Synthesis, Anti-TMV Activities, and Action Mechanisms of a Novel Cytidine Peptide Compound.

Cytidine has a broad range of applications in the pharmaceutical field as an intermediate of antitumor or antiviral agent. Here, a series of new cytidine peptide compounds were synthesized using cytidine and Boc group-protected amino acids and analyzed for their antiviral activities against tobacco mosaic virus (TMV). Among these compounds, the structure of an effective antiviral cytidine peptide SN11 was characterized by 1H NMR, 13C NMR, and high-resolution mass spectrometer. The compound SN11 has a molecular formula of C15H22N6O8 and is named 2-amino-N-(2- ((1- (3,4-dihydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl) -2-oxo-1,2-dihydropyrimidin-4-yl) amino) -2-oxyethyl) amino). The protection, inactivation, and curation activities of SN11 at a concentration of 500 µg/mL against TMV in Nicotiana glutinosa were 82.6%, 84.2%, and 72.8%, respectively. SN11 also effectively suppressed the systemic transportation of a recombinant TMV carrying GFP reporter gene (p35S-30B:GFP) in Nicotiana benthamiana by reducing viral accumulation to 71.3% in the upper uninoculated leaves and inhibited the systemic infection of TMV in Nicotiana tabacum plants. Furthermore, the results of RNA-seq showed that compound SN11 induced differential expression of genes involved in the biogenesis and function of ribosome, plant hormone signal transduction, plant pathogen interaction, and chromatin. These results validate the antiviral mechanisms of the cytidine peptide compound and provide a theoretical basis for their potential application in the management of plant virus diseases.

First Report of Rhizoctonia solani AG1-IB Causing Tobacco Target Spot in China.

Tobacco target spot, caused by Rhizoctonia solani Kühn, induces shot-hole lesions on leaves that that significantly reduce yield and quality of tobacco. In July 2022, samples (n=5) with target spot were collected from three tobacco fields, one each in Puer (22.63°N, 100.72°E, cv. Yunyan87) and Mengzi (23.26°N, 103.36°E, cv. Yunyan87) of Yunnan province and one in Dandong (40.63°N, 124.18°E, cv. Liaoyan17) of Liaoning province, China; disease incidence in these fields was approximately 30%~40%. Initial symptoms (2- to 3-mm-diameter lesions) appeared on the middle to lower leaves, then expanded to 2 to 3 cm in diameter and developed the shot-hole appearance. Pieces of tissue (5×5 mm) were cut from the edge of lesions, surface sterilized, rinsed in sterile water, then placed on the surface of water agar (WA) and incubated at 25℃ for 2 days in the dark. Single hyphal tips were taken from fungal isolates identified as R. solani based on the morphological traits (Tsror 2010), then transferred onto potato dextrose agar (PDA) and cultured for 3 d as described above. A total of 15 pure cultures were obtained. With the exception of YN-3 (isolated from Puer), YN-62 (isolated from Mengzi) and LN-95(isolated from Dandong) strains, which exhibited hyphal fusion reaction with AG1-IB standard strain, all the other strains demonstrated hyphal fusion with AG-3 standard strain (Ogoshi 1987). Genomic DNA of these three strains were extracted by the CTAB method and ITS regions of rDNA were sequenced (White et al. 1990). The sequences were deposited in GenBank with accession No. OR770079, OR770080 and OR770082. All the three rDNA-ITS sequences exhibited 99.85% similar to AG1-IB found in GenBank, and a phylogenetic tree using a neighbor-joining method grouped the three strains within the R. solani AG-1 IB clade. Therefore, based on the hyphal fusion reaction and molecular methods, these isolates were identified as R. solani AG1-IB. To determine pathogenicity of the isolates, the healthy leaves of tobacco plants (cv. Yunyan 87) were used. Five-mm-diameter mycelial plugs of the strain on PDA were inoculated on leaves that had been previously wounded with a sterile needle, and cotton balls moistened with sterile water were used for moisturizing the inoculation sites. Ten leaves were inoculated for each strain and leaves inoculated with PDA plugs were as control. The experiment was conducted twice. All plants were incubated for 2 d at 15℃ to 25℃ and 90% relative humidity with a 12 h photoperiod/day. Irregularly shaped lesions appeared on the leaves around each of the inoculated sites, but not on control leaves. The pathogens were reisolated and confirmed be R. solani AG1-IB by hyphal fusion and molecular identification tests as previously described, thereby fulfilling Koch's postulates. It has been reported that AG-3, AG-2 (Mercado Cardenas et al. 2012), AG-5 (Wang et al. 2023) and AG-6 (Sun et al. 2022) of R. solani could cause tobacco target spot, but AG-3 is considered the main causal agent (Marleny Gonzalez et al. 2011). To our knowledge, this is the first report of AG1-IB causing tobacco target spot in China and worldwide. The AG1-IB strain has a wide host range including cabbage, mint, lettuce, beans, and rice (Gonzalez et al. 2006). The discovery poses a new challenge for the prevention and control of tobacco target spot, especially when contemplating disease management strategies such as crop rotation and fungicide treatments.

Unveiling novel anti-viral mechanisms of ε-poly-l-lysine on tobacco mosaic virus-infected Nicotiana tabacum through microRNA and transcriptome sequencing.

MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.

Bioinformatic Identification of Signaling Pathways and Hub Genes in Vascular Dementia.

BACKGROUND: Vascular dementia (VaD) is a prevalent neurodegenerative disease characterized by cognitive impairment due to cerebrovascular factors, affecting a significant portion of the aging population and highlighting the critical need to understand specific targets and mechanisms for effective prevention and treatment strategies. We aimed to identify pathways and crucial genes involved in the progression of VaD through bioinformatics analysis and subsequently validate these findings. METHODS: We conducted differential expression analysis, Weighted Gene Co-expression Network Analysis (WGCNA), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, and Protein-Protein Interaction (PPI) analysis. We utilized pheochromocytoma 12 (PC12) cells to create an in vitro oxygen-glucose deprivation (OGD) model. We investigated the impact of overexpression and interference of adrenoceptor alpha 1D (ADRA1D) on OGD PC12 cells using TdT-mediated dUTP nick-end labeling (TUNEL), reverse transcription-quantitative polymerase chain reaction (RT-qPCR), western blot (WB), and Fluo-3-pentaacetoxymethyl ester (Fluo-3 AM) analysis. RESULTS: We found 187 differentially expressed genes (DEGs) in the red module that were strongly associated with VaD and were primarily enriched in vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction, mitogen-activated protein kinase (MAPK) signaling pathway, and cell adhesion. Among these pathways, we identified ADRA1D as a gene shared by vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction. The TUNEL assay revealed a significant decrease in PC12 cell apoptosis with ADRA1D overexpression (p < 0.01) and a significant increase in apoptosis upon silencing ADRA1D (p < 0.01). RT-qPCR and WB analysis revealed elevated ADRA1D expression (p < 0.001) and decreased phospholipase C beta (PLCß) and inositol 1,4,5-trisphosphate receptor (IP3R) expression (p < 0.05) with ADRA1D overexpression. Moreover, the Fluo-3 AM assessment indicated significantly lower intracellular Ca2+ levels with ADRA1D overexpression (p < 0.001). Conversely, interference with ADRA1D yielded opposite results. CONCLUSION: Our study provides a new perspective on the pathogenic mechanisms of VaD and potential avenues for therapeutic intervention. The results highlight the role of ADRA1D in modulating cellular responses to OGD and VaD, suggesting its potential as a target for VaD treatment.

First Report of Tomato Yellow Mottle-Associated Virus Infecting Tobacco in China.

Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.

Transcriptome analysis and functional verification reveal the roles of copper in resistance to potato virus Y infection in tobacco.

Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.

Molecular characterization and pathogenicity of a novel monopartite geminivirus infecting tobacco in China.

The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.

Antiviral Mechanisms of Anisomycin Produced by Streptomyces albulus SN40 on Potato Virus Y.

Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.

RNA interference-based exogenous double-stranded RNAs confer resistance to Rhizoctonia solani AG-3 on Nicotiana tabacum.

BACKGROUND: Rhizoctonia solani Kühn is a pathogenic fungus causing tobacco target spot disease, and leads to great losses worldwide. At present, resistant varieties and effective control strategy on tobacco target spot disease are very limited. Host-induced gene silencing (HIGS) as well as the exogenous dsRNA can be used to suppress disease progression, and reveal the function of crucial genes involved in the growth and pathogenesis of the fungus. RESULTS: The silencing of endoPGs or RPMK1 in host plants by TRV-based HIGS resulted in a significant reduction in disease development in Nicotiana benthamiana. In vitro analysis validated that red fluorescence signals were consistently observed in the hyphae treated with Cy3-fluorescein-labeled dsRNA at 12, 24, 48 and 72 h postinoculation (hpi). Additionally, application of dsRNA-endoPGs, dsRNA-RPMK1 and dsRNA-PGMK (fusion of partial endoPGs and RPMK1 sequences) effectively inhibited the hyphal growth of R. solani YC-9 in vitro and suppressed disease progression in the leaves, and quantitative real-time PCR confirmed that the application of dsRNAs significantly reduced the expression levels of endoPGs and RPMK1. CONCLUSION: These results provide theoretical basis and new direction for RNAi approaches on the prevention and control of disease caused by R. solani. © 2024 Society of Chemical Industry.

Electroacupuncture pretreatment alleviates spasticity after stroke in rats by inducing the NF-κB/NLRP3 signaling pathway and the gut-brain axis.

OBJECTIVE: Spasticity is one of the most prevalent ischemic stroke sequelae and the leading cause of disability after stroke. Although electroacupuncture pretreatment has been shown to be effective in the treatment of ischemic stroke, its therapeutic effect and mechanism on post-stroke spasm remain unknown. The purpose of this study was to look into the potential mechanism of electroacupuncture pretreatment in inducing the NF-κB/NLRP3 signaling pathway and the gut-brain axis in the therapy of spasm after stroke. METHODS: After electroacupuncture treatment at Baihui (DU20) and Qubin (G87), the rat model of middle cerebral artery occlusion (MCAO) was first established. HE, Nissl, and TUNEL staining were used to detect pathological alterations in the rat brain. The relative levels of IL-4, IL-6, TNF-α, and TMAO were determined by ELISA. qRT-PCR and Western blot were used to evaluate the mRNA and protein levels of NF-κB p65, NLRP3, caspase3 and caspase9. Gas chromatography-mass spectrometry (GC-MS) was used to determine the levels of short-chain fatty acids (SCFAs) in rat gut. RESULTS: Hippocampal cells from rats with spasticity following stroke in the MCAO group were chaotic and loosely distributed with an unclear border, a blurred nucleolus, and vanished cytoplasm when compared to those from the sham operation group. Furthermore, the number of surviving neurons decreased while the number of apoptotic cells increased. In the I/R group, relative levels of IL-6, TNF-α, and TMAO increased considerably, while NF-κB p65, NLRP3, caspase3, and caspase9 were dramatically downregulated. The intestinal contents of n-propyl acetate and propyl butyrate were lowered in rats with spasticity following stroke. Electroacupuncture treatments miraculously remedied all of the foregoing pathogenic alterations. CONCLUSION: Pretreatment with electroacupuncture relieves spasticity after stroke by decreasing the inflammatory response, suppressing the NF-κB/NLRP3 signaling pathway, and modulating the gut-brain axis by increasing n-propyl acetate and propyl butyrate levels in the bowel. Our findings establish a new molecular mechanism and theoretical foundation for electroacupuncture therapy of ischemic stroke.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Specific detection of Phytophthora parasitica by recombinase polymerase amplification (RPA) assays based on a unique multi-copy genomic sequence.

Phytophthora parasitica is a highly destructive oomycete plant pathogen that is capable of infecting a wide range of hosts including many agricultural cash crops, fruit trees, and ornamental garden plants. One of the most important diseases caused by P. parasitica worldwide is black shank of tobacco. Rapid, sensitive, and specific pathogen detection is crucial for early rapid diagnosis which can facilitate effective disease management. In this study, we used a genomics approach to identify repeated sequences in the genome of P. parasitica by genome sequence alignment, and identified a 203 bp P. parasitica-specific sequence, PpM34, that is present in 31-60 copies in the genome. The P. parasitica genome-specificity of PpM34 was supported by PCR amplification of 24 genetically diverse strains of P. parasitica, 32 strains representing twelve other Phytophthora species, one Pythium specie, six fungal species and three bacterial species, all of which are plant pathogens. Our PCR and real-time PCR assays showed that the PpM34 sequence was highly sensitive in specifically detecting P. parasitica. Finally, we developed a PpM34-based high-efficiency Recombinase Polymerase Amplification (RPA) assay, which allowed us to specifically detect as little as 1 pg of P. parasitica total DNA from both pure cultures and infected Nicotiana benthamiana at 39°C using a fluorometric thermal cycler. The sensitivity, specificity, convenience and rapidity of this assay represents a major improvement for early diagnosis of P. parasitica infection.

Development and validation of a machine learning model of radiation-induced hypothyroidism with clinical and dose-volume features.

BACKGROUND AND PURPOSE: Radiation-induced hypothyroidism (RIHT) is a common but underestimated late effect in head and neck cancers. However, no consensus exists regarding risk prediction or dose constraints in RIHT. We aimed to develop a machine learning model for the accurate risk prediction of RIHT based on clinical and dose-volume features and to evaluate its performance internally and externally. MATERIALS AND METHODS: We retrospectively searched two institutions for patients aged >20 years treated with definitive radiotherapy for nasopharyngeal or oropharyngeal cancer, and extracted their clinical information and dose-volume features. One was designated the developmental cohort, the other as the external validation cohort. We compared the performances of machine learning models with those of published normal tissue complication probability (NTCP) models. RESULTS: The developmental and external validation cohorts consisted of 378 and 49 patients, respectively. The estimated cumulative incidence rates of grade ≥1 hypothyroidism were 53.5% and 61.3% in the developmental and external validation cohorts, respectively. Machine learning models outperformed traditional NTCP models by having lower Brier scores at every time point and a lower integrated Brier score, while demonstrating a comparable calibration index and mean area under the curve. Even simplified machine learning models using only thyroid features performed better than did traditional NTCP algorithms. The machine learning models showed consistent performance between folds. The performance in a previously unseen external validation cohort was comparable to that of the cross-validation. CONCLUSIONS: Our model outperformed traditional NTCP models, with additional capabilities of predicting the RIHT risk at individual time points. A simplified model using only thyroid dose-volume features still outperforms traditional NTCP models and can be incorporated into future treatment planning systems for biological optimization.

Transcriptome sequencing and functional verification revealed the roles of exogenous magnesium in tobacco anti-PVY infection.

Potato virus Y (PVY) infection causes necrosis and curling of leaves, which seriously affect the yield and quality of Solanaceous crops. The roles of nutrient elements in the regulation of plant resistance to virus infection has been widely reported, while the mechanisms are poorly studied. Previous studies in our laboratory have demonstrated that foliar spraying of MgSO4 could induce Nicotiana tabacum resistance to PVY by increasing the activity of defense-related enzymes. Consistent with the results, we found that exogenous magnesium (Mg) had a certain effect on N. tabacum anti-PVY infection. Meanwhile, Illumina RNA sequencing revealed that Mg induced resistance to PVY infection was mainly by regulating carbohydrate metabolism and transportation, nitrogen metabolism, Ca2+ signal transduction and oxidative phosphorylation. Moreover, we used virus-induced gene silencing assays to verify the function of homologs of five N. tabacum genes involved in above pathways in N. benthamiana. The results showed that NbTPS and NbGBE were conducive to PVY infection, while NbPPases and NbNR were related to resistance to PVY infection. These results suggested a novel strategy for resistance to PVY infection and provided a theoretical basis for virus-resistance breeding.

Combination treatment of cordycepin and radiation induces MA-10 mouse Leydig tumor cell death via ROS accumulation and DNA damage.

Leydig cell tumor is the most frequent non-germ cell tumors of testis. The biggest challenge of using radiotherapy to treat testicular cancer is in effectively killing cancer cells and maintaining reproductive function after treatment. Our recently published article showed that cordycepin could enhance radiosensitivity to induce mouse Leydig tumor cell apoptosis by inducing cell cycle arrest, caspase pathway and endoplasmic reticulum (ER) stress. In the present study, the potency and mechanism of a previous combination treatment protocol on reactive oxygen species (ROS) induction and DNA damage were further investigated. Our results reveal that 25 µM cordycepin plus 4 Gy radiation leads to ROS accumulation accompanied by a decrease in heme oxygenase (HO)-1 protein expression in MA-10 mouse Leydig tumor cells. Subsequently, pronounced DNA damage with phosphorylated H2A histone family member X (γ-H2AX) increase and activation of DNA damage-related signaling pathways including double and single stranded break-induced ataxia telangiectasia mutated (ATM)/checkpoint kinase (Chk)2 and ataxia telangiectasia mutated and Rad3 related (ATR)/Chk1 signaling axes were identified. p53-dependent pathway was then initiated ultimately leading to cell death. Preincubated with free radical scavenger, N-acetylcysteine (NAC), down-regulated γ-H2AX expression in treated cells and partially reduced cell death, indicating that ROS overproduction is involved in combination treatment-induced DNA damage. Furthermore, the combination treatment effectively inhibited tumor growth as reflected in the reduction of tumor volume, size and weight, and high expression level of γ-H2AX in tumor tissue in vivo, suggesting that the combination treatment inhibited tumor growth via causing DNA damage in MA-10 cells. In summary, these results expound that the combination treatment of cordycepin and radiation induces MA-10 mouse Leydig tumor cell death through ROS accumulation and DNA damage. This finding can serve as a reference guideline for future clinical therapy of testicular cancer and provide potential targets for anti-cancer drug design.

Alterations of endogenous pain-modulatory system of the cerebral cortex in the neuropathic pain.

Neuropathic pain (NeP) remains a significant clinical challenge owing to insufficient awareness of its pathological mechanisms. We elucidated the aberrant metabolism of the cerebral cortex in NeP induced by the chronic constriction injury (CCI) using metabolomics and proteomics analyses. After CCI surgery, the values of MWT and TWL markedly reduced and maintained at a low level. CCI induced the significant dysregulation of 57 metabolites and 31 proteins in the cerebral cortex. Integrative analyses showed that the differentially expressed metabolites and proteins were primarily involved in alanine, aspartate and glutamate metabolism, GABAergic synapse, and retrograde endocannabinoid signaling. Targeted metabolomics and western blot analysis confirmed the alterations of some key metabolites and proteins in endogenous pain-modulatory system. In conclusion, our study revealed the alterations of endocannabinoids system and purinergic system in the CCI group, and provided a novel perspective on the roles of endogenous pain-modulatory system in the pathological mechanisms of NeP.

Transcriptomic and functional analyses reveal the molecular mechanisms underlying Fe-mediated tobacco resistance to potato virus Y infection.

Potato virus Y (PVY) mainly infects Solanaceous crops, resulting in considerable losses in the yield and quality. Iron (Fe) is involved in various biological processes in plants, but its roles in resistance to PVY infection has not been reported. In this study, foliar application of Fe could effectively inhibit early infection of PVY, and a full-length transcriptome and Illumina RNA sequencing was performed to investigate its modes of action in PVY-infected Nicotiana tabacum. The results showed that 18,074 alternative splicing variants, 3,654 fusion transcripts, 3,086 long non-coding RNAs and 14,403 differentially expressed genes (DEGs) were identified. Specifically, Fe application down-regulated the expression levels of the DEGs related to phospholipid hydrolysis, phospholipid signal, cell wall biosynthesis, transcription factors (TFs) and photosystem I composition, while those involved with photosynthetic electron transport chain (PETC) were up-regulated at 1 day post inoculation (dpi). At 3 dpi, these DEGs related to photosystem II composition, PETC, molecular chaperones, protein degradation and some TFs were up-regulated, while those associated with light-harvesting, phospholipid hydrolysis, cell wall biosynthesis were down-regulated. At 9 dpi, Fe application had little effects on resistance to PVY infection and transcript profiles. Functional analysis of these potentially critical DEGs was thereafter performed using virus-induced gene silencing approaches and the results showed that NbCat-6A positively regulates PVY infection, while the reduced expressions of NbWRKY26, NbnsLTP, NbFAD3 and NbHSP90 significantly promote PVY infection in N. benthamiana. Our results elucidated the regulatory network of Fe-mediated resistance to PVY infection in plants, and the functional candidate genes also provide important theoretical bases to further improve host resistance against PVY infection.

Analysis of lysine acetylation in tomato spot wilt virus infection in Nicotiana benthamiana.

Introduction: Kac is a model for all acylation modification studies. Kac plays a critical role in eukaryotes and prokaryotes. It is mainly involved in six major biological functions: gene expression, signal transduction, cell development, protein conversion, metabolism, and metabolite transport. Method: We investigated and compared the acetylation modification of proteins in healthy and tomato spot wilt virus (TSWV)-infected Nicotiana benthamiana leaves. Result: We identified 3,418 acetylated lysine sites on 1962 proteins acetylation of proteins in the TSWV-infected and control groups were compared; it was observed that 408 sites on 294 proteins were upregulated and 284 sites on 219 proteins (involved in pentose phosphate, photosynthesis, and carbon fixation in photosynthesis) were downregulated after the infection. Overall, 35 conserved motifs were identified, of which xxxkxxxxx_K_ Rxxxxxxxxx represented 1,334 (31.63%) enrichment motifs and was the most common combination. Bioinformatic analysis revealed that most of the proteins with Kac sites were located in the chloroplast and cytoplasm. They were involved in biological processes, such as cellular and metabolic processes. Discussion: In conclusion, our results revealed that Kac may participate in the regulation of TSWV infection in N. benthamiana.

Identification of 3-Methoxyphenylacetic Acid as a Phytotoxin, Produced by Rhizoctonia solani AG-3 TB.

Tobacco target spot disease is caused by Rhizoctonia solani AG-3 TB, which causes serious harm to the quality and yield of tobacco. In this study, thin layer chromatography (TLC), high performance liquid chromatography (HPLC), infrared absorption spectroscopy (IR), and nuclear magnetic resonance spectroscopy (NMR) were used to purify and identify the potential phytotoxin produced by R. solani AG-3 TB. The result indicated that the purified toxin compound was 3-methoxyphenylacetic acid (3-MOPAA) (molecular formula: C9H10O3). The exogenous purified compound 3-MOPAA was tested, and the results revealed that 3-MOPAA can cause necrosis in tobacco leaves. 3-MOPAA is a derivative of phenylacetic acid (PAA), which should be produced by specific enzymes, such as hydroxylase or methylase, in the presence of PAA. These results enrich the research on the pathogenic phytotoxins of R. solani and provide valuable insights into the pathogenic mechanism of AG-3 TB.

Nanoparticles augment the therapeutic window of RT and immunotherapy for treating cancers: pivotal role of autophagy.

Immunotherapies are now emerging as an efficient anticancer therapeutic strategy. Cancer immunotherapy utilizes the host's immune system to fight against cancer cells and has gained increasing interest due to its durable efficacy and low toxicity compared to traditional antitumor treatments, such as chemotherapy and radiotherapy (RT). Although the combination of RT and immunotherapy has drawn extensive attention in the clinical setting, the overall response rates are still low. Therefore, strategies for further improvement are urgently needed. Nanotechnology has been used in cancer immunotherapy and RT to target not only cancer cells but also the tumor microenvironment (TME), thereby helping to generate a long-term immune response. Nanomaterials can be an effective delivery system and a strong autophagy inducer, with the ability to elevate autophagy to very high levels. Interestingly, autophagy could play a critical role in optimal immune function, mediating cell-extrinsic homeostatic effects through the regulation of danger signaling in neoplastic cells under immunogenic chemotherapy and/or RT. In this review, we summarize the preclinical and clinical development of the combination of immunotherapy and RT in cancer therapy and highlight the latest progress in nanotechnology for augmenting the anticancer effects of immunotherapy and RT. The underlying mechanisms of nanomaterial-triggered autophagy in tumor cells and the TME are discussed in depth. Finally, we suggest the implications of these three strategies combined together to achieve the goal of maximizing the therapeutic advantages of cancer therapy and show recent advances in biomarkers for tumor response in the evaluation of those therapies.