RALF22 promotes plant immunity and amplifies the Pep3 immune signal.

Rapid alkalinization factors (RALFs) in plants have been reported to dampen pathogen-associated molecular pattern (PAMP)-triggered immunity via suppressing PAMP-induced complex formation between the pattern recognition receptor (PRR) and its co-receptor BAK1. However, the direct and positive role of RALFs in plant immunity remains largely unknown. Herein, we report the direct and positive roles of a typical RALF, RALF22, in plant immunity. RALF22 alone directly elicited a variety of typical immune responses and triggered resistance against the devastating necrotrophic fungal pathogen Sclerotinia sclerotiorum in a FERONIA (FER)-dependent manner. LORELEI (LRE)-like glycosylphosphatidylinositol (GPI)-anchored protein 1 (LLG1) and NADPH oxidase RBOHD were required for RALF22-elicited reactive oxygen species (ROS) generation. The mutation of cysteines conserved in the C terminus of RALFs abolished, while the constitutive formation of two disulfide bridges between these cysteines promoted the RALF22-elicited ROS production and resistance against S. sclerotiorum, demonstrating the requirement of these cysteines in the functions of RALF22 in plant immunity. Furthermore, RALF22 amplified the Pep3-induced immune signal by dramatically increasing the abundance of PROPEP3 transcript and protein. Supply with RALF22 induced resistance against S. sclerotiorum in Brassica crop plants. Collectively, our results reveal that RALF22 triggers immune responses and augments the Pep3-induced immune signal in a FER-dependent manner, and exhibits the potential to be exploited as an immune elicitor in crop protection.

Genome-Wide Identification of Rapid Alkalinization Factor Family in Brassica napus and Functional Analysis of BnRALF10 in Immunity to Sclerotinia sclerotiorum.

Rapid alkalinization factors (RALFs) were recently reported to be important players in plant immunity. Nevertheless, the signaling underlying RALF-triggered immunity in crop species against necrotrophic pathogens remains largely unknown. In this study, RALF family in the important oil crop oilseed rape (Brassica napus) was identified and functions of BnRALF10 in immunity against the devastating necrotrophic pathogen Sclerotinia sclerotiorum as well as the signaling underlying this immunity were revealed. The oilseed rape genome carried 61 RALFs, half of them were atypical, containing a less conserved YISY motif and lacking a RRXL motif or a pair of cysteines. Family-wide gene expression analyses demonstrated that patterns of expression in response to S. sclerotiorum infection and DAMP and PAMP treatments were generally RALF- and stimulus-specific. Most significantly responsive BnRALF genes were expressionally up-regulated by S. sclerotiorum, while in contrast, more BnRALF genes were down-regulated by BnPep5 and SsNLP1. These results indicate that members of BnRALF family are likely differentially involved in plant immunity. Functional analyses revealed that BnRALF10 provoked diverse immune responses in oilseed rape and stimulated resistance to S. sclerotiorum. These data support BnRALF10 to function as a DAMP to play a positive role in plant immunity. BnRALF10 interacted with BnFER. Silencing of BnFER decreased BnRALF10-induced reactive oxygen species (ROS) production and compromised rape resistance to S. sclerotiorum. These results back BnFER to be a receptor of BnRALF10. Furthermore, quantitative proteomic analysis identified dozens of BnRALF10-elicited defense (RED) proteins, which respond to BnRALF10 in protein abundance and play a role in defense. Our results revealed that BnRALF10 modulated the abundance of RED proteins to fine tune plant immunity. Collectively, our results provided some insights into the functions of oilseed rape RALFs and the signaling underlying BnRALF-triggered immunity.

Characterization of tomato protein kinases embedding guanylate cyclase catalytic center motif.

Guanylate cyclases (GCs) are enzymes that catalyze the reaction to produce cyclic GMP (cGMP), a key signaling molecule in eukaryotes. Nevertheless, systemic identification and functional analysis of GCs in crop plant species have not yet been conducted. In this study, we systematically identified GC genes in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of two putative tomato GC genes in disease resistance. Ninety-nine candidate GCs containing GC catalytic center (GC-CC) motif were identified in tomato genome. Intriguingly, all of them were putative protein kinases embedding a GC-CC motif within the protein kinase domain, which was thus tentatively named as GC-kinases here. Two homologs of Arabidopsis PEPRs, SlGC17 and SlGC18 exhibited in vitro GC activity. Co-silencing of SlGC17 and SlGC18 genes significantly reduced resistance to tobacco rattle virus, fungus Sclerotinia sclerotiorum, and bacterium Pseudomonas syringae pv. tomato (Pst) DC3000. Moreover, co-silencing of these two genes attenuated PAMP and DAMP-triggered immunity as shown by obvious decrease of flg22, chitin and AtPep1-elicited Ca2+ and H2O2 burst in SlGC-silenced plants. Additionally, silencing of these genes altered the expression of a set of Ca2+ signaling genes. Furthermore, co-silencing of these GC-kinase genes exhibited stronger effects on all above regulations in comparison with individual silencing. Collectively, our results suggest that GC-kinases might widely exist in tomato and the two SlPEPR-GC genes redundantly play a positive role in resistance to diverse pathogens and PAMP/DAMP-triggered immunity in tomato. Our results provide insights into composition and functions of GC-kinases in tomato.

Ubiquitin Extension Protein UEP1 Modulates Cell Death and Resistance to Various Pathogens in Tobacco.

Ubiquitin (Ub) extension proteins (UEPs) are fusion proteins of a Ub at the N terminus to a ribosomal protein. They are the main source of Ub and the only source of extension ribosomal protein. Although important roles of the Ub-26S proteasome system in various biological processes have been well established, direct evidence for the role of UEP genes in plant defense is rarely reported. In this study, we cloned a Ub-S27a-type UEP gene (NbUEP1) from Nicotiana benthamiana and demonstrated its function in cell death and disease resistance. Virus-induced gene silencing of NbUEP1 led to intensive cell death, culminating in whole-seedling withering. Transient RNA interference (RNAi) of NbUEP1 caused strong cell death in infiltrated areas, while stable NbUEP1-RNAi tobacco plants constitutively formed necrotic lesions in leaves. NbUEP1-RNAi plants exhibited increased resistance to the oomycete Pythium aphanidermatum and viruses Tobacco mosaic virus and Cucumber mosaic virus while displaying decreased resistance to the nematode Meloidogyne incognita compared with non-RNAi control plants. Transcription profiling analysis indicated that jasmonate and ethylene pathways, lipid metabolism, copper amine oxidase-mediated active species generation, glycine-rich proteins, vacuolar processing enzyme- and RD21-mediated cell death and defense regulation, and autophagy might be associated with NbUEP1-mediated cell death and resistance. Our results provided evidence for the important roles of plant UEPs in modulating plant cell death and disease resistance.

Glycolate oxidase gene family in Nicotiana benthamiana: genome-wide identification and functional analyses in disease resistance.

Glycolate oxidase (GOX)-dependent production of H2O2 in response to pathogens and its function in disease resistance are still poorly understood. In this study, we performed genome-wide identification of GOX gene family in Nicotiana benthamiana and analyzed their function in various types of disease resistance. Sixteen GOX genes were identified in N. benthamiana genome. They consisted of GOX and HAOX groups. All but two NbGOX proteins contained an alpha_hydroxyacid_oxid_FMN domain with extra 43-52 amino acids compared to that of FMN-dependent alpha-hydroxyacid oxidizing enzymes (NCBI-CDD cd02809). Silencing of three NbGOX family genes NbHAOX8, NbGOX1 and NbGOX4 differently affected resistance to various pathogens including Tobacco rattle virus, Xanthomonas oryzae pv. oryzae (Xoo) and Sclerotinia sclerotiorum. Effect of these genes on resistance to Xoo is well correlated with that on Xoo-responsive H2O2 accumulation. Additionally, silencing of these genes enhanced PAMP-triggered immunity as shown by increased flg22-elicited H2O2 accumulation in NbGOX-silenced plants. These NbGOX family genes were distinguishable in altering expression of defense genes. Analysis of mutual effect on gene expression indicated that NbGOX4 might function through repressing NbHAOX8 and NbGOX1. Collectively, our results reveal the important roles and functional complexity of GOX genes in disease resistance in N. benthamiana.

Leaf stage-associated resistance is correlated with phytohormones in a pathosystem-dependent manner.

It has been reported in several pathosystems that disease resistance can vary in leaves at different stages. However, how general this leaf stage-associated resistance is, and the molecular mechanism(s) underlying it, remain largely unknown. Here, we investigated the effect of leaf stage on basal resistance, effector-triggered immunity (ETI) and nonhost resistance, using eight pathosystems involving the hosts Arabidopsis thaliana, Nicotiana tabacum, and N. benthamiana and the pathogens Sclerotinia sclerotiorum, Pseudomonas syringae pv. tabaci, P. syringae pv. tomato DC3000, and Xanthomonas oryzae pv. oryzae (Xoo). We show evidence that leaf stage-associated resistance exists ubiquitously in plants, but with varying intensity at different stages in diverse pathosystems. Microarray expression profiling assays demonstrated that hundreds of genes involved in defense responses, phytohormone biosynthesis and signaling, and calcium signaling, were differentially expressed between leaves at different stages. The Arabidopsis mutants sid1, sid2-3, ein2, jar1-1, aba1 and aao3 lost leaf stage-associated resistance to S. sclerotiorum, and the mutants aba1 and sid2-3 were affected in leaf stage-associated RPS2/AvrRpt2+ -conferred ETI, whereas only the mutant sid2-3 influenced leaf stage-associated nonhost resistance to Xoo. Our results reveal that the phytohormones salicylic acid, ethylene, jasmonic acid and abscisic acid likely play an essential, but pathosystem-dependent, role in leaf stage-associated resistance.

HsfA1a upregulates melatonin biosynthesis to confer cadmium tolerance in tomato plants.

Melatonin regulates broad aspects of plant responses to various biotic and abiotic stresses, but the upstream regulation of melatonin biosynthesis by these stresses remains largely unknown. Herein, we demonstrate that transcription factor heat-shock factor A1a (HsfA1a) conferred cadmium (Cd) tolerance to tomato plants, in part through its positive role in inducing melatonin biosynthesis under Cd stress. Analysis of leaf phenotype, chlorophyll content, and photosynthetic efficiency revealed that silencing of the HsfA1a gene decreased Cd tolerance, whereas its overexpression enhanced plant tolerance to Cd. HsfA1a-silenced plants exhibited reduced melatonin levels, and HsfA1a overexpression stimulated melatonin accumulation and the expression of the melatonin biosynthetic gene caffeic acid O-methyltransferase 1 (COMT1) under Cd stress. Both an in vitro electrophoretic mobility shift assay and in vivo chromatin immunoprecipitation coupled with qPCR analysis revealed that HsfA1a binds to the COMT1 gene promoter. Meanwhile, Cd stress induced the expression of heat-shock proteins (HSPs), which was compromised in HsfA1a-silenced plants and more robustly induced in HsfA1a-overexpressing plants under Cd stress. COMT1 silencing reduced HsfA1a-induced Cd tolerance and melatonin accumulation in HsfA1a-overexpressing plants. Additionally, the HsfA1a-induced expression of HSPs was partially compromised in COMT1-silenced wild-type or HsfA1a-overexpressing plants under Cd stress. These results demonstrate that HsfA1a confers Cd tolerance by activating transcription of the COMT1 gene and inducing accumulation of melatonin that partially upregulates expression of HSPs.

Artificial Agrobacterium tumefaciens strains exhibit diverse mechanisms to repress Xanthomonas oryzae pv. oryzae-induced hypersensitive response and non-host resistance in Nicotiana benthamiana.

Xanthomonas oryzae pv. oryzae (Xoo) rapidly triggers a hypersensitive response (HR) and non-host resistance in its non-host plant Nicotiana benthamiana. Here, we report that Agrobacterium tumefaciens strain GV3101 blocks Xoo-induced HR in N. benthamiana when pre-infiltrated or co-infiltrated, but not when post-infiltrated at 4 h after Xoo inoculation. This suppression by A. tumefaciens is local and highly efficient to Xoo. The HR-inhibiting efficiency of A. tumefaciens is strain dependent. Strain C58C1 has almost no effect on Xoo-induced HR, whereas strains GV3101, EHA105 and LBA4404 nearly completely block HR formation. Intriguingly, these three HR-inhibiting strains employ different strategies to repress HR. Strain GV3101 displays strong antibiotic activity and thus suppresses Xoo growth. Comparison of the genotype and Xoo antibiosis activity of wild-type A. tumefaciens strain C58 and a set of C58-derived strains reveals that this Xoo antibiosis activity of A. tumefaciens is negatively, but not solely, regulated by the transferred-DNA (T-DNA) of the Ti plasmid pTiC58. Unlike GV3101, strains LBA4404 and EHA105 exhibit no significant antibiotic effect on Xoo, but rather abolish hydrogen peroxide accumulation. In addition, expression assays indicate that strains LBA4404 and EHA105 may inhibit Xoo-induced HR by suppression of the expression of Xoo type III secretion system (T3SS) effector genes hpa1 and hrpD6. Collectively, our results unveil the multiple levels of effects of A. tumefaciens on Xoo in N. benthamiana and provide insights into the molecular mechanisms underlying the bacterial antibiosis of A. tumefaciens and the non-host resistance induced by Xoo.

Phi Class of Glutathione S-transferase Gene Superfamily Widely Exists in Nonplant Taxonomic Groups.

Glutathione S-transferases (GSTs) constitute a superfamily of enzymes involved in detoxification of noxious compounds and protection against oxidative damage. GST class Phi (GSTF), one of the important classes of plant GSTs, has long been considered as plant specific but was recently found in basidiomycete fungi. However, the range of nonplant taxonomic groups containing GSTFs remains unknown. In this study, the distribution and phylogenetic relationships of nonplant GSTFs were investigated. We identified GSTFs in ascomycete fungi, myxobacteria, and protists Naegleria gruberi and Aureococcus anophagefferens. GSTF occurrence in these bacteria and protists correlated with their genome sizes and habitats. While this link was missing across ascomycetes, the distribution and abundance of GSTFs among ascomycete genomes could be associated with their lifestyles to some extent. Sequence comparison, gene structure, and phylogenetic analyses indicated divergence among nonplant GSTFs, suggesting polyphyletic origins during evolution. Furthermore, in silico prediction of functional partners suggested functional diversification among nonplant GSTFs.

Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance.

The cyclic nucleotide gated channel (CNGC) is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly, widely but differently responsive to diverse stimuli. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca(2+) signaling genes including SlCaMs, SlCDPKs, and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca(2+) signaling.

Genome-wide identification and functional analyses of calmodulin genes in Solanaceous species.

BACKGROUND: Calmodulin (CaM) is a major calcium sensor in all eukaryotes. It binds calcium and modulates the activity of a wide range of downstream proteins in response to calcium signals. However, little is known about the CaM gene family in Solanaceous species, including the economically important species, tomato (Solanum lycopersicum), and the gene silencing model plant, Nicotiana benthamiana. Moreover, the potential function of CaM in plant disease resistance remains largely unclear. RESULTS: We performed genome-wide identification of CaM gene families in Solanaceous species. Employing bioinformatics approaches, multiple full-length CaM genes were identified from tomato, N. benthamiana and potato (S. tuberosum) genomes, with tomato having 6 CaM genes, N. benthamiana having 7 CaM genes, and potato having 4 CaM genes. Sequence comparison analyses showed that three tomato genes, SlCaM3/4/5, two potato genes StCaM2/3, and two sets of N. benthamiana genes, NbCaM1/2/3/4 and NbCaM5/6, encode identical CaM proteins, yet the genes contain different intron/exon organization and are located on different chromosomes. Further sequence comparisons and gene structural and phylogenetic analyses reveal that Solanaceous species gained a new group of CaM genes during evolution. These new CaM genes are unusual in that they contain three introns in contrast to only a single intron typical of known CaM genes in plants. The tomato CaM (SlCaM) genes were found to be expressed in all organs. Prediction of cis-acting elements in 5' upstream sequences and expression analyses demonstrated that SlCaM genes have potential to be highly responsive to a variety of biotic and abiotic stimuli. Additionally, silencing of SlCaM2 and SlCaM6 altered expression of a set of signaling and defense-related genes and resulted in significantly lower resistance to Tobacco rattle virus and the oomycete pathogen, Pythium aphanidermatum. CONCLUSIONS: The CaM gene families in the Solanaceous species tomato, N. benthamiana and potato were identified through a genome-wide analysis. All three plant species harbor a small set of genes that encode identical CaM proteins, which may manifest a strategy of plants to retain redundancy or enhanced quantitative gene function. In addition, Solanaceous species have evolved one new group of CaM genes during evolution. CaM genes play important roles in plant disease resistance to a variety of pathogens.

Identification of genes required for nonhost resistance to Xanthomonas oryzae pv. oryzae reveals novel signaling components.

BACKGROUND: Nonhost resistance is a generalized, durable, broad-spectrum resistance exhibited by plant species to a wide variety of microbial pathogens. Although nonhost resistance is an attractive breeding strategy, the molecular basis of this form of resistance remains unclear for many plant-microbe pathosystems, including interactions with the bacterial pathogen of rice, Xanthomonas oryzae pv. oryzae (Xoo). METHODS AND FINDINGS: Virus-induced gene silencing (VIGS) and an assay to detect the hypersensitive response (HR) were used to screen for genes required for nonhost resistance to Xoo in N. benthamiana. When infiltrated with Xoo strain YN-1, N. benthamiana plants exhibited a strong necrosis within 24 h and produced a large amount of H(2)O(2) in the infiltrated area. Expression of HR- and defense-related genes was induced, whereas bacterial numbers dramatically decreased during necrosis. VIGS of 45 ACE (Avr/Cf-elicited) genes revealed identified seven genes required for nonhost resistance to Xoo in N. benthamiana. The seven genes encoded a calreticulin protein (ACE35), an ERF transcriptional factor (ACE43), a novel Solanaceous protein (ACE80), a hydrolase (ACE117), a peroxidase (ACE175) and two proteins with unknown function (ACE95 and ACE112). The results indicate that oxidative burst and calcium-dependent signaling pathways play an important role in nonhost resistance to Xoo. VIGS analysis further revealed that ACE35, ACE80, ACE95 and ACE175, but not the other three ACE genes, interfered with the Cf-4/Avr4-dependent HR. CONCLUSIONS/SIGNIFICANCE: N. benthamiana plants inoculated with Xoo respond by rapidly eliciting an HR and nonhost resistance. The oxidative burst and other signaling pathways are pivotal in Xoo-N. benthamiana nonhost resistance, and genes involved in this response partially overlap with those involved in Cf/Avr4-dependent HR. The seven genes required for N. benthamiana-mediated resistance to Xoo provide a basis for further dissecting the molecular mechanism of nonhost resistance.

Identification of genes required for Cf-dependent hypersensitive cell death by combined proteomic and RNA interfering analyses.

Identification of hypersensitive cell death (HCD) regulators is essential to dissect the molecular mechanisms underlying plant disease resistance. In this study, combined proteomic and RNA interfering (RNAi) analyses were employed to identify genes required for the HCD conferred by the tomato resistance gene Cf-4 and the Cladosporium fulvum avirulence gene Avr4. Forty-nine proteins differentially expressed in the tomato seedlings mounting and those not mounting Cf-4/Avr4-dependent HCD were identified through proteomic analysis. Among them were a variety of defence-related proteins including a cysteine protease, Pip1, an operative target of another C. fulvum effector, Avr2. Additionally, glutathione-mediated antioxidation is a major response to Cf-4/Avr4-dependent HCD. Functional analysis through tobacco rattle virus-induced gene silencing and transient RNAi assays of the chosen 16 differentially expressed proteins revealed that seven genes, which encode Pip1 homologue NbPip1, a SIPK type MAP kinase Nbf4, an asparagine synthetase NbAsn, a trypsin inhibitor LeMir-like protein NbMir, a small GTP-binding protein, a late embryogenesis-like protein, and an ASR4-like protein, were required for Cf-4/Avr4-dependent HCD. Furthermore, the former four genes were essential for Cf-9/Avr9-dependent HCD; NbPip1, NbAsn, and NbMir, but not Nbf4, affected a nonadaptive bacterial pathogen Xanthomonas oryzae pv. oryzae-induced HCD in Nicotiana benthamiana. These data demonstrate that Pip1 and LeMir may play a general role in HCD and plant immunity and that the application of combined proteomic and RNA interfering analyses is an efficient strategy to identify genes required for HCD, disease resistance, and probably other biological processes in plants.

Cladosporium fulvum CfHNNI1 induces hypersensitive necrosis, defence gene expression and disease resistance in both host and nonhost plants.

Nonhost resistance as a durable and broad-spectrum defence strategy is of great potential for agricultural applications. We have previously isolated a cDNA showing homology with genes encoding bZIP transcription factors from tomato leaf mould pathogen Cladosporium fulvum. Upon expression, the cDNA results in necrosis in C. fulvum host tomato and nonhost tobacco plants and is thus named CfHNNI1 (for C . f ulvum host and nonhost plant necrosis inducer 1). In the present study we report the induction of necrosis in a variety of nonhost plant species belonging to three families by the transient in planta expression of CfHNNI1 using virus-based vectors. Additionally, transient expression of CfHNNI1 also induced expression of the HR marker gene LeHSR203 and greatly reduced the accumulation of recombinant Potato virus X. Stable CfHNNI1 transgenic tobacco plants were generated in which the expression of CfHNNI1 is under the control of the pathogen-inducible hsr203J promoter. When infected with the oomycetes pathogen Phytophthora parasitica var. nicotianae, these transgenic plants manifested enhanced expression of CfHNNI1 and subsequent accumulation of CfHNNI1 protein, resulting in high expression of the HSR203J and PR genes, and strong resistance to the pathogen. The CfHNNI1 transgenic plants also exhibited induced resistance to Pseudomonas syringae pv. tabaci and Tobacco mosaic virus. Furthermore, CfHNNI1 was highly expressed and the protein was translocated into plant cells during the incompatible interactions between C. fulvum and host and nonhost plants. Our results demonstrate that CfHNNI1 is a potential general elicitor of hypersensitive response and nonhost resistance.

[Genomic characterization of tomato yellow leaf curl China virus and its associated satellite DNA infecting tobacco in Guangxi].

The virus isolates G102 and G103 were collected from tobacco showing leaf curl symptoms in Jingxi, Guangxi Province. A 0.5kb fragment was obtained by PCR using primers specific to geminivirus genome. The nucleotide sequence identity of the partial DNA-A sequence between the two isolates was over 99%. The complete DNA-A sequence of G102 was determined to be 2728 nucleotides. Comparisons showed that the DNA-A of G102 had the highest sequence identity (96.5%) with that of Tomato yellow leaf curl China virus (TYLCCNV). Further studies showed that both G102 and G103 were associated with satellite DNA molecules (DNAbeta). Sequence analysis revealed that DNAbeta of G102 and G103 contained 1342nt and they shared the highest sequence identities (92.9% and 93.4%, respectively) with that of TYLCCNV. This is the first report that TYLCCNV isolates in Guangxi were also associated with satellite DNA molecules. The previously results demonstrated that all 25 TYLCCNV isolates collected in Yunnan province were associated with DNA beta molecules. The finding that TYLCCNV isolates collected in Guangxi province were also associated with DNA beta molecules gives further evidence that TYLCCNV isolates are associated with DNA beta molecules in nature.