RESUMO
MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.
Assuntos
Regulação da Expressão Gênica de Plantas , MicroRNAs , Nicotiana , Polilisina , Vírus do Mosaico do Tabaco , Nicotiana/genética , Nicotiana/virologia , MicroRNAs/genética , MicroRNAs/metabolismo , Polilisina/farmacologia , Transcriptoma , Doenças das Plantas/virologia , Doenças das Plantas/genética , Antivirais/farmacologia , Perfilação da Expressão GênicaRESUMO
Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.
RESUMO
Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.
Assuntos
Cobre , Resistência à Doença , Nicotiana , Doenças das Plantas , Potyvirus , Nicotiana/virologia , Nicotiana/genética , Potyvirus/fisiologia , Cobre/farmacologia , Doenças das Plantas/virologia , Resistência à Doença/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Perfilação da Expressão Gênica , Plantas Geneticamente Modificadas/virologia , Regulação da Expressão Gênica de Plantas , TranscriptomaRESUMO
The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.
Assuntos
Begomovirus , Geminiviridae , Geminiviridae/genética , Nicotiana , Filogenia , Virulência , Doenças das Plantas , Begomovirus/genética , ChinaRESUMO
Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.
Assuntos
Potyvirus , Streptomyces , Vírus do Mosaico do Tabaco , Anisomicina , Simulação de Acoplamento Molecular , Vírus do Mosaico do Tabaco/genética , Streptomyces/genética , Antivirais/farmacologia , Doenças das PlantasRESUMO
Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.
RESUMO
Potato virus Y (PVY) infection causes necrosis and curling of leaves, which seriously affect the yield and quality of Solanaceous crops. The roles of nutrient elements in the regulation of plant resistance to virus infection has been widely reported, while the mechanisms are poorly studied. Previous studies in our laboratory have demonstrated that foliar spraying of MgSO4 could induce Nicotiana tabacum resistance to PVY by increasing the activity of defense-related enzymes. Consistent with the results, we found that exogenous magnesium (Mg) had a certain effect on N. tabacum anti-PVY infection. Meanwhile, Illumina RNA sequencing revealed that Mg induced resistance to PVY infection was mainly by regulating carbohydrate metabolism and transportation, nitrogen metabolism, Ca2+ signal transduction and oxidative phosphorylation. Moreover, we used virus-induced gene silencing assays to verify the function of homologs of five N. tabacum genes involved in above pathways in N. benthamiana. The results showed that NbTPS and NbGBE were conducive to PVY infection, while NbPPases and NbNR were related to resistance to PVY infection. These results suggested a novel strategy for resistance to PVY infection and provided a theoretical basis for virus-resistance breeding.
RESUMO
Potato virus Y (PVY) mainly infects Solanaceous crops, resulting in considerable losses in the yield and quality. Iron (Fe) is involved in various biological processes in plants, but its roles in resistance to PVY infection has not been reported. In this study, foliar application of Fe could effectively inhibit early infection of PVY, and a full-length transcriptome and Illumina RNA sequencing was performed to investigate its modes of action in PVY-infected Nicotiana tabacum. The results showed that 18,074 alternative splicing variants, 3,654 fusion transcripts, 3,086 long non-coding RNAs and 14,403 differentially expressed genes (DEGs) were identified. Specifically, Fe application down-regulated the expression levels of the DEGs related to phospholipid hydrolysis, phospholipid signal, cell wall biosynthesis, transcription factors (TFs) and photosystem I composition, while those involved with photosynthetic electron transport chain (PETC) were up-regulated at 1 day post inoculation (dpi). At 3 dpi, these DEGs related to photosystem II composition, PETC, molecular chaperones, protein degradation and some TFs were up-regulated, while those associated with light-harvesting, phospholipid hydrolysis, cell wall biosynthesis were down-regulated. At 9 dpi, Fe application had little effects on resistance to PVY infection and transcript profiles. Functional analysis of these potentially critical DEGs was thereafter performed using virus-induced gene silencing approaches and the results showed that NbCat-6A positively regulates PVY infection, while the reduced expressions of NbWRKY26, NbnsLTP, NbFAD3 and NbHSP90 significantly promote PVY infection in N. benthamiana. Our results elucidated the regulatory network of Fe-mediated resistance to PVY infection in plants, and the functional candidate genes also provide important theoretical bases to further improve host resistance against PVY infection.
RESUMO
Cucumber green mottle mosaic virus (CGMMV) infection causes acidification and rot of watermelon flesh, resulting in serious economic losses. It is widely reported the interaction relationship between boron and reactive oxygen species (ROS) in regulating normal growth and disease resistance in plants. Our previous results demonstrated that exogenous boron could improve watermelon resistance to CGMMV infection. However, the roles of ROS-related genes regulated by boron in resistance to CGMMV infection are unclear. Here, we demonstrated that CGMMV symptoms were alleviated, and viral accumulations were decreased by boron application in Nicotiana benthamiana, indicating that boron contributed to inhibiting CGMMV infection. Meanwhile, we found that a number of differentially expressed genes (DEGs) associated with inositol biosynthesis, ethylene synthesis, Ca2+ signaling transduction and ROS scavenging system were up-regulated, while many DEGs involved in ABA catabolism, GA signal transduction and ascorbic acid metabolism were down-regulated by boron application under CGMMV infection. Additionally, we individually silenced nine ROS-related genes to explore their anti-CGMMV roles using a tobacco rattle virus (TRV) vector. The results showed that NbCat1, NbGME1, NbGGP and NbPrx Q were required for CGMMV infection, while NbGST and NbIPS played roles in resistance to CGMMV infection. The similar results were obtained in watermelon by silencing of ClCat, ClPrx or ClGST expression using a pV190 vector. This study proposed a new strategy for improving plant resistance to CGMMV infection by boron-regulated ROS pathway and provided several target genes for watermelon disease resistance breeding.
RESUMO
BACKGROUND: Plant virus diseases are difficult to prevent and control, causing serious economic losses to the agricultural production world. To develop new pesticides with antiviral activity, a serial of compounds containing the structure of pyrimidine and moroxydine were synthesized, among which GLY-15 exhibited good antiviral activity against tobacco mosaic virus (TMV), while the mechanism of antiviral activity remains to be clarified. RESULTS: GLY-15 treatment significantly inhibited the formation of necrotic spots caused by TMV in Nicotiana glutinosa, and effectively suppressed the systemic transportation of TMV expressing a reporter gene (p35S-30B:GFP) in N. benthamiana and markedly reduced the accumulation of a movement deficient TMV in plants as well as viral RNA accumulation in tobacco protoplasts. The results of RNA sequencing showed that GLY-15 induced significant differential expression of genes or pathways involved in the stress response, defense response and signal transduction, phytohormone response and metabolism. Among them, real-time quantitative PCR validated that the expression of 12 critical genes such as heat shock protein, receptor kinase, cell-wall-related protein, disease-related protein and glucan endo-1,3-ß-glucosidase were significantly up-regulated. In addition, GLY-15 triggered reactive oxygen species (ROS) production and induced the activity of several crucial defense related enzymes in plants. The results of molecular docking showed potential binding ability of GLY-15 with TMV helicase and the coat protein. CONCLUSION: This study provide valuable insights into antiviral mechanism of action for GLY-15, which is expected to be applied as a pesticide for the management of plant viruses. © 2022 Society of Chemical Industry.
Assuntos
Vírus do Mosaico do Tabaco , Antivirais/farmacologia , Simulação de Acoplamento Molecular , Doenças das Plantas , Nicotiana , Pirimidinas/farmacologia , EsqueletoRESUMO
It is well known that aging induces a progressive decline in the proliferation and neural differentiation of radial glial cells (RGCs) in the hippocampal dentate gyrus (DG). The function of miR-144/451 is to activate stress-regulated molecular gene expression switches for cell proliferation and differentiation. We found that the miR-144/451 expression in the hippocampus was significantly reduced in aged mice compared to adult mice. Furthermore, the proliferation and neural differentiation of RGCs in the mouse hippocampal DG was decreased by miR-144/451 knockout (miR-144/451-/-). Antioxidant agents, superoxide dismutases (SODs) and catalase, and the expression of melatonin's receptor in the hippocampus were decreased in the miR-144/451-/- mice. In addition, the (protein kinase B) AKT/(glycogen synthase kinase 3ß) GSK3ß/(catenin beta-1) ß-catenin signaling pathway was weakly activated in the hippocampus of miR-144/451-/- mice, which was related to brain neurogenesis. Melatonin treatment improved the expression of miR-144/451 and antioxidant enzymes and activated the AKT/GSK3ß/ß-catenin pathway in the hippocampus of miR-144/451-/- mice. When the AKT pathway was inhibited by LY294002, the neurogenerative and antioxidant effects of melatonin were significantly limited in the hippocampus of miR-144/451-/- mice. In brief, our results indicated that miR-144/451 plays crucial roles in the proliferation and neural differentiation of RGCs via the regulation of the antioxidant and AKT/GSK3ß/ß-catenin pathways.
Assuntos
MicroRNAs , Proteínas Proto-Oncogênicas c-akt , Animais , Proliferação de Células , Giro Denteado , Células Ependimogliais , Glicogênio Sintase Quinase 3 beta/metabolismo , Hipocampo/metabolismo , Camundongos , MicroRNAs/genética , MicroRNAs/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , beta Catenina/metabolismoRESUMO
BACKGROUND: Early, precise and simultaneous identification of plant viruses is of great significance for preventing virus spread and reducing losses in agricultural yields. METHODS AND RESULTS: In this study, the identification of plant viruses from symptomatic samples collected from a cigar tobacco planting area in Deyang and a flue-cured tobacco planting area in Luzhou city, Sichuan Province, China, was conducted by deep sequencing of small RNAs (sRNAs) through an Illumina sequencing platform, and plant virus-specific contigs were generated based on virus-derived siRNA sequences. Additionally, sequence alignment and phylogenetic analysis were performed to determine the species or strains of these viruses. A total of 27930450, 21537662 and 28194021 clean reads were generated from three pooled samples, with a total of 105 contigs mapped to the closest plant viruses with lengths ranging from 34 ~ 1720 nt. The results indicated that the major viruses were potato virus Y, Chilli veinal mottle virus, tobacco vein banding mosaic virus, tobacco mosaic virus and cucumber mosaic virus. Subsequently, a fast and sensitive multiplex reverse transcription polymerase chain reaction assay was developed for the simultaneous detection of the most frequent RNA viruses infecting cigar and flue-cured tobacco in Sichuan. CONCLUSIONS: These results provide a theoretical basis and convenient methods for the rapid detection and control of viruses in cigar- and flue-cured tobacco.
Assuntos
Perfilação da Expressão Gênica/métodos , Nicotiana/virologia , Pequeno RNA não Traduzido/genética , RNA-Seq/métodos , Vírus/classificação , Cucumovirus/genética , Cucumovirus/isolamento & purificação , Cucumovirus/patogenicidade , Resistência à Doença , Evolução Molecular , Reação em Cadeia da Polimerase Multiplex , Filogenia , Folhas de Planta/genética , Folhas de Planta/virologia , Potyvirus/genética , Potyvirus/isolamento & purificação , Potyvirus/patogenicidade , RNA Viral/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Alinhamento de Sequência , Nicotiana/genética , Vírus do Mosaico do Tabaco/genética , Vírus do Mosaico do Tabaco/isolamento & purificação , Vírus do Mosaico do Tabaco/patogenicidade , Vírus/genética , Vírus/isolamento & purificaçãoRESUMO
Novel anti-viral natural product ε-poly-l-lysine (ε-PL) produced by Streptomyces is a homopolymer of l-lysine, of which the underlying molecular mode of action remains to be further elucidated. In this study, ε-PL induced significant fragmentation of tobacco mosaic virus (TMV) virions and delayed the systemic infection of TMV-GFP as well as wild-type TMV in plants. ε-PL treatment also markedly inhibited RNA accumulation of TMV in tobacco BY-2 protoplasts. The results of RNA-seq indicated that the agent induced significantly differential expression of genes that are associated with defense response, stress response, autophagy, and ubiquitination. Among them, 15 critical differential expressed genes were selected for real-time quantitative PCR validation. We further demonstrated that ε-PL can induce host defense responses by assessing the activity of several defense-related enzymes in plants. Our results provided valuable insights into molecular anti-viral mode of action for ε-PL, which is expected to be applied as a novel microbial natural product against plant virus diseases.
Assuntos
Produtos Biológicos , Vírus do Mosaico do Tabaco , Antivirais , Produtos Biológicos/farmacologia , Polilisina , Nicotiana , Vírus do Mosaico do Tabaco/genética , TranscriptomaRESUMO
ETHNOPHARMACOLOGICAL RELEVANCE: Tanshinone-â (TSNâ ), a member of the mainly active components of Salvia miltiorrhiza Bunge (Dan Shen), which is widely used for the treatment for modern clinical diseases including cardiovascular and cerebrovascular diseases, has been reported to show the properties of anti-oxidation, anti-inflammation, neuroprotection and other pharmacological actions. However, whether TSNâ can improve neuron survival and neurological function against transient focal cerebral ischemia (tMCAO) in mice is still a blank field. AIM OF THE STUDY: This study aims to investigate the neuroprotective effects of TSNâ on ischemic stroke (IS) induced by tMCAO in mice and explore the potential mechanism of TSNâ against IS by combining network pharmacology approach and experimental verification. MATERIALS AND METHODS: In this study, the pivotal candidate targets of TSNâ against IS were screened by network pharmacology firstly. Enrichment analysis and molecular docking of those targets were performed to identify the possible mechanism of TSNâ against IS. Afterwards, experiments were carried out to further verify the mechanism of TSNâ against IS. The infarct volume and neurological deficit were evaluated by 2, 3, 5-triphenyl tetrazolium chloride (TTC) staining and Longa respectively. Immunohistochemistry was used to observe neuronal death in the hippocampus and cortical regions by detecting the change of NeuN. The predicting pathways of signaling-related proteins were assessed by Western blot in vitro and in vivo experiments. RESULTS: In vivo, TSNâ was found to dose-dependently decrease mice's cerebral infarct volume induced by tMCAO. In vitro, pretreatment with TSNâ could increase cell viability of HT-22 cell following oxygen-glucose deprivation (OGD/R). Moreover, the results showed that 125 candidate targets were identified, Protein kinase B (AKT) signaling pathway was significantly enriched by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis and mitogen-activated protein kinases 1 (MAPK1) and AKT1 could be bound to TSNâ more firmly by molecular docking analysis, which implies that TSNâ may play a role in neuroprotection through activating AKT and MAPK signaling pathways. Meanwhile, TSNâ was confirmed to significantly protect neurons from injury induced by IS through activating AKT and MAPK signaling pathways. CONCLUSION: In conclusion, our study clarifies that the mechanism of TSNâ against IS might be related to AKT and MAPK signaling pathways, which may provide the basic evidence for further development and utilization of TSNâ .
Assuntos
Abietanos/farmacologia , AVC Isquêmico/prevenção & controle , Fármacos Neuroprotetores/farmacologia , Abietanos/uso terapêutico , Abietanos/toxicidade , Animais , Isquemia Encefálica/complicações , Linhagem Celular , Sobrevivência Celular/efeitos dos fármacos , Modelos Animais de Doenças , Glicogênio Sintase Quinase 3 beta/metabolismo , Hipocampo/metabolismo , AVC Isquêmico/etiologia , AVC Isquêmico/genética , Sistema de Sinalização das MAP Quinases/efeitos dos fármacos , Masculino , Camundongos Endogâmicos ICR , Quinases de Proteína Quinase Ativadas por Mitógeno/metabolismo , Simulação de Acoplamento Molecular , Neurônios/efeitos dos fármacos , Fármacos Neuroprotetores/uso terapêutico , Fármacos Neuroprotetores/toxicidade , Fosfatidilinositol 3-Quinases/metabolismo , Inibidores de Fosfoinositídeo-3 Quinase/farmacologia , Inibidores de Fosfoinositídeo-3 Quinase/uso terapêutico , Mapas de Interação de Proteínas , Proteínas Proto-Oncogênicas c-akt/metabolismo , beta Catenina/metabolismo , Quinases raf/metabolismoRESUMO
In the pathogen infection and host defence equilibrium, plant viruses have evolved to efficiently replicate their genomes, to resist the attack from host defence responses and to avoid causing severe negative effect on growth and metabolism of the hosts. In this study, we generated chimeric tobacco mosaic virus (TMV) variants, in which the coat protein (CP) sequences were substituted with that of cucumber green mottle mosaic virus (CGMMV) or pepper mild mottle virus (PMMoV) to address the role of these in virus infection and host symptomology. The results showed that the chimeric viruses (TMV-CGCP or TMV-PMCP) induce stunting and necrotic symptoms in tobacco plants. We analyzed the transcriptomic changes in tobacco plants after infection of TMV and its chimeras using a high-throughput RNA sequencing approach and found that infection of the chimeric TMV induced significant up-regulation of host defence responsive genes together with salicylic (SA) or abscisic acid (ABA) responsive genes, but down-regulation of auxin (Aux) responsive genes. We further confirmed the increase in the levels of SA and ABA, together with the reduced levels of Aux after infection of chimeric TMV in tobacco plants. These data suggest novel roles of tobamovirus CP in induction of host symptoms and defence responses.
RESUMO
BACKGROUND: Pepper mild mottle virus (PMMoV) is a member in the genus Tobamovirus and infects mainly solanaceous plants. However, the mechanism of virus-host interactions remains unclear. To explore the responses of pepper plants to PMMoV infection, we analyzed the transcriptomic changes in pepper plants after PMMoV infection using a high-throughput RNA sequencing approach and explored the roles of host autophagy in regulating PMMoV infection. RESULTS: A total of 197 differentially expressed genes (DEGs) were obtained after PMMoV infection, including 172 significantly up-regulated genes and 25 down-regulated genes. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses revealed that most up-regulated DEGs were involved in plant abiotic and biotic stresses. Further analyses showed the expressions of multiple autophagy-related genes (ATGs) were increased after PMMoV infection in pepper and Nicotiana benthamiana plants. Through confocal microscopy and transmission electron microscopy, we have found that PMMoV infection in plant can induce autophagy, evidenced by the increased number of GFP-ATG8a fluorescent punctate and the appearance of double membrane autophagic structures in cells of N. benthamiana. Additionally, inhibition of autophagy significantly increased PMMoV RNA accumulation and aggravated systemic PMMoV symptoms through autophagy inhibitor (3-MA and E64d) treatment and silencing of NbATG expressions by a Tobacco rattle virus-induced gene silencing assays. These results indicated that autophagy played a positive role in plant resistance to PMMoV infection. CONCLUSIONS: Taken together, our results provide a transcriptomic insight into pepper responding to PMMoV infection and reveal that autophagy induced by PMMoV infection has an antiviral role in regulating PMMoV infection. These results also help us to better understand the mechanism controlling PMMoV infection in plants and to develop better strategies for breeding projects for virus-resistant crops.
Assuntos
Autofagia/fisiologia , Capsicum/virologia , Perfilação da Expressão Gênica , Doenças das Plantas/virologia , Tobamovirus , Capsicum/genética , Capsicum/imunologia , Regulação da Expressão Gênica de Plantas/genética , Técnicas de Silenciamento de Genes , Doenças das Plantas/imunologia , Doenças das Plantas/microbiologia , Análise de Sequência de RNA , Nicotiana/virologiaRESUMO
Plant viral diseases cause severe economic losses in agricultural production. Development of microorganism-derived antiviral agents provides an alternative strategy to efficiently control plant viral diseases. In this study, the antiviral effect and mechanism of a combined biological agent Cytosinpeptidemycin and Chitosan oligosaccharide (CytPM-COS) were investigated. CytPM-COS effectively inhibited tobacco mosaic virus (TMV) in Nicotiana glutinosa, suppressed viral RNA and CP accumulation in BY-2 protoplast and affected the subcellular localization as well as punctate formation of TMV MP in N. benthamiana leaves. In addition, CytPM-COS triggered reactive oxygen species (ROS) production and induced up-regulation of various defense responsive genes including PR-1, PR-5, FLS2, Hsp70. Our results indicated that CytPM-COS can potentially act as a pesticide for integrated control of plant viruses in the future.
Assuntos
Antivirais , Quitosana , Vírus do Mosaico do Tabaco , Fatores Biológicos , Citosina/análogos & derivados , Oligossacarídeos , Doenças das Plantas , Folhas de Planta , NicotianaRESUMO
BACKGROUND: Chilli veinal mottle virus (ChiVMV), which belongs to the genus Potyvirus of the family Potyviridae, mainly infects solanaceous plants and has caused serious economic losses in Asia and Africa. Tobacco plants infected with ChiVMV suffered from punctate necrosis of leaves, leaf deformation, systemic necrosis of leaves and stems, and eventually plant death. However, ChiVMV infection could not usually be identified given the lack of rapid and efficient detection assays in tobacco plants. Therefore, an isolate of tobacco-infecting ChiVMV (ChiVMV-LZ) was obtained, and a novel isothermal amplification and detection technique, reverse transcription-recombinase polymerase amplification (RT-RPA), was established to detect ChiVMV in tobacco plants. METHODS: In this study, the full-length genome of ChiVMV-LZ was obtained using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) assays. The genome sequence of ChiVMV-LZ was characterized by sequence alignment and phylogenetic analysis. Then, a RT-RPA assay was established for rapid and sensitive detection of ChiVMV-LZ in tobacco. Additionally, the established RT-RPA assay was compared to the RT-PCR assay in aspect of sensitivity and application in field-collected tobacco samples. RESULTS: ChiVMV-LZ was isolated from diseased tobacco in Luzhou, Sichuan, China. The tobacco plants inoculated with ChiVMV-LZ showed typical symptoms of yellow and round spots on the leaves, and curled and folded leaf margin, similar to those observed on naturally ChiVMV-infected tobacco in the field. The full-length genomic sequence of ChiVMV-LZ was determined to be 9742 nucleotides. Sequence alignment and phylogenetic analysis showed that ChiVMV-LZ was most closely related to ChiVMV-Yp8 isolated from pepper plants in Sichuan province while distantly related to ChiVMV-YN from tobacco in Yunnan province, indicating a possibly geographical differentiation of ChiVMV isolates. Additionally, a RT-RPA assay was established for rapid detection of ChiVMV in tobacco. The RT-RPA has no cross-reaction with other related tobacco viruses and is about 10-fold more sensitive than conventional RT-PCR method. CONCLUSION: The characterization of ChiVMV-LZ infecting tobacco was determined, and the established RT-RPA assay provides a reliable and effective method for rapid detection of ChiVMV in tobacco.
Assuntos
Nicotiana/virologia , Técnicas de Amplificação de Ácido Nucleico/métodos , Doenças das Plantas/virologia , Potyvirus/isolamento & purificação , Genoma Viral , Filogenia , Folhas de Planta/virologia , Potyvirus/genética , Recombinases , Transcrição Reversa , Sensibilidade e EspecificidadeRESUMO
Microbial secondary metabolites produced by Streptomyces are applied to control plant diseases. ε-poly-l-lysine (ε-PL) is a non-toxic food preservative, but the potential application of ε-PL as a microbial fungicide in agriculture has rarely been reported. In this study, Alternaria alternata (A. alternata) was used to reveal the effect and mode of action for ε-PL on the plant pathogenic fungi. The results showed that ε-PL effectively inhibited necrotic-lesion development caused by A. alternata on tobacco. Mycelial growth was also significantly inhibited in vitro by 100⯵g/ml ε-PL using in vitro analysis. Moreover, 25⯵g/ml ε-PL inhibited spore germination and induced abnormal morphological development of A. alternata hyphae. To clarify the molecular-genetic antifungal mechanisms, we selected several crucial genes involved in the development and pathogenesis of A. alternata and studied their expression regulated by ε-PL. Results of real-time quantitative PCR showed that a mycelium morphology and pathogenic process related cyclic adenosine monophosphate protein (cAMP) dependent protein kinase A (PKA), Alternaria alternata cAMP-dependent protein kinase catalytic subunit (AAPK1) and the early infection-related glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were down-regulated after ε-PL treatment. The results provide novel insights for the application of ε-PL in the control of plant diseases caused by A. alternata.
Assuntos
Alternaria , Nicotiana , Doenças das Plantas , Polilisina , VirulênciaRESUMO
Cytosinpeptidemycin (CytPM) is a microbial pesticide that displayed broad-spectrum antiviral activity against various plant viruses. However, the molecular mechanism underlying antiviral activity of CytPM is poorly understood. In this study, the results demonstrated that CytPM could effectively delay the systemic infection of tobacco mosaic virus (TMV) in Nicotiana benthamiana and significantly inhibit the viral accumulation in tobacco BY-2 protoplasts. Results of RNA-seq indicated that 210 and 120 differential expressed genes (DEGs) were significantly up- and down-regulated after CytPM treatment in BY-2 protoplasts, respectively. In addition, KEGG analysis indicated that various DEGs were involved in endoplasmic reticulum (ER) protein processing, suggesting a possible correlation between ER homeostasis and virus resistance. RT-qPCR was performed to validate the gene expression of crucial DEGs related with defense, stress responses, signaling transduction, and phytohormone, which were consistent with results of RNA-seq. Our works provided valuable insights into the antiviral mechanism of CytPM that induced host resistance to viral infection.