RESUMO
Background: In this study, we developed and validated machine learning (ML) models by combining radiomic features extracted from magnetic resonance imaging (MRI) with clinicopathological factors to assess pulmonary nodule classification for benign malignant diagnosis. Methods: A total of 333 consecutive patients with pulmonary nodules (233 in the training cohort and 100 in the validation cohort) were enrolled. A total of 2,824 radiomic features were extracted from the MRI images (CE T1w and T2w). Logistic regression (LR), Naïve Bayes (NB), support vector machine (SVM), random forest (RF), and extreme gradient boosting (XGBoost) classifiers were used to build the predictive models, and a radiomics score (Rad-score) was obtained for each patient after applying the best prediction model. Clinical factors and Rad-scores were used jointly to build a nomogram model based on multivariate logistic regression analysis, and the diagnostic performance of the five prediction models was evaluated using the area under the receiver operating characteristic curve (AUC). Results: A total of 161 women (48.35%) and 172 men (51.65%) with pulmonary nodules were enrolled. Six important features were selected from the 2,145 radiomic features extracted from CE T1w and T2w images. The XGBoost classifier model achieved the highest discrimination performance with AUCs of 0.901, 0.906, and 0.851 in the training, validation, and test cohorts, respectively. The nomogram model improved the performance with AUC values of 0.918, 0.912, and 0.877 in the training, validation, and test cohorts, respectively. Conclusion: MRI radiomic ML models demonstrated good nodule classification performance with XGBoost, which was superior to that of the other four models. The nomogram model achieved higher performance with the addition of clinical information.
RESUMO
TDO2 is a key enzyme in the kynurenine metabolic pathway, which is the most important pathway of tryptophan metabolism. It has been shown that miRNAs are involved in cell metastasis through interaction with target mRNAs. In this study, we found 645 miRNAs that could be immunoprecipitated with TDO2 through the RNA-immunoprecipitation experiment. miR-126-5p was selected as the research target, which was also confirmed by dual-luciferase reporter assay. Through qRT-PCR analysis, it was verified that the overexpression of miR-126-5p promoted the expression of TDO2, PI3K/AKT and WNT1. Meanwhile, it was verified that overexpression of miR-126-5p can promote intracellular tryptophan metabolism by HPLC. We also verified the effects of miR-126-5p on cell proliferation, migration, and invasion by cck-8, cell colony formation and trans-well assay in both HCCLM3 cells and HepG2 cells. In vivo experiments were also conducted to verify that miR-126-5p promoted tumor formation and growth via immunohistochemical detection of cell infiltration and proliferation to generate markers Ki-67, BAX, and VEGF. In conclusion, our results suggest that miR-126-5p is a biomarker and a potential new treatment target in the progression of HCC via promoting the expression of TDO2.
Assuntos
Carcinoma Hepatocelular/patologia , Neoplasias Hepáticas/patologia , MicroRNAs/genética , Triptofano Hidroxilase/genética , Animais , Carcinoma Hepatocelular/genética , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Hepáticas/genética , Camundongos Endogâmicos BALB C , MicroRNAs/metabolismo , Fosfatidilinositol 3-Quinases/genética , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/genética , Proteínas Proto-Oncogênicas c-akt/metabolismo , Triptofano/genética , Triptofano/metabolismo , Triptofano Hidroxilase/metabolismo , Ensaios Antitumorais Modelo de XenoenxertoRESUMO
Tryptophan metabolism plays a role in the occurrence and development of hepatocellular carcinoma cells. By degrading certain amino acids, tumor growth can be limited while maintaining the body's normal nutritional requirements. Tryptophan side-chain oxidase (TSO) enzyme can degrade tryptophan, and its inhibitory effect on hepatocellular carcinoma cells is worthy of further study. To investigate the degradation effect on tryptophan, TSO was isolated and purified from qq Pseudomonas. The reaction products were identified with high performance liquid chromatography (HPLC) and high-performance liquid chromatography tandem mass spectrometry (HPLC-MS). De novo sequencing provided the complete amino acid sequence of TSO. The results of CCK-8, colony formation, transwell, and qPCR confirmed that TSO had inhibitory effects on the proliferation and migration of HCCLM3 (human hepatocarcinoma cell line) and HepG2 cells. The results of flow cytometry confirmed its apoptotic activity. In animal experiments, we found that the tumor-suppressive effect was better in the oncotherapy group than the intraperitoneal injection group. The results of immunohistochemistry also suggested that TSO could inhibit proliferation and promote apoptosis. In conclusion, a specific enzyme that can degrade tryptophan and inhibit the growth of hepatoma cells was authenticated, and its basic information was obtained by extraction/purification and amino acid sequencing.
Assuntos
Antineoplásicos/farmacologia , Proteínas de Bactérias/farmacologia , Carcinoma Hepatocelular/tratamento farmacológico , Neoplasias Hepáticas/tratamento farmacológico , Oxigenases de Função Mista/farmacologia , Triptofano/metabolismo , Animais , Antineoplásicos/química , Antineoplásicos/isolamento & purificação , Apoptose/efeitos dos fármacos , Apoptose/genética , Proteínas de Bactérias/biossíntese , Proteínas de Bactérias/genética , Proteínas de Bactérias/isolamento & purificação , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/metabolismo , Carcinoma Hepatocelular/patologia , Linhagem Celular Tumoral , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Regulação Neoplásica da Expressão Gênica , Glicogênio Sintase Quinase 3 beta/genética , Glicogênio Sintase Quinase 3 beta/metabolismo , Células Hep G2 , Humanos , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/metabolismo , Neoplasias Hepáticas/patologia , Metaloproteinase 2 da Matriz/genética , Metaloproteinase 2 da Matriz/metabolismo , Camundongos , Camundongos Nus , Oxigenases de Função Mista/biossíntese , Oxigenases de Função Mista/genética , Oxigenases de Função Mista/isolamento & purificação , Modelos Moleculares , Antígeno Nuclear de Célula em Proliferação/genética , Antígeno Nuclear de Célula em Proliferação/metabolismo , Estrutura Secundária de Proteína , Pseudomonas/química , Pseudomonas/enzimologia , Pseudomonas/genética , Transdução de Sinais , Carga Tumoral/efeitos dos fármacos , Ensaios Antitumorais Modelo de Xenoenxerto , Proteína X Associada a bcl-2/genética , Proteína X Associada a bcl-2/metabolismoRESUMO
BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
Assuntos
Transfusão de Sangue , DNA Viral/sangue , Herpesvirus Humano 6/genética , Herpesvirus Humano 7/genética , Herpesvirus Humano 8/genética , Reação em Cadeia da Polimerase Multiplex/métodos , DNA Viral/genética , Feminino , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Reação em Cadeia da Polimerase Multiplex/normas , Estudos Prospectivos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/métodos , Carga Viral/normasRESUMO
BACKGROUND: Ischemia-reperfusion injury (IRI) is the major cause of primary graft dysfunction in organ transplantation. The mitogen-activated protein kinase/extracellular signal-regulated kinase (ERK) signaling pathway plays a crucial role in cell physiological and pathological processes including IRI. This study aims to investigate whether inhibition of ERK signaling with U0126 can prevent prolonged cold IRI in heart transplantation. METHODS: Rat cardiac cell line H9c2 cells were treated with U0126 before exposure to hypothermic hypoxia/reoxygenation (H/R) conditions. The effect of U0126 on H9c2 cells in response to H/R stress was determined by measuring cell death, reactive oxygen species production, mitochondrial membrane potential, and ERK signaling activation. Mouse syngeneic heterotopic heart transplantation was conducted, where a donor heart was preserved in the University of Wisconsin (UW) solution supplemented with U0126 for 24 hours at 4°C before transplantation. Heart graft function, histopathologic changes, apoptosis, and fibrosis were measured to assess IRI. RESULTS: Phosphorylated ERK was increased in both in vitro H/R-injured H9c2 cells and in vivo heart grafts with IRI. Pretreatment with U0126 inhibited ERK phosphorylation and prevented H9c2 cells from cell death, reactive oxygen species generation, and mitochondrial membrane potential loss in response to H/R. Preservation of donor hearts with U0126-supplemented solution improved graft function and reduced IRI by reductions in cell apoptosis/death, neutrophil infiltration, and fibrosis of the graft. CONCLUSIONS: Addition of U0126 to UW solution reduces ERK signal activation and attenuates prolonged cold IRI in a heart transplantation model. ERK inhibition with U0126 may be a useful strategy to minimize IRI in organ transplantation.
Assuntos
Butadienos/farmacologia , Isquemia Fria , MAP Quinases Reguladas por Sinal Extracelular/antagonistas & inibidores , Transplante de Coração/efeitos adversos , Traumatismo por Reperfusão Miocárdica/prevenção & controle , Miócitos Cardíacos/efeitos dos fármacos , Nitrilas/farmacologia , Soluções para Preservação de Órgãos/farmacologia , Preservação de Órgãos , Inibidores de Proteínas Quinases/farmacologia , Adenosina/farmacologia , Alopurinol/farmacologia , Animais , Apoptose/efeitos dos fármacos , Hipóxia Celular , Linhagem Celular , Isquemia Fria/efeitos adversos , MAP Quinases Reguladas por Sinal Extracelular/metabolismo , Fibrose , Glutationa/farmacologia , Insulina/farmacologia , Masculino , Potencial da Membrana Mitocondrial/efeitos dos fármacos , Camundongos Endogâmicos C57BL , Traumatismo por Reperfusão Miocárdica/enzimologia , Traumatismo por Reperfusão Miocárdica/patologia , Traumatismo por Reperfusão Miocárdica/fisiopatologia , Miócitos Cardíacos/enzimologia , Miócitos Cardíacos/patologia , Preservação de Órgãos/efeitos adversos , Estresse Oxidativo/efeitos dos fármacos , Fosforilação , Rafinose/farmacologia , Ratos , Transdução de Sinais , Função Ventricular Esquerda/efeitos dos fármacosRESUMO
Pancreatic cancer is one of the most aggressive tumors associated with a poor clinical prognosis, weakly effective therapeutic options. Therefore, there is a strong impetus to discover new therapeutic targets in pancreatic cancer. In the present study, we first demonstrated that TSPAN1 is upregulated in pancreatic cancer and that TSPAN1 depletion decreases pancreatic cancer cell proliferation in vitro and in vivo. TSPAN1 expression was correlated with poor overall survival of pancreatic cancer patients. Moreover, we demonstrated that TSPAN1 is a novel positive regulator of macroautophagy/autophagy characterized by decreased LC3-II and SQSTM1/p62 expressions, inhibited puncta formation of GFP-LC3 and autophagic vacuoles. We also demonstrated that tspan1 mutation impaired autophagy in the zebrafish model. Furthermore, we showed that TSPAN1 promoted autophagy maturation via direct binding to LC3 by two conserved LIR motifs. Mutations in the LIR motifs of TSPAN1 resulted in a loss of the ability to induce autophagy and promote pancreatic cancer proliferation. Second, we discovered two conservative TCF/LEF binding elements present in the promoter region of the TSPAN1 gene, which was further verified through luciferase activity and ChIP assays. Furthermore, TSPAN1 was upregulated by FAM83A through the canonical WNT-CTNNB1 signaling pathway. We further demonstrated that both TSPAN1 and FAM83A are both direct targets of MIR454 (microRNA 454). Additionally, we revealed the role of MIR454-FAM83A-TSPAN1 in the proliferation of pancreatic cancer cells in vitro and in vivo. Our findings suggest that components of the MIR454-FAM83A-TSPAN1 axis may be valuable prognosis markers or therapeutic targets for pancreatic cancer.Abbreviations: AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; APC: APC regulator of WNT signaling pathway; ATG: autophagy related; AXIN2: axin 2; BECN1: beclin 1; CCND1: cyclin D1; CSNK1A1/CK1α: casein kinase 1 alpha 1; CTNNB1/ß-catenin: catenin beta 1; DAPI: 4'6-diamino-2-phenylindole; EBSS: Earle's balanced salt solution; EdU: 5-ethynyl-20-deoxyuridine; FAM83A: family with sequence similarity 83 member A; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; GSK3B: glycogen synthase kinase 3 beta; IHC: immunohistochemical; LAMP1: lysosomal associated membrane protein 1; LIR: LC3-interacting region; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; MIR454: microRNA 454; miRNA: microRNA; MKI67: antigen identified by monoclonal antibody Ki 67; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; MYC: MYC proto-oncogene, bHLH transcription factor; OS: overall survival; PDAC: pancreatic ductal adenocarcinoma; RAB7A: RAB7A, member RAS oncogene family; shRNA: short hairpin RNA; SQSTM1: sequestosome 1; TBE: TCF/LEF binding element; TCGA: The Cancer Genome Atlas; TCF/LEF: transcription factor/lymphoid enhancer binding factor; TCF4: transcription factor 4; TSPAN1: tetraspanin 1; TUNEL: terminal deoxynucleotidyl transferase mediated dUTP nick end labeling; UTR: untranslated region; WT: wild type.
Assuntos
Autofagia , MicroRNAs , Proteínas de Neoplasias , Neoplasias Pancreáticas , Via de Sinalização Wnt , Animais , Humanos , MicroRNAs/genética , Proteínas de Neoplasias/genética , Neoplasias Pancreáticas/genética , Tetraspaninas/genética , Peixe-Zebra , beta Catenina/metabolismoRESUMO
Macroautophagy/autophagy plays key roles in development, oncogenesis, and cardiovascular and metabolic diseases. Autophagy-specific class III phosphatidylinositol 3-kinase complex I (PtdIns3K-C1) is essential for autophagosome formation. However, the regulation of this complex formation requires further investigation. Here, we discovered that STYK1 (serine/threonine/tyrosine kinase 1), a member of the receptor tyrosine kinases (RTKs) family, is a new upstream regulator of autophagy. We discovered that STYK1 facilitated autophagosome formation in human cells and zebrafish, which was characterized by elevated LC3-II and lowered SQSTM1/p62 levels and increased puncta formation by several marker proteins, such as ATG14, WIPI1, and ZFYVE1. Moreover, we observed that STYK1 directly binds to the PtdIns3K-C1 complex as a homodimer. The binding with this complex was promoted by Tyr191 phosphorylation, by means of which the kinase activity of STYK1 was elevated. We also demonstrated that STYK1 elevated the serine phosphorylation of BECN1, thereby decreasing the interaction between BECN1 and BCL2. Furthermore, we found that STYK1 preferentially facilitated the assembly of the PtdIns3K-C1 complex and was required for PtdIns3K-C1 complex kinase activity. Taken together, our findings provide new insights into autophagy induction and reveal evidence of novel crosstalk between the components of RTK signaling and autophagy. Abbreviations: AICAR: 5-aminoimidazole-4-carboxamide ribonucleotide; AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; ATG: autophagy related; ATP: adenosine triphosphate; BCL2: BCL2 apoptosis regulator; BECN1: beclin 1; Bre A: brefeldin A; Co-IP: co-immunoprecipitation; CRISPR: clustered regularly interspaced short palindromic repeats; DAPI: 4',6-diamidino-2-phenylindole; EBSS: Earle's balanced salt solution; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; MAPK8/JNK1: mitogen-activated protein kinase 8; mRFP: monomeric red fluorescent protein; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; PIK3C3: phosphatidylinositol 3-kinase catalytic subunit type 3; PIK3R4: phosphoinositide-3-kinase regulatory subunit 4; qRT-PCR: quantitative reverse transcription PCR; RACK1: receptor for activated C kinase 1; RUBCN: rubicon autophagy regulator; siRNA: small interfering RNA; SQSTM1: sequestosome 1; STYK1/NOK: serine/threonine/tyrosine kinase 1; TCGA: The Cancer Genome Atlas; Ub: ubiquitin; ULK1: unc-51 like autophagy activating kinase 1; UVRAG: UV radiation resistance associated; WIPI1: WD repeat domain, phosphoinositide interacting 1; ZFYVE1: zinc finger FYVE-type containing 1.
Assuntos
Autofagia , Fosfatidilinositol 3-Quinases/metabolismo , Receptores Proteína Tirosina Quinases/metabolismo , Proteína Sequestossoma-1/metabolismo , Adenilato Quinase/metabolismo , Animais , Autofagossomos/metabolismo , Proteínas Relacionadas à Autofagia/metabolismo , Sobrevivência Celular , Dimerização , Células HEK293 , Células HeLa , Células Hep G2 , Humanos , Células MCF-7 , Fosforilação , Domínios Proteicos , Transdução de Sinais , Serina-Treonina Quinases TOR/metabolismo , Tirosina/química , Peixe-ZebraRESUMO
Epstein-Barr virus (EBV) is a ubiquitous human γ-herpesvirus that infects over 90% of the global population. EBV is considered a contributory factor in a variety of malignancies including nasopharyngeal carcinoma, gastric carcinoma, Burkitt lymphoma, and Hodgkin's lymphoma. Notably, EBV was the first virus found to encode microRNAs (miRNAs). Increasing evidence indicates that EBV-encoded miRNAs contribute to the carcinogenesis and development of EBV-associated malignancies. EBV miRNAs have been shown to inhibit the expression of genes involved in cell proliferation, apoptosis, invasion, and immune signaling pathways. Therefore, EBV miRNAs perform a significant function in the complex host-virus interaction and EBV-driven carcinogenesis. However, the integrated mechanisms underlying the roles of EBV miRNAs in carcinogenesis remain to be further explored. In this review, we describe recent advances regarding the involvement of EBV miRNAs in the pathogenesis of EBV-associated malignancies and discuss their potential utility as cancer biomarkers. An in-depth investigation into the pro-carcinogenic role of EBV miRNAs will expand our knowledge of the biological processes associated with virus-driven tumors and contribute to the development of novel therapeutic strategies for the treatment of EBV-associated malignancies.
RESUMO
BACKGROUND: Breast cancer is a life-threatening disease in females and the leading cause of mortality among the female population, presenting huge challenges for prognosis and treatment. ITM2A is a member of the BRICHOS superfamily, which are thought to have a chaperone function. ITM2A has been identified to related to ovarian cancer progress recently. However, the biological role of ITM2A in breast cancer remains largely unclear. METHODS: Quantitative real-time polymerase chain reaction (qRT-PCR), western blotting assay and immunohistochemistry staining were used to analyzed the expression level of ITM2A. The patient overall survival versus ITM2A expression level was evaluated by Kaplan-Meier analysis. MTT assay, EdU incorporation assay and colony formation assay were used to evaluated the role of ITM2A on breast cancer cell proliferation. Autophagy was explored through autophagic flux detection using a confocal microscope and autophagic vacuoles investigation under a transmission electron microscopy (TEM). In vitro kinase assay was used to investigated the phosphorylation modification of ITM2A by HUNK. RESULTS: Our data showed that the expression of integral membrane protein 2A (ITM2A) was significantly down-regulated in human breast cancer tissues and cell lines. Kaplan-Meier analysis indicated that patients presenting with reduced ITM2A expression exhibited poor overall survival, and expression significantly correlated with age, progesterone receptor status, TNM classification and tumor stage. ITM2A overexpression significantly inhibited the proliferation of breast cancer cells. By studying several autophagic markers and events in human breast cancer SKBR-3 cells, we further demonstrated that ITM2A is a novel positive regulator of autophagy through an mTOR-dependent manner. Moreover, we found that ITM2A was phosphorylated at T35 by HUNK, a serine/threonine kinase significantly correlated with human breast cancer overall survival and HER2-induced mammary tumorigenesis. CONCLUSION: Our study provided evidence that ITM2A functions as a novel prognostic marker and represents a potential therapeutic target.
Assuntos
Apoptose , Neoplasias da Mama/metabolismo , Neoplasias da Mama/patologia , Proteínas de Membrana/metabolismo , Proliferação de Células , Células Cultivadas , Feminino , Humanos , Proteínas Serina-Treonina Quinases/metabolismo , Transdução de Sinais , Serina-Treonina Quinases TOR/metabolismoRESUMO
In the present study, we found the mRNA expression level of glycerol-3-phosphate dehydrogenase (GPD1) was significantly downregulated in human breast cancer patients. Patients with reduced GPD1 expression exhibited poorer overall metastatic relapse-free survival (p = 0.0013). Further Cox proportional hazard model analysis revealed that the reduced expression of GPD1 is an independent predictor of overall survival in oestrogen receptor-positive (p = 0.0027, HR = 0.91, 95% CI = 0.85-0.97, N = 3,917) and nodal-negative (p = 0.0013, HR = 0.87, 95% CI = 0.80-0.95, N = 2,456) breast cancer patients. We also demonstrated that GPD1 was a direct target of miR-370, which was significantly upregulated in human breast cancer. We further showed that exogenous expression of GPD1 in human MCF-7 and MDA-MB-231 breast cancer cells significantly inhibited cell proliferation, migration, and invasion. Our results, therefore, suggest a novel tumour suppressor function for GPD1 and contribute to the understanding of cancer metabolism.
RESUMO
Anti-microtubule drugs, such as paclitaxel (PTX), are extensively used for the treatment of numerous cancers. However, growing evidence has shown that PTX resistance, either intrinsic or acquired, frequently occurs in patients and results in the failure of treatment, contributing to the high cancer mortality rate. Therefore, it is necessary to identify the genes or pathways involved in anti-microtubule drug resistance for future successful treatment of cancers. Pygopus2 (Pygo2), which contains a Zn-coordinated plant homeodomain (PHD) finger domain, is critical for ß-catenin-dependent transcriptional switches in normal and malignant tissues and is over-expressed in various cancers, including human brain glioma. In this study, we report that over-expression of Pygo2 inhibited the efficacy of PTX and contributed to cell multidrug resistance in two different ways. First, over-expression of Pygo2 inhibited the PTX-induced phosphorylation of B-cell lymphoma 2 (Bcl-2), suppressing the proteolytic cleavage of procaspase-8/9 and further inhibiting the activation of caspase-3, which also inhibits the activation of the JNK/SAPK pathway, ultimately inhibiting cell apoptosis. Second, over-expression of Pygo2 facilitated the expression of P-glycoprotein, which acts as a drug efflux pump, by promoting the transcription of Multi-drug resistance 1 (MDR1) at the MDR1 promoter loci, resulting in acceleration of the efflux of PTX.
Assuntos
Antineoplásicos Fitogênicos/farmacologia , Neoplasias Encefálicas/genética , Regulação Neoplásica da Expressão Gênica , Glioma/genética , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo , Subfamília B de Transportador de Cassetes de Ligação de ATP/genética , Subfamília B de Transportador de Cassetes de Ligação de ATP/metabolismo , Membro 1 da Subfamília B de Cassetes de Ligação de ATP/metabolismo , Antineoplásicos Fitogênicos/uso terapêutico , Apoptose/efeitos dos fármacos , Neoplasias Encefálicas/tratamento farmacológico , Neoplasias Encefálicas/patologia , Caspase 3/metabolismo , Caspase 8/metabolismo , Caspase 9/metabolismo , Linhagem Celular Tumoral , Imunoprecipitação da Cromatina , Resistência a Múltiplos Medicamentos/genética , Resistencia a Medicamentos Antineoplásicos/genética , Glioma/tratamento farmacológico , Glioma/patologia , Humanos , Peptídeos e Proteínas de Sinalização Intracelular/genética , Sistema de Sinalização das MAP Quinases/genética , Paclitaxel/farmacologia , Paclitaxel/uso terapêutico , Fosforilação , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas c-bcl-2/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , beta Catenina/metabolismoRESUMO
D-dimer level in cancer patients is associated with risk of venous thromboembolism and deep venous thrombosis. Most cancer patients have "abnormal" D-dimer levels based on the current normal reference range. To investigate tumor-specific D-dimer reference range, we compared D-dimer levels for nine different tumour types with healthy controls by using simultaneous quantile regression and constructing a median, 5th percentile, and 95th percentile model of normal tumour D-dimer concentration. Associations with tumour primary site, stage, pathological type, and treatment were also explored. Additionally, 190 patients were tracked to reveal the relevance of initial D-dimer levels to cancer prognosis. D-dimer ranges (median, 5th, 95th) in various cancers (mg/L) were: liver 1.12, 0.27, 5.25; pancreatic 0.96, 0.23, 4.81; breast 0.44, 0.2, 2.17; gastric 0.65, 0.22, 5.03; colorectal 0.73, 0.22, 4.45; lung 0.7, 0.25, 4.0; gynaecological 0.61, 0.22, 3.98; oesophageal 0.23, 0.7, 3.45; and head and neck 0.22, 0.44, 2.19. All were significantly higher than that of healthy controls (0.18, 0.07, 0.57). D-dimer peaked 1-2 days postoperatively but had decreased to the normal range by 1 week. Additionally, cancer patients with high initial D-dimer were shown a tendency of poor prognosis in survival rate. In conclusion, D-dimer levels in cancer depend on patient age, tumour primary site, and tumour stage. Thrombosis prevention is necessary if D-dimer has not decreased to the tumor-specific baseline a week after surgery.
Assuntos
Produtos de Degradação da Fibrina e do Fibrinogênio/metabolismo , Neoplasias/diagnóstico , Tromboembolia Venosa/diagnóstico , Trombose Venosa/diagnóstico , Adulto , Fatores Etários , Idoso , Anticoagulantes/uso terapêutico , Estudos Transversais , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Estadiamento de Neoplasias , Neoplasias/complicações , Neoplasias/tratamento farmacológico , Neoplasias/mortalidade , Especificidade de Órgãos , Prognóstico , Valores de Referência , Taxa de Sobrevida , Fatores de Tempo , Tromboembolia Venosa/complicações , Tromboembolia Venosa/tratamento farmacológico , Tromboembolia Venosa/mortalidade , Trombose Venosa/complicações , Trombose Venosa/tratamento farmacológico , Trombose Venosa/mortalidadeRESUMO
Breast cancer is a heterogeneous disease associated with diverse clinical, biological and molecular features, presenting huge challenges for prognosis and treatment. Here we found that perilipin-1 (PLIN1) mRNA expression is significantly downregulated in human breast cancer. Kaplan-Meier analysis indicated that patients presenting with reduced PLIN1 expression exhibited poorer overall metastatic relapse-free survival (p = 0.03). Further Cox proportional hazard models analysis revealed that the reduced expression of PLIN1 is an independent predictor of overall survival in estrogen receptor positive (p < 0.0001, HR = 0.87, 95% CI = 0.81-0.92, N = 3,600) and luminal A-subtype (p = 0.02, HR = 0.88, 95% CI = 0.78-0.98, N = 1,469) breast cancer patients. We also demonstrated that the exogenous expression of PLIN1 in human breast cancer MCF-7 and MDA-MB-231 cells significantly inhibits cell proliferation, migration, invasion and in vivo tumorigenesis in mice. Together, these data provide novel insights into a prognostic significance of PLIN1 in human breast cancer and reveal a potentially new gene therapy target for breast cancer.
Assuntos
Neoplasias da Mama/mortalidade , Perilipina-1/análise , Animais , Biomarcadores Tumorais/análise , Neoplasias da Mama/química , Neoplasias da Mama/patologia , Linhagem Celular Tumoral , Movimento Celular , Proliferação de Células , Feminino , Genes p53 , Humanos , Camundongos , Mutação , Invasividade Neoplásica , Prognóstico , Modelos de Riscos Proporcionais , Receptores de Estrogênio/análiseRESUMO
Pygo2 has been discovered as an important Wnt signaling component contributing to the activation of Wnt-target gene transcription. In the present study, we discovered that Pygo2 mRNA and protein levels were up-regulated in the majority of (152/209) human brain glioma tissues and five glioma cell lines, and significantly correlated with the age, the WHO tumor classification and poor patient survival. The histone methyltransferase complex components (WDR5, Ash2, and menin, but not CXCC1 or NCOA6) were down-regulated at the promoter loci of Wnt target genes after Pygo2 knockdown, and this was accompanied by the down-regulation of Wnt/ß-catenin pathway activity. Further, we demonstrated that the involvement of Pygo2 in the activation of the Wnt pathway in human glioma progression is through up-regulation of the H3K4me3 (but not H3K4me2) by promoting the recruitment of the histone methyltransferase MLL1/MLL2 complex to Wnt target gene promoters. Thus, our study provided evidence that Pygo2 functions as a novel prognostic marker and represents a potential therapeutic target.
Assuntos
Neoplasias Encefálicas/genética , Proteínas de Ligação a DNA/genética , Regulação Neoplásica da Expressão Gênica , Glioma/genética , Histona-Lisina N-Metiltransferase/genética , Histonas/genética , Peptídeos e Proteínas de Sinalização Intracelular/genética , Proteína de Leucina Linfoide-Mieloide/genética , Proteínas de Neoplasias/genética , Adulto , Neoplasias Encefálicas/diagnóstico , Neoplasias Encefálicas/mortalidade , Neoplasias Encefálicas/patologia , Linhagem Celular Tumoral , Proteínas de Ligação a DNA/metabolismo , Progressão da Doença , Feminino , Glioma/diagnóstico , Glioma/mortalidade , Glioma/patologia , Histona-Lisina N-Metiltransferase/metabolismo , Histonas/metabolismo , Humanos , Peptídeos e Proteínas de Sinalização Intracelular/antagonistas & inibidores , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo , Masculino , Pessoa de Meia-Idade , Proteína de Leucina Linfoide-Mieloide/metabolismo , Proteínas de Neoplasias/metabolismo , Proteínas Nucleares/genética , Proteínas Nucleares/metabolismo , Prognóstico , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas/genética , Proteínas Proto-Oncogênicas/metabolismo , RNA Interferente Pequeno/genética , RNA Interferente Pequeno/metabolismo , Análise de Sobrevida , Fatores de Transcrição/genética , Fatores de Transcrição/metabolismo , Ativação Transcricional , Proteínas Wnt/genética , Proteínas Wnt/metabolismo , Via de Sinalização Wnt , beta Catenina/genética , beta Catenina/metabolismoRESUMO
Upconversion (UC) luminescent lanthanide nanoparticles (LNPs) are expected to play an important role in imaging and photodynamic therapy (PDT) in vitro and in vivo. However, with the absorption of UC emissions by photosensitizers (PSs) to generate singlet oxygen ((1)O2) for PDT, the imaging signals from LNPs are significantly weakened. It is important to activate another imaging route to track the location of the LNPs during PDT process. In this work, Nd(3+)-sensitized LNPs with dual-band visible and near-infrared (NIR) emissions under single 808 nm excitation were reported to address this issue. The UC emissions in green could trigger covalently linked rose bengal (RB) molecules for efficient PDT, and NIR emissions deriving from Yb(3+) and magnetic resonance imaging (MRI) were used for imaging simultaneously. Notably, the designed therapeutic platform could further effectively avoid the overheating effect induced by the laser irradiation, due to the minimized absorption of biological media at around 808 nm. TdT-mediated dUTP nick end labeling (TUNEL) assay showed serious cell apoptosis in the tumor after PDT for 2 weeks, leading to an effective tumor inhibition rate of 67%. Benefit from the PDT, the tumor growth-induced liver and spleen burdens were largely attenuated, and the liver injury was also alleviated. More importantly, pulmonary and hepatic tumor metastases were significantly reduced after PDT. The Nd(3+)-sensitized LNPs provide a multifunctional nanoplatform for NIR light-assisted PDT with minimized heating effect and an effective inhibition of tumor growth and metastasis.
Assuntos
Elementos da Série dos Lantanídeos/química , Luminescência , Nanopartículas Metálicas/química , Neoplasias Experimentais/diagnóstico por imagem , Fotoquimioterapia/métodos , Animais , Apoptose , Células HeLa , Humanos , Imageamento por Ressonância Magnética , Camundongos , Camundongos Endogâmicos BALB C , Metástase Neoplásica , Neoplasias Experimentais/tratamento farmacológico , Neoplasias Experimentais/patologia , Fármacos Fotossensibilizantes/química , Rosa Bengala/químicaRESUMO
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus that is linked to the development of various malignancies. There is an urgent need for effective vaccines against EBV. EBV envelope glycoprotein gp350 is an attractive candidate for a prophylactic vaccine. This study was undertaken to produce the truncated (codons 1-443) gp350 protein (gp350(1-443)) in Pichia pastoris and evaluate its immunogenicity. The gp350(1-443) protein was expressed as a secretory protein with an N-terminal His-tag in P. pastoris and purified through Ni-NTA chromatography. Immunization with the recombinant gp350(1-443) could elicit high levels of gp350(1-443)-specific antibodies in mice. Moreover, gp350(1-443)-immunized mice developed strong lymphoproliferative and Th1/Th2 cytokine responses. Furthermore, the recombinant gp350(1-443) could stimulate CD4(+) and CD8(+) T cell responses in vaccinated mice. Collectively, these findings demonstrated that the yeast-expressed gp350(1-443) retained strong immunogenicity. This study will provide a useful source for developing EBV subunit vaccine candidates.
Assuntos
Infecções por Vírus Epstein-Barr/virologia , Herpesvirus Humano 4/imunologia , Proteínas do Envelope Viral/genética , Proteínas do Envelope Viral/imunologia , Vacinas Virais/imunologia , Animais , Infecções por Vírus Epstein-Barr/imunologia , Feminino , Herpesvirus Humano 4/genética , Humanos , Imunização , Camundongos , Camundongos Endogâmicos BALB C , Células Th1/imunologia , Células Th2/imunologia , Vacinas de Subunidades Antigênicas/administração & dosagem , Vacinas de Subunidades Antigênicas/genética , Vacinas de Subunidades Antigênicas/imunologia , Proteínas do Envelope Viral/administração & dosagem , Vacinas Virais/administração & dosagem , Vacinas Virais/genéticaRESUMO
Epstein-Barr virus (EBV)-associated disease exhibits distinct gene expression patterns characterized by the transcription of EBV nuclear antigen (EBNA) 1, EBNA2, latent membrane protein (LMP) 1, LMP2A, and BZLF1 (Zebra). A series of visual reverse transcript loop-mediated isothermal amplification (RT-LAMP) assays were performed to examine the expression of EBNA1, EBNA2, LMP1, LMP2A and BZLF1. The sensitivity of RT-LAMP for these transcripts was approximately equivalent to real-time RT-PCR (RT-qPCR), which was developed to quantify relative levels of EBV transcripts, and 10 to 100-fold more sensitive than conventional RT-PCR. Cross-reactions to other viruses were not observed upon examination of cell lines infected with herpes simplex viruses-1 and -2 (HSV-1 and -2), varicella zoster virus (VZV), human cytomegalovirus (HCMV) or Kaposi's sarcoma-associated herpesvirus. When applied to 146 specimens, RT-LAMP exhibited high clinical sensitivity and specificity, with an excellent agreement (κ > 0.92) compared to RT-qPCR. These assays are convenient for rapid early diagnosis and for surveillance of EBV-infected individuals by evaluating the EBV transcriptional profile, because the results can be visualized with the naked eye. These assays may be employed in further investigations because they can aid the design of improved therapeutic regimens and can be used specifically in resource-poor settings.
Assuntos
Herpesvirus Humano 4/genética , Técnicas de Amplificação de Ácido Nucleico , Proteínas Virais/genética , Latência Viral/genética , Linhagem Celular , Infecções por Vírus Epstein-Barr/virologia , Corantes Fluorescentes/química , Expressão Gênica , Herpesviridae/genética , Herpesvirus Humano 4/fisiologia , Humanos , Leucócitos Mononucleares/metabolismo , RNA Viral/análise , Reação em Cadeia da Polimerase em Tempo Real , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Proteínas Virais/metabolismoRESUMO
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus associated with the development of both lymphoid and epithelial tumors. EBNA1 is the only viral protein expressed in all EBV-associated malignancies and plays important roles in EBV latency. Thus, EBNA1 is thought to be a promising antigen for immunotherapy of all EBV-associated malignancies. This study was undertaken to produce recombinant EBNA1 protein in Pichia pastoris and evaluate its immunogenicity. The truncated EBNA1 (E1ΔGA, codons 390-641) was expressed as a secretory protein with an N-terminal histidine tag in the methylotrophic yeast P. pastoris and purified by Ni-NTA affinity chromatography. The purified proteins were then used as antigens to immunize BALB/c mice for production of polyclonal antibodies. Western blot analysis showed that the polyclonal antibodies specifically recognized the EBNA1 protein in B95-8 cell lysates. The recombinant E1ΔGA also induced strong lymphoproliferative and Th1 cytokine responses in mice. Furthermore, mice immunized with E1ΔGA developed CD4+ and CD8+ T cell responses. These findings showed that the yeast-expressed E1ΔGA retained good immunogenicity and might be a promising vaccine candidate against EBV-associated malignancies.
Assuntos
Antígenos Nucleares do Vírus Epstein-Barr/imunologia , Antígenos Nucleares do Vírus Epstein-Barr/isolamento & purificação , Expressão Gênica , Pichia/genética , Animais , Anticorpos Antivirais/imunologia , Citocinas/imunologia , Infecções por Vírus Epstein-Barr/imunologia , Infecções por Vírus Epstein-Barr/virologia , Antígenos Nucleares do Vírus Epstein-Barr/genética , Feminino , Herpesvirus Humano 4/genética , Herpesvirus Humano 4/imunologia , Humanos , Imunização , Camundongos , Camundongos Endogâmicos BALB C , Pichia/metabolismo , Proteínas Recombinantes/genética , Proteínas Recombinantes/imunologia , Proteínas Recombinantes/isolamento & purificação , Células Th1/imunologiaRESUMO
Allergic inflammation and severe allergic reactions (anaphylaxis) are important in allergen induced diseases. Bacterial products such as lipopolysaccharide (LPS) are ubiquitous and can facilitate allergen induced Th2 immune responses. Phosphatase SHP-1 is critical in regulating immunological homeostasis and in allergen induced Th2 immune responses in the lung. However, the mechanisms underlying the initiation of allergic inflammation and allergen induced anaphylaxis are still not completely elucidated and it is unclear whether SHP-1 plays any role in LPS-induced airway inflammation and in allergen-induced anaphylaxis. In this study we tested the hypothesis that phosphatase SHP-1 plays an important role in allergic inflammation and anaphylaxis and determined whether its effects are through regulation of mast cell functions. SHP-1 deficient (mev/+ and mev/mev) and mast cell deficient (Kit(W-sh)) mice were examined in their responses to LPS airway stimulation and to ovalbumin (OVA) allergen induced systemic anaphylaxis. Compared to wild type mice, mev/+ mice had significantly enhanced LPS induced airway inflammation and OVA induced anaphylactic responses, including hypothermia and clinical symptoms. These changes were mast cell dependent as Kit(W-sh) mice had reduced responses whereas adoptive transfer of mast cells restored the responses. However, T and B cells were not involved and macrophages did not play a significant role in LPS induced airway inflammation. Interestingly, basophil differentiation from SHP-1 deficient bone marrow cells was significantly reduced. These findings provided evidence that through regulation of mast cell functions SHP-1 plays a critical role as a negative regulator in allergic inflammation and in allergen induced anaphylaxis. In addition, SHP-1 seems to be required for normal basophil development.
Assuntos
Anafilaxia/imunologia , Pulmão/imunologia , Mastócitos/imunologia , Proteína Tirosina Fosfatase não Receptora Tipo 6/imunologia , Hipersensibilidade Respiratória/imunologia , Transferência Adotiva , Alérgenos/imunologia , Anafilaxia/metabolismo , Anafilaxia/patologia , Animais , Basófilos/efeitos dos fármacos , Basófilos/imunologia , Basófilos/metabolismo , Diferenciação Celular/efeitos dos fármacos , Células Cultivadas , Citocinas/biossíntese , Citocinas/imunologia , Expressão Gênica/efeitos dos fármacos , Inflamação , Injeções Intravenosas , Lipopolissacarídeos/imunologia , Lipopolissacarídeos/farmacologia , Pulmão/efeitos dos fármacos , Pulmão/metabolismo , Mastócitos/efeitos dos fármacos , Mastócitos/metabolismo , Mastócitos/transplante , Camundongos , Camundongos Knockout , Ovalbumina/imunologia , Ovalbumina/farmacologia , Proteína Tirosina Fosfatase não Receptora Tipo 6/genética , Proteína Tirosina Fosfatase não Receptora Tipo 6/metabolismo , Hipersensibilidade Respiratória/metabolismo , Hipersensibilidade Respiratória/patologia , Transdução de Sinais/efeitos dos fármacos , Células Th2/imunologiaRESUMO
Human enterovirus 71 (EV71) is one of the major causative agents of hand, foot and mouth disease and is also associated with serious neurological diseases in children. Currently, there are no effective antiviral drugs or vaccines against EV71 infection. VP1, one of the major immunogenic capsid proteins of EV71, is widely considered to be the candidate antigen for an EV71 vaccine. In this study, VP1 of EV71 was expressed as a secretory protein with an N-terminal histidine tag in the methylotrophic yeast Pichia pastoris, and purified by Ni-NTA affinity chromatography. Immunogenicity and vaccine efficacy of the recombinant VP1 were assessed in mouse models. The results showed that the recombinant VP1 could efficiently induce anti-VP1 antibodies in BALB/c mice, which were able to neutralize EV71 viruses in an in vitro neutralization assay. Passive protection of neonatal mice further confirmed the prophylactic efficacy of the antisera from VP1 vaccinated mice. Furthermore, VP1 vaccination induced strong lymphoproliferative and Th1 cytokine responses. Taken together, our study demonstrated that the yeast-expressed VP1 protein retained good immunogenicity and was a potent EV71 vaccine candidate.