RESUMO
Inflammatory bowel diseases (IBD), including Crohn's disease and ulcerative colitis, are chronic disorders characterized by dysregulated immune response and persistent inflammation. Recent studies suggest that bile acid receptors, particularly GPBAR1, and the transcription factor RORγt play critical roles in modulating intestinal inflammation. This study evaluates the therapeutic potential of PBT002, a dual GPBAR1 agonist and RORγt inverse agonist, in IBD models. The effects of PBT002 were assessed through in vitro and in vivo experiments. Macrophages and T lymphocytes obtained from the buffy coat were exposed to PBT002 to evaluate its immunomodulatory activity. The beneficial effects in vivo were evaluated in mouse models of colitis induced by TNBS, DSS or DSS + IL-23 using also a Gpbar1 knock-out male mice. PBT002 exhibited an EC50 of 1.2⯵M for GPBAR1 and an IC50 of 2.8⯵M for RORγt. In in vitro, PBT002 modulated macrophage polarization towards an anti-inflammatory M2 phenotype and reduced Th17 cell markers while increasing Treg markers. In the TNBS-induced colitis model, PBT002 reduced weight loss, CDAI, and colon damage, while it modulated cytokine gene expression towards an anti-inflammatory profile. In GPBAR1-/-, the anti-inflammatory effects of PBT002 were attenuated, indicating partial GPBAR1 dependence. RNA sequencing revealed significant modulation of inflammatory pathways by PBT002. In DSS+IL-23 induced colitis, PBT002 mitigated disease exacerbation, reducing pro-inflammatory cytokine levels and immune cell infiltration. In conclusion, PBT002, a GPBAR1 agonist and RORγt inverse agonist, modulates both the innate and adaptive immune responses to reduce inflammation and disease severity in models of IBD.
Assuntos
Colite , Doenças Inflamatórias Intestinais , Macrófagos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Membro 3 do Grupo F da Subfamília 1 de Receptores Nucleares , Receptores Acoplados a Proteínas G , Animais , Membro 3 do Grupo F da Subfamília 1 de Receptores Nucleares/agonistas , Membro 3 do Grupo F da Subfamília 1 de Receptores Nucleares/genética , Masculino , Doenças Inflamatórias Intestinais/tratamento farmacológico , Doenças Inflamatórias Intestinais/imunologia , Receptores Acoplados a Proteínas G/agonistas , Receptores Acoplados a Proteínas G/genética , Camundongos , Colite/tratamento farmacológico , Colite/induzido quimicamente , Colite/imunologia , Macrófagos/efeitos dos fármacos , Macrófagos/imunologia , Macrófagos/metabolismo , Anti-Inflamatórios/farmacologia , Anti-Inflamatórios/uso terapêutico , Humanos , Agonismo Inverso de Drogas , Células Th17/efeitos dos fármacos , Células Th17/imunologia , Sulfato de Dextrana , Modelos Animais de DoençasRESUMO
Bile acids are steroids formed at the interface of host metabolism and intestinal microbiota. While primary bile acids are generated in the liver from cholesterol metabolism, secondary bile acids represent the products of microbial enzymes. Close to 100 different enzymatic modifications of bile acids structures occur in the human intestine and clinically guided metagenomic and metabolomic analyses have led to the identification of an extraordinary number of novel metabolites. These chemical mediators make an essential contribution to the composition and function of the postbiota, participating to the bidirectional communications of the intestinal microbiota with the host and contributing to the architecture of intestinal-liver and -brain and -endocrine axes. Bile acids exert their function by binding to a group of cell membrane and nuclear receptors collectively known as bile acid-regulated receptors (BARRs), expressed in monocytes, tissue-resident macrophages, CD4+ T effector cells, including Th17, T regulatory cells, dendritic cells and type 3 of intestinal lymphoid cells and NKT cells, highlighting their role in immune regulation. In this review we report on how bile acids and their metabolitesmodulate the immune system in inflammations and cancers and could be exploiting for developing novel therapeutic approaches in these disorders.
Assuntos
Ácidos e Sais Biliares , Humanos , Ácidos e Sais Biliares/metabolismo , Ácidos e Sais Biliares/imunologia , Animais , Microbioma Gastrointestinal/imunologiaRESUMO
The leukemia inhibitory factor (LIF) is member of interleukin (IL)-6 family of cytokines involved immune regulation, morphogenesis and oncogenesis. In cancer tissues, LIF binds a heterodimeric receptor (LIFR), formed by a LIFRß subunit and glycoprotein(gp)130, promoting epithelial mesenchymal transition and cell growth. Bile acids are cholesterol metabolites generated at the interface of host metabolism and the intestinal microbiota. Here we demonstrated that bile acids serve as endogenous antagonist to LIFR in oncogenesis. The tissue characterization of bile acids content in non-cancer and cancer biopsy pairs from gastric adenocarcinomas (GC) demonstrated that bile acids accumulate within cancer tissues, with glyco-deoxycholic acid (GDCA) functioning as negative regulator of LIFR expression. In patient-derived organoids (hPDOs) from GC patients, GDCA reverses LIF-induced stemness and proliferation. In summary, we have identified the secondary bile acids as the first endogenous antagonist to LIFR supporting a development of bile acid-based therapies in LIF-mediated oncogenesis.
Assuntos
Interleucina-6 , Receptores de Citocinas , Humanos , Carcinogênese , Fator Inibidor de Leucemia/metabolismo , Receptores de Citocinas/metabolismo , Receptores de OSM-LIFRESUMO
While patients with nonalcoholic fatty liver disease (NAFLD) are at increased risk to develop clinically meaningful cardiovascular diseases (CVD), there are no approved drug designed to target the liver and CVD component of NAFLD. GPBAR1, also known as TGR5, is a G protein coupled receptor for secondary bile acids. In this study we have investigated the effect of GPBAR1 activation by BAR501, a selective GPBAR1 agonist, in Apolipoprotein E deficient (ApoE-/-) mice fed a high fat diet and fructose (Western diet), a validated model of NAFLD-associated atherosclerosis. Using aortic samples from patients who underwent surgery for abdominal aneurism, and ex vivo experiments with endothelial cells and human macrophages, we were able to co-localize the expression of GPBAR1 in CD14+ and PECAM1+ cells. Similar findings were observed in the aortic plaques from ApoE-/- mice. Treating ApoE-/- mice with BAR501, 30 mg/kg for 14 weeks, attenuated the body weight gain while ameliorated the insulin sensitivity by increasing the plasma concentrations of GLP-1 and FGF15. Activation of GPBAR1 reduced the aorta thickness and severity of atherosclerotic lesions and decreased the amount of plaques macrophages. Treating ApoE-/- mice reshaped the aortic transcriptome promoting the expression of anti-inflammatory genes, including IL-10, as also confirmed by tSNE analysis of spleen-derived macrophages. Feeding ApoE-/- mice with BAR501 redirected the bile acid synthesis and the composition of the intestinal microbiota. In conclusion, GPBAR1 agonism attenuates systemic inflammation and improve metabolic profile in a genetic/dietetic model of atherosclerosis. BAR501 might be of utility in the treatment for NAFLD-related CVD.
Assuntos
Aterosclerose , Doenças Cardiovasculares , Hepatopatia Gordurosa não Alcoólica , Animais , Humanos , Camundongos , Apolipoproteínas E , Aterosclerose/tratamento farmacológico , Doenças Cardiovasculares/complicações , Modelos Animais de Doenças , Células Endoteliais , Inflamação/tratamento farmacológico , Inflamação/complicações , Camundongos Endogâmicos C57BL , Hepatopatia Gordurosa não Alcoólica/tratamento farmacológico , Hepatopatia Gordurosa não Alcoólica/etiologia , Receptores Acoplados a Proteínas G/genéticaRESUMO
BACKGROUND: Patients with nonalcoholic fatty liver disease are at increased risk to develop atherosclerotic cardiovascular diseases. FXR and GPBAR1 are 2 bile acid-activated receptors exploited in the treatment of nonalcoholic fatty liver disease: whether dual GPBAR1/FXR agonists synergize with statins in the treatment of the liver and cardiovascular components of nonalcoholic fatty liver disease is unknown. METHODS AND RESULTS: Investigations of human aortic samples obtained from patients who underwent surgery for aortic aneurysms and Gpbar1-/-, Fxr-/-, and dual Gpbar1-/-Fxr-/- mice demonstrated that GPBAR1 and FXR are expressed in the aortic wall and regulate endothelial cell/macrophage interactions. The expression of GPBAR1 in the human endothelium correlated with the expression of inflammatory biomarkers. Mice lacking Fxr and Gpbar1-/-/Fxr-/- display hypotension and aortic inflammation, along with altered intestinal permeability that deteriorates with age, and severe dysbiosis, along with dysregulated bile acid synthesis. Vasomotor activities of aortic rings were altered by Gpbar1 and Fxr gene ablation. In apolipoprotein E-/- and wild-type mice, BAR502, a dual GPBAR1/FXR agonist, alone or in combination with atorvastatin, reduced cholesterol and low-density lipoprotein plasma levels, mitigated the development of liver steatosis and aortic plaque formation, and shifted the polarization of circulating leukocytes toward an anti-inflammatory phenotype. BAR502/atorvastatin reversed intestinal dysbiosis and dysregulated bile acid synthesis, promoting a shift of bile acid pool composition toward FXR antagonists and GPBAR1 agonists. CONCLUSIONS: FXR and GPBAR1 maintain intestinal, liver, and cardiovascular homeostasis, and their therapeutic targeting with a dual GPBAR1/FXR ligand and atorvastatin holds potential in the treatment of liver and cardiovascular components of nonalcoholic fatty liver disease.
Assuntos
Ácidos e Sais Biliares , Inibidores de Hidroximetilglutaril-CoA Redutases , Hepatopatia Gordurosa não Alcoólica , Animais , Humanos , Camundongos , Atorvastatina/farmacologia , Atorvastatina/uso terapêutico , Ácidos e Sais Biliares/metabolismo , Disbiose/complicações , Disbiose/metabolismo , Proteínas de Ligação ao GTP/metabolismo , Inibidores de Hidroximetilglutaril-CoA Redutases/farmacologia , Inibidores de Hidroximetilglutaril-CoA Redutases/uso terapêutico , Fígado/metabolismo , Hepatopatia Gordurosa não Alcoólica/tratamento farmacológico , Hepatopatia Gordurosa não Alcoólica/genética , Receptores Acoplados a Proteínas G/metabolismoRESUMO
PURPOSE: The gastric adenocarcinoma (GC) represents the third cause of cancer-related mortality worldwide, and available therapeutic options remain sub-optimal. The Fibroblast growth factor receptors (FGFRs) are oncogenic transmembrane tyrosine kinase receptors. FGFR inhibitors have been approved for the treatment of various cancers and a STAT3-dependent regulation of FGFR4 has been documented in the H.pylori infected intestinal GC. Therefore, the modulation of FGFR4 might be useful for the treatment of GC. METHODS: To investigate wich factors could modulate FGFR4 signalling in GC, we employed RNA-seq analysis on GC patients biopsies, human patients derived organoids (PDOs) and cancer cell lines. RESULTS: We report that FGFR4 expression/function is regulated by the leukemia inhibitory factor (LIF) an IL-6 related oncogenic cytokine, in JAK1/STAT3 dependent manner. The transcriptomic analysis revealed a direct correlation between the expression of LIFR and FGFR4 in the tissue of an exploratory cohort of 31 GC and confirmed these findings by two external validation cohorts of GC. A LIFR inhibitor (LIR-201) abrogates STAT3 phosphorylation induced by LIF as well as recruitment of pSTAT3 to the promoter of FGFR4. Furthermore, inhibition of FGFR4 by roblitinib or siRNA abrogates STAT3 phosphorylation and oncogentic effects of LIF in GC cells, indicating that FGFR4 is a downstream target of LIF/LIFR complex. Treating cells with LIR-201 abrogates oncogenic potential of FGF19, the physiological ligand of FGFR4. CONCLUSIONS: Together these data unreveal a previously unregnized regulatory mechanism of FGFR4 by LIF/LIFR and demonstrate that LIF and FGF19 converge on the regulation of oncogenic STAT3 in GC cells.
RESUMO
The farnesoid-x-receptor (FXR) and the G protein bile acid activated receptor (GPBAR)1 are two bile acid activated receptors highly expressed in entero-hepatic, immune, adipose and cardiovascular tissues. FXR and GPBAR1 are clinically validated targets in the treatment of metabolic disorders and FXR agonists are currently trialled in patients with non-alcoholic steato-hepatitis (NASH). Results of these trials, however, have raised concerns over safety and efficacy of selective FXR ligands suggesting that the development of novel agent designed to impact on multiple targets might have utility in the treatment of complex, multigenic, disorders. Harnessing on FXR and GPBAR1 agonists, several novel hybrid molecules have been developed, including dual FXR and GPBAR1 agonists and antagonists, while exploiting the flexibility of FXR agonists toward other nuclear receptors, dual FXR and peroxisome proliferators-activated receptors (PPARs) and liver-X-receptors (LXRs) and Pregnane-X-receptor (PXR) agonists have been reported. In addition, modifications of FXR agonists has led to the discovery of dual FXR agonists and fatty acid binding protein (FABP)1 and Leukotriene B4 hydrolase (LTB4H) inhibitors. The GPBAR1 binding site has also proven flexible to accommodate hybrid molecules functioning as GPBAR1 agonist and cysteinyl leukotriene receptor (CYSLTR)1 antagonists, as well as dual GPBAR1 agonists and retinoid-related orphan receptor (ROR)γt antagonists, dual GPBAR1 agonist and LXR antagonists and dual GPBAR1 agonists endowed with inhibitory activity on dipeptidyl peptidase 4 (DPP4). In this review we have revised the current landscape of FXR and GPBAR1 based hybrid agents focusing on their utility in the treatment of metabolic associated liver disorders.
Assuntos
Ácidos e Sais Biliares , Doenças Metabólicas , Humanos , Receptores Acoplados a Proteínas G/metabolismo , Receptores Citoplasmáticos e Nucleares , Fígado/metabolismo , Doenças Metabólicas/tratamento farmacológicoRESUMO
Introduction: The leukemia inhibitory factor (LIF), is a cytokine belonging to IL-6 family, whose overexpression correlate with poor prognosis in cancer patients, including pancreatic ductal adenocarcinoma (PDAC). LIF signaling is mediate by its binding to the heterodimeric LIF receptor (LIFR) complex formed by the LIFR receptor and Gp130, leading to JAK1/STAT3 activation. Bile acids are steroid that modulates the expression/activity of membrane and nuclear receptors, including the Farnesoid-X-Receptor (FXR) and G Protein Bile Acid Activated Receptor (GPBAR1). Methods: Herein we have investigated whether ligands to FXR and GPBAR1 modulate LIF/LIFR pathway in PDAC cells and whether these receptors are expressed in human neoplastic tissues. Results: The transcriptome analysis of a cohort of PDCA patients revealed that expression of LIF and LIFR is increased in the neoplastic tissue in comparison to paired non-neoplastic tissues. By in vitro assay we found that both primary and secondary bile acids exert a weak antagonistic effect on LIF/LIFR signaling. In contrast, BAR502 a non-bile acid steroidal dual FXR and GPBAR1 ligand, potently inhibits binding of LIF to LIFR with an IC50 of 3.8 µM. Discussion: BAR502 reverses the pattern LIF-induced in a FXR and GPBAR1 independent manner, suggesting a potential role for BAR502 in the treatment of LIFR overexpressing-PDAC.
RESUMO
Inflammatory bowel disease (IBD) is a chronic and relapsing disease caused by a dysregulated immune response to host intestinal microbiota that occurs in genetically predisposed individuals. IBD encompasses two major clinical entities: ulcerative colitis (UC), limited to the colonic mucosa, and Crohn's disease (CD), which might affect any segment of the gastrointestinal tract. Despite the prevalence of IBD increasing worldwide, therapy remains suboptimal, largely because of the variability of causative mechanisms, raising the need to develop individualized therapeutic approaches targeted to each individual patient. In this context, patients-derived intestinal organoids represent an effective tool for advancing our understanding of IBD's pathogenesis. Organoid 3D culture systems offer a unique model for dissecting epithelial mechanisms involved IBDs and testing individualized therapy, although the lack of a functional immune system and a microbiota, two driving components of the IBD pathogenesis, represent a major barrier to their exploitation in clinical medicine. In this review, we have examined how to improve the translational utility of intestinal organoids in IBD and how co-cultures of 3D or 2D organoids and immune cells and/or intestinal microbiota might help to overcome these limitations.
Assuntos
Colite Ulcerativa , Doença de Crohn , Doenças Inflamatórias Intestinais , Humanos , Intestinos/patologia , Organoides/patologiaRESUMO
BACKGROUND AND AIM: Drug-induced liver injury (DILI) is a common disorder that involves both direct liver cell toxicity and immune activation. The bile acid receptor, G-protein-coupled bile acid receptor 1 (GPBAR1; Takeda G-protein-coupled receptor 5 [TGR5]), and cysteinyl leukotriene receptor (CYSLTR) 1 are G-protein-coupled receptors activated by bile acids and leukotrienes, exerting opposite effects on cell-to-cell adhesion, inflammation, and immune cell activation. To investigate whether GPBAR1 and CYSLTR1 mutually interact in the development of DILI, we developed an orally active small molecule, CHIN117, that functions as a GPBAR1 agonist and CYSLTR1 antagonist. APPROACH AND RESULTS: RNA-sequencing analysis of liver explants showed that acetaminophen (APAP) intoxication positively modulates the leukotriene pathway, CYSLTR1, 5-lipoxygenase, and 5-lipoxygenase activating protein, whereas GPBAR1 gene expression was unchanged. In mice, acute liver injury induced by orally dosing APAP (500 mg/kg) was severely exacerbated by Gpbar1 gene ablation and attenuated by anti-Cysltr1 small interfering RNA pretreatment. Therapeutic dosing of wild-type mice with CHIN117 reversed the liver damage caused by APAP and modulated up to 1300 genes, including 38 chemokines and receptors, that were not shared by dosing mice with a selective GPBAR1 agonist or CYSLTR1 antagonist. Coexpression of the two receptors was detected in liver sinusoidal endothelial cells (LSECs), monocytes, and Kupffer cells, whereas combinatorial modulation of CYSLTR1 and GPBAR1 potently reversed LSEC/monocyte interactions. CHIN117 reversed liver damage and liver fibrosis in mice administered CCl 4 . CONCLUSIONS: By genetic and pharmacological approaches, we demonstrated that GPBAR1 and CYSLTR1 mutually interact in the development of DILI. A combinatorial approach designed to activate GPBAR1 while inhibiting CYSLTR1 reverses liver injury in models of DILI.
Assuntos
Doença Hepática Induzida por Substâncias e Drogas , Hepatopatias , Camundongos , Animais , Ácidos e Sais Biliares/metabolismo , Araquidonato 5-Lipoxigenase/metabolismo , Células Endoteliais/metabolismo , Acetaminofen/toxicidade , Receptores Acoplados a Proteínas G/metabolismo , Hepatopatias/metabolismo , Doença Hepática Induzida por Substâncias e Drogas/etiologia , Doença Hepática Induzida por Substâncias e Drogas/metabolismo , Leucotrienos/metabolismo , Proteínas de Ligação ao GTP/metabolismoRESUMO
Pancreatic cancer is a leading cause of cancer mortality and is projected to become the second-most common cause of cancer mortality in the next decade. While gene-wide association studies and next generation sequencing analyses have identified molecular patterns and transcriptome profiles with prognostic relevance, therapeutic opportunities remain limited. Among the genes that are upregulated in pancreatic ductal adenocarcinomas (PDAC), the leukaemia inhibitory factor (LIF), a cytokine belonging to IL-6 family, has emerged as potential therapeutic candidate. LIF is aberrantly secreted by tumour cells and promotes tumour progression in pancreatic and other solid tumours through aberrant activation of the LIF receptor (LIFR) and downstream signalling that involves the JAK1/STAT3 pathway. Since there are no LIFR antagonists available for clinical use, we developed an in silico strategy to identify potential LIFR antagonists and drug repositioning with regard to LIFR antagonists. The results of these studies allowed the identification of mifepristone, a progesterone/glucocorticoid antagonist, clinically used in medical abortion, as a potent LIFR antagonist. Computational studies revealed that mifepristone binding partially overlapped the LIFR binding site. LIF and LIFR are expressed by human PDAC tissues and PDAC cell lines, including MIA-PaCa-2 and PANC-1 cells. Exposure of these cell lines to mifepristone reverses cell proliferation, migration and epithelial mesenchymal transition induced by LIF in a concentration-dependent manner. Mifepristone inhibits LIFR signalling and reverses STAT3 phosphorylation induced by LIF. Together, these data support the repositioning of mifepristone as a potential therapeutic agent in the treatment of PDAC.
Assuntos
Adenocarcinoma , Carcinoma Ductal Pancreático , Neoplasias Pancreáticas , Gravidez , Feminino , Humanos , Receptores de OSM-LIF/genética , Mifepristona/farmacologia , Mifepristona/uso terapêutico , Neoplasias Pancreáticas/tratamento farmacológico , Neoplasias Pancreáticas/genética , Neoplasias Pancreáticas/patologia , Adenocarcinoma/tratamento farmacológico , Adenocarcinoma/genética , Reposicionamento de Medicamentos , Carcinoma Ductal Pancreático/patologia , Antagonistas de Hormônios/farmacologia , Neoplasias PancreáticasRESUMO
Gastric cancer (GC) is the third cause of cancer-related mortality worldwide. Nevertheless, because GC screening programs are not cost-effective, most patients receive diagnosis in the advanced stages, when surgical options are limited. Peritoneal dissemination occurs in approximately one-third of patients with GC at the diagnosis and is a strong predictor of poor outcome. Despite the clinical relevance, biological and molecular mechanisms underlying the development of peritoneal metastasis in GC remain poorly defined. Here, we report results of a high-throughput sequencing of transcriptome expression in paired samples of non-neoplastic and neoplastic gastric samples from 31 patients with GC with or without peritoneal carcinomatosis. The RNA-seq analysis led to the discovery of a group of highly upregulated or downregulated genes, including the leukemia inhibitory factor receptor (LIFR) and one cut domain family member 2 (ONECUT2) that were differentially modulated in patients with peritoneal disease in comparison with patients without peritoneal involvement. Both LIFR and ONECUT2 predicted survival at univariate statistical analysis. LIFR and its major ligand LIF belong to the interleukin-6 (IL-6) cytokine family and have a central role in immune system regulation, carcinogenesis, and dissemination in several human cancers. To confirm the mechanistic role of the LIF/LIFR pathway in promoting GC progression, GC cell lines were challenged in vitro with LIF and a LIFR inhibitor. Among several GC cell lines, MKN45 cells displayed the higher expression of the receptor, and their exposure to LIF promotes a concentration-dependent proliferation and epithelial-mesenchymal transition (EMT), as shown by modulation of relative expression of E-cadherin/vimentin along with JAK and STAT3 phosphorylation and acquisition of a migratory phenotype. Furthermore, exposure to LIF promoted the adhesion of MKN45 cells to the peritoneum in an ex vivo assay. These effects were reversed by the pharmacological blockade of LIFR signaling. Together, these data suggest that LIFR might have a major role in promoting disease progression and peritoneal dissemination in patients with GC and that development of LIF/LIFR inhibitors might have a role in the treatment of GC.
RESUMO
Nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) are two highly prevalent human diseases caused by excessive fat deposition in the liver. Although multiple approaches have been suggested, NAFLD/NASH remains an unmet clinical need. Here, we report the discovery of a novel class of hybrid molecules designed to function as cysteinyl leukotriene receptor 1 (CysLT1R) antagonists and G protein bile acid receptor 1 (GPBAR1/TGR5) agonists for the treatment of NAFLD/NASH. The most potent of these compounds generated by harnessing the scaffold of the previously described CystLT1R antagonists showed efficacy in reversing liver histopathology features in a preclinical model of NASH, reshaping the liver transcriptome and the lipid and energy metabolism in the liver and adipose tissues. In summary, the present study described a novel orally active dual CysLT1R antagonist/GPBAR1 agonist that effectively protects against the development of NAFLD/NASH, showing promise for further development.
RESUMO
BACKGROUND & AIMS: ACE2, a carboxypeptidase that generates Ang-(1-7) from Ang II, is highly expressed in the lung, small intestine and colon. GPBAR1, is a G protein bile acid receptor that promotes the release of the insulinotropic factor glucagon-like peptide (GLP)-1 and attenuates intestinal inflammation. METHODS: We investigated the expression of ACE2, GLP-1 and GPBAR1 in two cohorts of Crohn's disease (CD) patients and three mouse models of colitis and Gpbar1-/- mice. Activation of GPBAR1 in these models and in vitro was achieved by BAR501, a selective GPBAR1 agonist. RESULTS: In IBD patients, ACE2 mRNA expression was regulated in a site-specific manner in response to inflammation. While expression of ileal ACE2 mRNA was reduced, the colon expression was induced. Colon expression of ACE2 mRNA in IBD correlated with expression of TNF-α and GPBAR1. A positive correlation occurred between GCG and GPBAR1 in human samples and animal models of colitis. In these models, ACE2 mRNA expression was further upregulated by GPABR1 agonism and reversed by exendin-3, a GLP-1 receptor antagonist. In in vitro studies, liraglutide, a GLP-1 analogue, increased the expression of ACE2 in colon epithelial cells/macrophages co-cultures. CONCLUSIONS: ACE2 mRNA expression in the colon of IBD patients and rodent models of colitis is regulated in a TNF-α- and GLP-1-dependent manner. We have identified a GPBAR1/GLP-1 mechanism as a positive modulator of ACE2.
Assuntos
Enzima de Conversão de Angiotensina 2 , Colite , Doença de Crohn , Peptídeo 1 Semelhante ao Glucagon , Receptores Acoplados a Proteínas G , Enzima de Conversão de Angiotensina 2/metabolismo , Animais , Ácidos e Sais Biliares , Peptídeo 1 Semelhante ao Glucagon/metabolismo , Humanos , Inflamação , Camundongos , RNA Mensageiro/genética , Receptores Acoplados a Proteínas G/metabolismo , Fator de Necrose Tumoral alfaRESUMO
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.
Assuntos
DNA/química , Desoxiadenosinas/química , Quadruplex G , Oligonucleotídeos/química , Telômero , Catálise , Humanos , EstereoisomerismoRESUMO
G-protein-coupled receptors (GPCRs) are the molecular target of 40% of marketed drugs and the most investigated structures to develop novel therapeutics. Different members of the GPCRs superfamily can modulate the same cellular process acting on diverse pathways, thus representing an attractive opportunity to achieve multitarget drugs with synergic pharmacological effects. Here, we present a series of compounds with dual activity toward cysteinyl leukotriene receptor 1 (CysLT1R) and G-protein-coupled bile acid receptor 1 (GPBAR1). They are derivatives of REV5901âthe first reported dual compoundâwith therapeutic potential in the treatment of colitis and other inflammatory processes. We report the binding mode of the most active compounds in the two GPCRs, revealing unprecedented structural basis for future drug design studies, including the presence of a polar group opportunely spaced from an aromatic ring in the ligand to interact with Arg792.60 of CysLT1R and achieve dual activity.
Assuntos
Anti-Inflamatórios não Esteroides/química , Anti-Inflamatórios não Esteroides/farmacologia , Receptores Acoplados a Proteínas G/efeitos dos fármacos , Receptores de Leucotrienos/efeitos dos fármacos , Animais , Colite/tratamento farmacológico , Humanos , Leucotrieno D4/farmacologia , Macrófagos/efeitos dos fármacos , Camundongos , Simulação de Acoplamento Molecular , Ligação Proteica , Células RAW 264.7 , Receptores Acoplados a Proteínas G/metabolismo , Receptores de Leucotrienos/metabolismo , Relação Estrutura-AtividadeRESUMO
Gastric cancer is the fifth most common malignancy but the third leading cause of cancer-associated mortality worldwide. Therapy for gastric cancer remain largely suboptimal making the identification of novel therapeutic targets an urgent medical need. In the present study we have carried out a high-throughput sequencing of transcriptome expression in patients with gastric cancers. Twenty-four patients, among a series of 53, who underwent an attempt of curative surgery for gastric cancers in a single center, were enrolled. Patients were sub-grouped according to their histopathology into diffuse and intestinal types, and the transcriptome of the two subgroups assessed by RNAseq analysis and compared to the normal gastric mucosa. The results of this investigation demonstrated that the two histopathology phenotypes express two different patterns of gene expression. A total of 2,064 transcripts were differentially expressed between neoplastic and non-neoplastic tissues: 772 were specific for the intestinal type and 407 for the diffuse type. Only 885 transcripts were simultaneously differentially expressed by both tumors. The per pathway analysis demonstrated an enrichment of extracellular matrix and immune dysfunction in the intestinal type including CXCR2, CXCR1, FPR2, CARD14, EFNA2, AQ9, TRIP13, KLK11 and GHRL. At the univariate analysis reduced levels AQP9 was found to be a negative predictor of 4 years survival. In the diffuse type low levels CXCR2 and high levels of CARD14 mRNA were negative predictors of 4 years survival. In summary, we have identified a group of genes differentially regulated in the intestinal and diffuse histotypes of gastric cancers with AQP9, CARD14 and CXCR2 impacting on patients' prognosis, although CXCR2 is the only factor independently impacting overall survival.
RESUMO
The severe acute respiratory syndrome (SARS)-CoV-2 is the pathogenetic agent of Corona Virus Induced Disease (COVID)19. The virus enters the human cells after binding to the angiotensin converting enzyme (ACE)2 receptor in target tissues. ACE2 expression is induced in response to inflammation. The colon expression of ACE2 is upregulated in patients with inflammatory bowel disease (IBD), highlighting a potential risk of intestinal inflammation in promoting viral entry in the human body. Because mechanisms that regulate ACE2 expression in the intestine are poorly understood and there is a need of anti-SARS-CoV-2 therapies, we have settled to investigate whether natural flavonoids might regulate the expression of Ace2 in intestinal models of inflammation. The results of these studies demonstrated that pelargonidin activates the Aryl hydrocarbon Receptor (AHR) in vitro and reverses intestinal inflammation caused by chronic exposure to high fat diet or to the intestinal braking-barrier agent TNBS in a AhR-dependent manner. In these two models, development of colon inflammation associated with upregulation of Ace2 mRNA expression. Colon levels of Ace2 mRNA were directly correlated with Tnf-α mRNA levels. Molecular docking studies suggested that pelargonidin binds a fatty acid binding pocket on the receptor binding domain of SARS-CoV-2 Spike protein. In vitro studies demonstrated that pelargonidin significantly reduces the binding of SARS-CoV-2 Spike protein to ACE2 and reduces the SARS-CoV-2 replication in a concentration-dependent manner. In summary, we have provided evidence that a natural flavonoid might hold potential in reducing intestinal inflammation and ACE2 induction in the inflamed colon in a AhR-dependent manner.
Assuntos
Enzima de Conversão de Angiotensina 2/biossíntese , Antocianinas/farmacologia , Descoberta de Drogas/métodos , Regulação Enzimológica da Expressão Gênica , Receptores de Hidrocarboneto Arílico/agonistas , SARS-CoV-2/efeitos dos fármacos , Enzima de Conversão de Angiotensina 2/antagonistas & inibidores , Enzima de Conversão de Angiotensina 2/genética , Animais , Antocianinas/química , Chlorocebus aethiops , Relação Dose-Resposta a Droga , Células Hep G2 , Humanos , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Camundongos Transgênicos , Estrutura Secundária de Proteína , Estrutura Terciária de Proteína , Receptores de Hidrocarboneto Arílico/metabolismo , SARS-CoV-2/metabolismo , Células VeroRESUMO
Nonnutritive sweeteners (NNSs) are widely employed as dietary substitutes for classical sugars thanks to their safety profile and low toxicity. In this study, a re-evaluation of the biological effects of steviol (1), the main metabolite from Stevia rebaudiana glycosides, was performed using the Inverse Virtual Screening (IVS) target fishing computational approach. Starting from well-known pharmacological properties of Stevia rebaudiana glycosides, this computational tool was employed for predicting the putative interacting targets of 1 and, afterwards, of its five synthetic ester derivatives 2-6, accounting a large panel of proteins involved in cancer and inflammation events. Applying this methodology, the farnesoid X receptor (FXR) was identified as the putative target partner of 1-6. The predicted ligand-protein interactions were corroborated by transactivation assays, specifically disclosing the agonistic activity of 1 and the antagonistic activities of 2-6 on FXR. The reported results highlight the feasibility of IVS as a fast and potent tool for predicting the interacting targets of query compounds, addressing the re-evaluation of their bioactivity. In light of the obtained results, the presumably safe profile of known compounds, such as the case of steviol (1), is critically discussed.
Assuntos
Produtos Biológicos/farmacologia , Diterpenos do Tipo Caurano/farmacologia , Glicosídeos/farmacologia , Receptores Citoplasmáticos e Nucleares/agonistas , Stevia/química , Produtos Biológicos/química , Produtos Biológicos/isolamento & purificação , Diterpenos do Tipo Caurano/química , Diterpenos do Tipo Caurano/isolamento & purificação , Relação Dose-Resposta a Droga , Avaliação Pré-Clínica de Medicamentos , Glicosídeos/química , Glicosídeos/isolamento & purificação , Células Hep G2 , Humanos , Conformação Molecular , Relação Estrutura-Atividade , Células Tumorais CultivadasRESUMO
Bile acids are produced in the liver by the cholesterol breakdown and further metabolized by the intestinal microbiota to generate a group of chemically heterogeneous steroids that bind and activate a family of cells surface and nuclear receptors, collectively known as the bile acid-activated receptors (BARs). The two best characterized members of this family are the farnesoid-x-receptor (FXR) and G protein Bile Acid Receptor (GPBAR1). Both receptors are expressed by cells of innate immunity including liver-resident and intestinal-resident macrophages and monocytes-derived macrophages. Because FXR and GPBAR1 knockout mice are biased toward a pro-inflammatory phenotype, it appears the both receptors might have a role in the development and maintenance of a tolerogenic phenotype. FXR and GPBAR1 ligands have been proven effective in the treatment in inflammatory and metabolic disorders and ligands for these receptors are currently under development for the treatment of non-alcoholic steato-hepatitis and diabetes.