[Clinical features of non-cirrhotic portal hypertension in patients with common variable immunodeficiency].

We wished to summarize the clinical features of common variable immunodeficiency (CVID) complicated by non-cirrhotic portal hypertension (NCPH) and to deepen our understanding of it. The case data of CVID complicated with NCPH admitted to Peking Union Medical College Hospital from January 1983 to May 2021 were analyzed retrospectively to summarize their clinical characteristics. Six patients with CVID combined with NCPH (three of each sex; 16-45 years) were assessed. Four patients had portal hypertension. All patients had anemia, splenomegaly, a normal serum level of albumin and transaminases, and possibly increased levels of alkaline phosphatase and gamma-glutamyl transpeptidase. Two patients were diagnosed with esophagogastric fundic varices by gastroscopy. Two patients underwent splenectomy (which improved hematologic abnormalities partially). Four patients had autoimmune disease. Two cases were diagnosed with nodular regenerative hyperplasia (NRH) upon liver biopsy. Six patients were administered intravenous immunoglobulin-G (0.4-0.6 g/kg bodyweight) once every 3-4 weeks as basic therapy. Often, CVID complicated with NCPH has: (1) The manifestations of portal hypertension as the primary symptom. (2) Autoimmune-related manifestations. Imaging can provide important diagnostic clues. The etiology may be related to hepatic NRH and splenomegaly due to recurrent infections.

[Application of augmented reality and mixed reality navigation technology in laparoscopic limited right hepatectomy].

Objective: To investigate the application effect of augmented reality and mixed reality navigation technology in three-dimensional(3D) laparoscopic narrow right hepatectomy(LRH). Methods: A retrospective analysis was performed on the clinical data of 5 patients with hepatic malignancy admitted to the First Department of Hepatobiliary Surgery,Zhujiang Hospital,Southern Medical University from September 2020 to June 2021,all of whom were males,aged from 42 to 74 years.Preoperative evaluation was performed using the self-developed 3D abdominal medical image visualization system; if all the 5 patients were to receive right hemihepatectomy,the remnant liver volume would be insufficient,so LRH were planned.During the operation,the independently developed 3D laparoscopic augmented reality and mixed reality surgical navigation system was used to perform real-time multi-modal image fusion and interaction between the preoperative 3D model and 3D laparoscopic scene.Meanwhile,intraoperative ultrasound assisted indocyanine green fluorescence was used to determine the surgical path.In this way,the LRH under the guidance of augmented reality and mixed reality navigation was completed.The predicted liver resection volume was evaluated before surgery,actual resected liver volume,surgical indicators and postoperative complications were analyzed. Results: All the 5 patients completed LRH under the guidance of augmented reality and mixed reality navigation technology,with no conversion to laparotomy.The median operative time was 300 minutes(range:270 to 360 minutes),no intraoperative blood transfusion was performed,and the median postoperative hospital stay was 8 days(range:7 to 9 days).There were no perioperative deaths,or postoperative complications such as liver failure,bleeding,or biliary fistula. Conclusion: For patients who need to undergo LRH,the use of augmented and mixed reality navigation technology can safely and effectively guide the implementation of surgery,retain more functional liver volume,improve surgical safety,and reduce postoperative complications.

[Prevention and control of oral diseases via "Common Risk Factor Approach"].

People are generally more aware of infectious diseases, cardiovascular diseases, trauma and other fatal diseases rather than oral diseases. In fact, the oral disease as a whole is ranked the third among the chronic diseases of human beings. There have been accumulating evidences that oral health plays a significant role in general health and quality of life. There is a wide recognition that oral health shares common risky/pathogenic factors with other Non-Communicable Diseases (NCD). Oral microorganisms may cause dental caries and periodontal diseases, and they may also cause atherosclerosis and heart diseases, thus these usually end up to chronic diseases. On the other hand, unhealthy diet, physical inactivity, tobacco and alcohol consumption, psychological stress, poor sanitation, accidents and a sedentary lifestyle contribute to both oral diseases and a number of general chronic diseases. Oral health cannot be dealt with in isolation from other health issues. That is why the WHO recommended the "Common Risk Factor Approach (CRFA)" for oral health promotion. In this article, the authors give essential interpretation of CRFA and make suggestions on preventing and controlling oral diseases via CRFA.

[A questionnaire survey for gout management in physicians in Beijing].

Objective: To provide helpful continued medical education (CME) for physicians and improve gout treatment, we conducted a questionnaire survey to investigate physicians' knowledge in nine districts of Beijing. Methods: A questionnaire survey including ten gout-related questions was conducted among 298 physicians in Beijing. Demographic data and previous gout CME experience were collected. Chi-square test or Student's t test, univariate analysis and logistic regression analysis were used to evaluate the relevant factors of physicians' knowledge level. Results: A total of 250 valid copies were collected including 127 from community service centers (CSC), 123 from tertiary hospitals. The correct answer rate of gout etiology, pathogenesis and attack symptoms were over 70% in both groups. 45.5% (56/123) CSC doctors and 57.4% (66/115) tertiary doctors answered right drugs to control acute gout attack (P=0.067). Only 42.3% (52/123) in CSC and 53.4% (63/118) in hospitals chose allopurinol as a urate-lowering drug (ULT), while 46.3% (57/123) and 32.2% (38/118) doctors considered colchicine as a ULT drug (P=0.084) respectively. Near half doctors considered that gout patients should take long-term ULT [40.5% (51/126) vs. 57.6%(68/118)respectively, P=0.007]. Univariate analysis showed that CME training could improve gout-related knowledge in CRC doctors. Conclusion: Most CSC doctors generally understand basic knowledge of gout, while confusion of treatment is still significant. CME especially including standard gout treatment should be performed by doctors in tertiary hospitals.

[Clinical features of adult patients with chronic active Epstein-Barr virus infection].

Objective: To investigate the clinical features of adult-onset chronic active Epstein-Barr virus infection (CAEBV). Methods: A total of 21 adult patients with CAEBV who were admitted to the department of General Internal Medicine at Peking Union Medical College Hospital from January 2006 to January 2016 were retrospectively analyzed. Demographic data, disease duration, clinical manifestations, laboratory findings, treatments and prognosis were reviewed. Results: Eighteen females and 3 males were enrolled with a mean age of 39 years. The most common clinical manifestations included fever in 20 patients, splenomegaly in 20 patients, lymphadenopathy in 18 patients, and hepatomegaly in 10 patients, followed by laryngopharyngeal disorders in 6 patients, pleural effusion and peritoneal effusion each in 5 patients, rash in 4 patients, interstitial lung disease in 3 patients, gastrointestinal hemorrhage in 2 patients, and peripheral neuropathy and pulmonary hypertension each in 1 patient. Six patients were complicated with hemophagocytic lymphohis-tioncytosis(HLH) that developed 5-17 (mean: 9) months following CAEBV onset, all of whom experienced hyperpyrexia, pancytopenia, lymphadenopathy, splenomegaly, and liver dysfunction, 3 with hepatomegaly. Nineteen of the 21 patients had received steroid therapy including 10 combined with immunosuppressive agents, 11 with antiviral therapy, and 8 with intravenous immunoglobulin. Thirteen patients died, including 10 of multiple organ failure, (including 6 of HLH) 2 of severe pulmonary infection, and 1 of lymphoma. Six patients remained on follow-up, yet 2 were missing. Conclusions: CAEBV is expected with severe condition and poor prognosis, which is likely to be complicated with HLH. Clinical physicians should pay attention to adult patients with fever, hepatosplenomegaly and lymphadenopathy, which suggests possible CAEBV.

[Glycogen storage disease type â a: a rare cause of gout in adolescent and young adult patients].

Objective: To analyze the clinical features of secondary gout in glycogen storage disease type Ⅰa (GSD Ⅰa), so as to improve the awareness of this disease. Methods: The clinical features, laboratory findings, treatments and prognosis of 5 GSD Ⅰa patients with secondary gout who had been admitted to the Peking Union Medical College Hospital during 2006 to 2016 were collected and analyzed. GSD Ⅰa was confirmed by liver biopsy and genotyping. Results: Among the 5 patients (median age: 27 years), 3 were males and 2 were females. The mean age of gout onset was 17 ranging from 10 to 22 years old. The common manifestations of GSD included hepatomegaly since childhood, hypoglycemia, growth retardation, anemia, hyperlactacidemia and hyperlipidemia. All the 5 patients were complicated with gouty tophi and kidney stone. Gouty tophi and kidney stone were identified 3.8 years and 10.2 years after the first occurrence of articular symptoms, respectively. Renal damage occurred in 3 cases. All the patients underwent several therapeutic modalities including lifestyle intervention, allopurinol, and raw corn starch treatment. Conclusions: Determination of the presence of primary disease should be performed actively for young-onset gout with early occurrence of gouty tophi. GSD should be suspected if there exist clinical manifestations like hepatomegaly, recurrent hypoglycemia, growth retardation. Early management of hyperuricemia and gout in GSD patients is important to prevent complications and improve prognosis.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 µmol/L and females with serum uric acid> 359.6 µmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Inhibition of pulmonary carcinoma proliferation or metastasis of miR-218 via down-regulating CDCP1 expression.

OBJECTIVE: Pulmonary carcinoma is one common malignant tumor with a high risk of recurrence and metastasis. Non-small cell lung cancer (NSCLC) is the most common subtype. As one tumor biomarker, microRNA (miR) has tissue sensitivity and can facilitate oncogene or inhibit tumor suppressor gene. MiR-218 has abnormal expression and can work as one molecular marker for tumors. However, its expression and function mechanism in lung cancer cells have not been fully illustrated. MATERIALS AND METHODS: In vitro cultured pulmonary adenoma A549 cells and normal bronchial epithelial cell line 16HBE were tested for miR-218 expression. A549 cells were transfected with miR-218 mimic or negative controls, followed by real-time PCR quantifying for miR-218. MTT method was used to test cell proliferation, whilst Transwell chamber was adopted for measuring cell invasion. Dual luciferase reporter gene assay (DLRGA) was used to test target relationship between miR-218 and CDCP1. Western blot was used to test CDCP1 expression. RESULTS: MiR-218 was down-regulated in A549 cells compared to 16HBE (p<0.05). Transfection of miR-218 mimic significantly facilitated miR-218 expression, inhibited tumor proliferation or invasion. As the target gene of miR-218, CDCP1 expression was suppressed by miR-218 over-expression (p<0.05 compared to control group). CONCLUSIONS: MiR-218 inhibits NSCLC proliferation or metastasis via down-regulating CDCP1, and can work as one novel molecular target for lung cancer diagnosis.

Role of protein kinase A in GABAA receptor dysfunction in CA1 pyramidal cells following chronic benzodiazepine treatment.

One-week treatment with the benzodiazepine (BZ) flurazepam (FZP), results in anticonvulsant tolerance, associated with reduced GABAA receptor (GABAR) subunit protein and miniature inhibitory post-synaptic current (mIPSC) amplitude in CA1 neurons of rat hippocampus. Because protein kinase A (PKA) has been shown to modulate GABAR function in CA1 pyramidal cells, the present study assessed whether GABAR dysfunction is associated with changes in PKA activity. Two days after 1-week FZP treatment, there were significant decreases in basal (- 30%) and total (- 25%) PKA activity, and a 40% reduction in PKA RIIbeta protein in the insoluble fraction of CA1 hippocampus. The soluble component of CA1 showed a significant increase in basal (100%) but not total PKA activity. Whole-cell recording in vitro showed a 50% reduction in mIPSC amplitude in CA1 pyramidal cells, with altered sensitivity to PKA modulators. Neurons from FZP-treated rats responded to 8-bromo-cAMP with a significant increase (31%) in mIPSC amplitude. Likewise, vasoactive intestinal polypeptide (VIP), an endogenous PKA activator, caused a significant 36% increase in mIPSC amplitude in FZP-treated cells. Neither agent had a significant effect on mIPSC amplitude in control cells. This study supports a role for PKA in GABAR dysfunction after chronic FZP treatment.

Insulinoma: 31 years of tumor localization and excision.

This report is based on 31 years of experience with 116 cases of hyperinsulinism. Six cases had hypertrophy of the islets of Langerhans, 3 had widespead metastasis from malignant insulinomas, and 107 were benign adenoma cases. An immunoreactive insulin to glucose ratio of 0.3 of the peripheral venous blood before operation is of great value in diagnosing hyperinsulinism. Intraoperatively, immunoreactive insulin assay of the portal blood (IRI) is very valuable in determining if an insulinoma remains. The dividing line is 100 microU.ml-1. In localizing the tumor, "differential" PTPC is important before operation. During the operation, fine needle aspiration cytology may assist in ascertaining if the palpable tumor is an insulinoma. Multiple fine needle aspiration cytology examinations can sometimes reveal an insulinoma in an indurated pancreas. Portal vein blood IRI and blood sugar assays may serve to confirm if removal of the insulinoma is complete. Removal of the insulinoma controls hypoglycemia satisfactorily, but the brain damage incurred by prolonged hypoglycemia cannot be significantly altered. Removal of the tumor should be by enucleation, and the raw surface of the pancreas should be drained not sutured.