNA derived from dsRNA templates is much more efficient than with previously described methods. This procedure also worked well for cloning gel-purified dsRNA and with single-stranded RNA templates.

Strawberry necrotic shock virus is a distinct virus and not a strain of Tobacco streak virus.

Fragaria (strawberry) and Rubus species (blackberry, wild blackberry, red raspberry and black raspberry) were thought to be infected with distinct isolates of Tobacco streak virus (TSV). Employing serology and nucleic acid hybridization it has been shown that these isolates form a cluster distinct from other strains of TSV. In this study we have cloned and sequenced the complete RNA 3 of an isolate of TSV from strawberry (Fragaria) as well as the coat protein (CP) gene of 14 additional isolates of TSV originating from Fragaria and Rubus species. Our data suggest that the isolates of TSV that infect Fragaria and Rubus belong to a distinct virus for which we propose the name Strawberry necrotic shock virus (SNSV). The RNA 3 of SNSV contains 2248 nucleotides, 43 more than the type isolate of TSV from white clover (TSV-WC), with a CP gene that is 669 nucleotides long, in contrast to the 714-7 nucleotides of the TSV CP sequences found in the database. The movement protein gene of SNSV is 897 nucleotides in length, 27 more than that of the TSV-WC isolate of TSV. The CP genes of the 15 Fragaria and Rubus isolates that we studied form two distinct phylogenetic clusters that share about 95% amino acid sequence identity, while they only share 60-65% amino acid sequence identity with TSV-WC.

First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease.

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAG- ATGTCCACTAATGATA 3') were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.