Extrachromosomal circular DNA (eccDNA) characteristics in the bile and plasma of advanced perihilar cholangiocarcinoma patients and the construction of an eccDNA-related gene prognosis model.

Extrachromosomal DNAs (eccDNAs) frequently carry amplified oncogenes. This investigation aimed to examine the occurrence and role of eccDNAs in individuals diagnosed with advanced perihilar cholangiocarcinoma (pCCA) who exhibited distinct prognostic outcomes. Five patients with poor survival outcomes and five with better outcomes were selected among patients who received first-line hepatic arterial infusion chemotherapy from June 2021 to June 2022. The extracted eccDNAs were amplified for high-throughput sequencing. Genes associated with the differentially expressed eccDNAs were analyzed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses. The differentially expressed bile eccDNA-related genes were used to construct a prognostic model. Across all 10 patients, a total of 19,024 and 3,048 eccDNAs were identified in bile and plasma, respectively. The concentration of eccDNA detected in the bile was 9-fold higher than that in plasma. The chromosome distribution of the eccDNAs were similar between bile and matched plasma. GO and KEGG pathway analyses showed enrichment in the mitogen-activated protein kinase (MAPK) and Wnt/ß-catenin pathways in patients with poor survival outcomes. According to the prognostic model constructed by eccDNA-related genes, the high-risk group of cholangiocarcinoma patients displayed significantly shorter overall survival (p < 0.001). Moreover, the degree of infiltration of immunosuppressive cells was higher in patients in the high-risk group. In conclusion, EccDNA could be detected in bile and plasma of pCCA patients, with a higher concentration. A prognostic model based on eccDNA-related genes showed the potential to predict the survival and immune microenvironment of patients with cholangiocarcinoma.

Nanoassembly-Mediated Exendin-4 Derivatives to Decrease Renal Retention.

An Exendin-4 analogue that was conjugated with 68Ga exhibited an excellent diagnostic effect on insulinoma in clinical practice. On account of its low molecular weight and short hydration radius, 68Ga-Exendin-4 showed high accumulation in kidney tissues. Nanoparticle-mediated strategies have attracted much attention due to polyvalent properties and the size amplification effect. In this study, Exendin-4 derivatives of radionuclide nanodevices were developed and evaluated. The Exendin-4 derivatives consisting of a ternary block recombinant protein were purified by an inverse transition cycle (ITC) and allowed to self-assemble into a nanodevice under physiological conditions. Our results showed that the nanoassemblies of Exendin-4 derivatives formed homogeneous spherical nanoparticles, exhibited outstanding affinity for insulinoma cells, and could be deposited in insulinoma tissues in vivo. The nanoassembly-mediated Exendin-4 derivatives showed fivefold reduced renal retention and exhibited an outstanding tumor-suppression effect.

Anlotinib for Metastatic Progressed Pheochromocytoma and Paraganglioma: A Retrospective Study of Real-World Data.

Introduction: Pheochromocytomas (PCC) and paragangliomas (PGL) (collectively PPGL) are a type of rare hypervascular neuroendocrine tumors that are very challenging to treat. This study aimed to determine the efficacy and safety of the multi-tyrosine kinase inhibitor anlotinib for the treatment of locally advanced or metastatic (LA/M) PPGL. Methods: A total of 37 eligible patients with unresectable or progressive LA/M PPGL were enrolled. Of them, 27 patients received anlotinib alone (n = 19) or in combination (n = 8) with radionuclide therapies, including peptide receptor radionuclide therapy (PRRT) and iodine 131 meta-iodobenzylguanidine (131I-MIBG). The primary endpoints included objective response rate (ORR), defined as partial response (PR) or complete response (CR), and disease-control rate, defined as PR, CR, or stable disease (SD). The secondary endpoints were progression-free survival (PFS), duration of response, and drug safety. Results: In the efficacy evaluation for all 27 patients, the ORR was 44.44% (95% CI: 24.4%-64.5%) and disease-control rate was 96.29% (95% CI: 88.7%-100%). Twelve cases (44.44%) achieved PR, 14 (51.85%) SD. The median PFS was 25.2 months (95% CI: 17.2 months to not reached). PFS was shorter in the anlotinib monotherapy group than in the group receiving anlotinib in combination with radionuclide therapy (P = .2). There were no serious treatment-related AEs. Conclusion: Anlotinib monotherapy or in combination with radionuclide therapies shows promising efficacy and safety for the treatment of LA/M PCC and PGL. Multi-tyrosine kinase inhibitors might represent a novel therapeutic strategy for patients with PPGL; however, large-scale prospective randomized, blinded, controlled clinical research studies are required.

PET/NIR Fluorescence Bimodal Imaging for Targeted Tumor Detection.

Cancer is one of the greatest threats to human health due to late diagnosis and incomplete resection. The bimodal probe combines positron emission tomography (PET) imaging for noninvasive whole-body scanning with intraoperative near-infrared fluorescence (NIRF) surgical guidance for preoperative tumor detection, tumor resection during surgery, and postoperative monitoring. We developed a new PET/NIRF bimodal imaging agent, [68Ga]Ga-DOTA-NPC, covalently coupled to DCDSTCY and DOTA via ethylenediamine and radiolabeled with gallium-68, and investigated it in vitro and in vivo. The probe was found to be preferential for colon cancer cells due to the organic anion-transporting polypeptide1B3 (OATP1B3). PET/NIRF imaging allowed us to confirm [68Ga]Ga-DOTA-NPC as a promising probe for tumor detection, as it provides good biosafety and high-contrast tumor accumulation. Orthotopic and subcutaneous colon tumors were successfully resected under real-time NIRF guidance. [68Ga]Ga-DOTA-NPC provides highly sensitive and unlimited tissue-penetrating PET/NIRF imaging, helping to visualize and differentiate tumors from adjacent tissue.

Diagnostic value of matrix metalloproteinases 2, 7 and 9 in urine for early detection of colorectal cancer.

BACKGROUND: A noninvasive biomarker with high diagnostic performance is urgently needed for the early diagnosis of colorectal cancer (CRC). AIM: To evaluate the diagnostic value of matrix metalloproteinases (MMPs) 2, 7 and 9 in urine for CRC. METHODS: Of 59 healthy controls, 47 patients with colon polyps and 82 patients with CRC were included in this study. Carcinoembryonic antigen (CEA) in serum and MMP2, MMP7, and MMP9 in urine were detected. The combined diagnostic model of the indicators was established by binary logistic regression. The receiver operating characteristic curve (ROC) of the subjects was used to evaluate the independent and combined diagnostic value of the indicators. RESULTS: The MMP2, MMP7, MMP9, and CEA levels in the CRC group differed significantly from levels in the healthy controls (P < 0.05). The levels of MMP7, MMP9, and CEA also differed significantly between the CRC group and the colon polyps group (P < 0.05). The area under the curve (AUC) distinguishing between the healthy control and the CRC patients using the joint model with CEA, MMP2, MMP7 and MMP9 was 0.977, and the sensitivity and specificity were 95.10% and 91.50%, respectively. For early-stage CRC, the AUC was 0.975, and the sensitivity and specificity were 94.30% and 98.30%, respectively. For advanced stage CRC, the AUC was 0.979, and the sensitivity and specificity were 95.70% and 91.50%, respectively. Using CEA, MMP7 and MMP9 to jointly established a model distinguishing the colorectal polyp group from the CRC group, the AUC was 0.849, and the sensitivity and specificity were 84.10% and 70.20%, respectively. For early-stage CRC, the AUC was 0.818, and the sensitivity and specificity were 76.30% and 72.30%, respectively. For advanced stage CRC, the AUC was 0.875, and the sensitivity and specificity were 81.80% and 72.30%, respectively. CONCLUSION: MMP2, MMP7 and MMP 9 may exhibit diagnostic value for the early detection of CRC and may serve as auxiliary diagnostic markers for CRC.

Mealybug salivary microbes inhibit induced plant defenses.

BACKGROUND: Phenacoccus solenopsis is a polyphagous invasive mealybug that caused serious damage to crops worldwide. Phloem-sucking hemipterans are known to carry symbiotic microbes in their saliva. However, the role of salivary bacteria of P. solenopsis in modulating plant defenses remains limited. Exploring the impact of salivary bacteria on plant defense responses will contribute to the development of new targets for efficient control of invasive mealybugs. RESULTS: Salivary bacteria of the invasive mealybug P. solenopsis can suppress herbivore-induced plant defenses and thus enhance mealybug fitness. Mealybugs treated with an antibiotic showed decreased weight gain, fecundity and survival. Untreated mealybugs suppressed jasmonic acid (JA)-regulated defenses but activated salicylic acid (SA)-regulated defenses in cotton plants. In contrast, antibiotic-treated mealybugs triggered JA-responsive gene expression and JA accumulation, and showed shortened phloem ingestion. Reinoculating antibiotic-treated mealybugs with Enterobacteriaceae or Stenotrophomonas cultivated from mealybug saliva promoted phloem ingestion and fecundity, and restored the ability of mealybugs to suppress plant defenses. Fluorescence in situ hybridization visualization revealed that Enterobacteriaceae and Stenotrophomonas colonize salivary glands and are secreted into the mesophyll cells and phloem vessels. Exogenous application of the bacterial isolates to plant leaves inhibited JA-responsive gene expression and activated SA-responsive gene expression. CONCLUSION: Our findings imply that symbiotic bacteria in the saliva of the mealybug play an important role in manipulating herbivore-induced plant defenses, enabling this important pest to evade induced plant defenses and promoting its performance and destructive effects on crops. © 2023 Society of Chemical Industry.

Detection of Bone Metastases by 68Ga-DOTA-SSAs and 18F-FDG PET/CT: A Two-Center Head-to-Head Study of Gastroenteropancreatic Neuroendocrine Neoplasms.

Purpose: This study aimed to assess the efficacy of dual-tracer [68Ga-DOTA-somatostatin receptor analogs (SSAs) and 18F-fluorodeoxyglucose (FDG)] positron emission tomography/computed tomography (PET/CT) imaging for detecting bone metastases (BMs) in patients with gastroenteropancreatic neuroendocrine neoplasms (GEP-NENs). Methods: We retrospectively enrolled 74 GEP-NEN patients with BMs from two centers, who underwent dual-tracer PET/CT from January 2014 to March 2021. We compared and analyzed effectiveness of the dual PET/CT imaging techniques on the BMs, based on 18F-FDG and 68Ga-DOTA-SSAs. Specifically, we analyzed the imaging results using χ 2 tests for classification variables, paired-sample tests for number of BMs, Wilcoxon's signed rank test for number of lesions, and the Kruskal-Wallis test for standard uptake value (SUV) ratio comparison. The correlation of dual-tracer SUVmax with Ki-67 index was analyzed by Spearman's correlation coefficient. Results: The detection efficiencies of dual-tracer PET/CT imaging in patients with different pathologies showed discordant for detecting liver metastases and BMs in group neuroendocrine tumor (NET) G3, 68Ga-DOTA-SSAs was better at detecting BMs for NET G3 (P=0.049 for SUVT/B and P=0.026 for the number of metastatic lesions). In addition, statistical significance was found among osteogenesis group, osteolysis group, and the no-change group (for bone SUVT/B value detected by 18F-FDG and Ki-67 index, osteogenesis group < osteolysis group; for bone SUVT/B detected by 68Ga-DOTA-SSAs, osteogenesis group > the no-change group). What is more, liver and bone SUVmax and Ki-67 index were positively correlated in 18F-FDG imaging (P < 0.001 for liver; P=0.002 for bone), and negatively correlated in 68Ga-DOTA-SSAs imaging (P < 0.001 for liver; P=0.039 for bone). Conclusions: 68Ga-DOTA-SSAs was superior to 18F-FDG for detecting BMs in NET G1/G2 (well and moderately differentiated NETs), as well as in NET G3 (poorly differentiated NETs). Relatively good differentiation was observed in the osteogenesis group. In addition, dual-tracer PET/CT imaging results were observably correlated with tumor differentiation.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Blood index panel for gastric cancer detection.

BACKGROUND: Gastric cancer is a common malignant tumor. Early detection and diagnosis are crucial for the prevention and treatment of gastric cancer. AIM: To develop a blood index panel that may improve the diagnostic value for discriminating gastric cancer and gastric polyps. METHODS: Thirteen tumor-related detection indices, 38 clinical biochemical indices and 10 cytokine indices were examined in 139 gastric cancer patients and 40 gastric polyp patients to build the model. An additional 68 gastric cancer patients and 22 gastric polyp patients were enrolled for validation. After area under the curve evaluation and univariate and multivariate analyses. RESULTS: Five tumor-related detection indices, 12 clinical biochemical indices and 1 cytokine index showed significant differences between the gastric cancer and gastric polyp groups. Carbohydrate antigen (CA) 724, phosphorus (P) and ischemia-modified albumin (IMA) were included in the blood index panel, and the area under the curve (AUC) of the index panel was 0.829 (0.754, 0.905). After validation, the AUC was 0.811 (0.700, 0.923). Compared to the conventional index CA724, the blood index panel showed significantly increased diagnostic value. CONCLUSION: We developed an index model that included CA724, P and IMA to discriminate the gastric cancer and gastric polyp groups, which may be a potential diagnostic method for clinical practice.

Early detection of colorectal cancer based on circular DNA and common clinical detection indicators.

BACKGROUND: Colorectal cancer (CRC) is the third most common cancer worldwide, and it is the second leading cause of death from cancer in the world, accounting for approximately 9% of all cancer deaths. Early detection of CRC is urgently needed in clinical practice. AIM: To build a multi-parameter diagnostic model for early detection of CRC. METHODS: Total 59 colorectal polyps (CRP) groups, and 101 CRC patients (38 early-stage CRC and 63 advanced CRC) for model establishment. In addition, 30 CRP groups, and 62 CRC patients (30 early-stage CRC and 32 advanced CRC) were separately included to validate the model. 51 commonly used clinical detection indicators and the 4 extrachromosomal circular DNA markers NDUFB7, CAMK1D, PIK3CD and PSEN2 that we screened earlier. Four multi-parameter joint analysis methods: binary logistic regression analysis, discriminant analysis, classification tree and neural network to establish a multi-parameter joint diagnosis model. RESULTS: Neural network included carcinoembryonic antigen (CEA), ischemia-modified albumin (IMA), sialic acid (SA), PIK3CD and lipoprotein a (LPa) was chosen as the optimal multi-parameter combined auxiliary diagnosis model to distinguish CRP and CRC group, when it differentiated 59 CRP and 101 CRC, its overall accuracy was 90.8%, its area under the curve (AUC) was 0.959 (0.934, 0.985), and the sensitivity and specificity were 91.5% and 82.2%, respectively. After validation, when distinguishing based on 30 CRP and 62 CRC patients, the AUC was 0.965 (0.930-1.000), and its sensitivity and specificity were 66.1% and 70.0%. When distinguishing based on 30 CRP and 32 early-stage CRC patients, the AUC was 0.960 (0.916-1.000), with a sensitivity and specificity of 87.5% and 90.0%, distinguishing based on 30 CRP and 30 advanced CRC patients, the AUC was 0.970 (0.936-1.000), with a sensitivity and specificity of 96.7% and 86.7%. CONCLUSION: We built a multi-parameter neural network diagnostic model included CEA, IMA, SA, PIK3CD and LPa for early detection of CRC, compared to the conventional CEA, it showed significant improvement.

Evaluation of the diagnostic value of serum-based proteomics for colorectal cancer.

BACKGROUND: Colorectal cancer (CRC) is a highly malignant cancer with a high incidence and mortality in China. It is urgent to find a diagnostic marker with higher sensitivity and specificity than the traditional approaches for CRC diagnosis. AIM: To provide new ideas for the diagnosis of CRC based on serum proteomics. METHODS: Specimens from 83 healthy people, 62 colon polyp (CRP) patients, and 101 CRC patients were analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The diagnostic value of the profiles of differentially expressed proteins was then analyzed. RESULTS: Compared with the healthy control group, CRC patients had elevated expression of 5 proteins and reduced expression of 14 proteins. The area under the curve (AUC) for a differentially expressed protein with a mass-to-charge ratio of 2022.34 was the largest; the AUC was 0.843, which was higher than the AUC of 0.717 observed with carcinoembryonic antigen (CEA), and the sensitivity and specificity of this identified marker were 75.3% and 79.5%, respectively. After cross-validation, the accuracy of diagnosis using levels of this differentially expressed protein was 82.37%. Compared with the CRP group, the expression of 3 proteins in the serum of CRC patients was elevated and 11 proteins were expressed at reduced levels. Proteins possessing mass-to-charge ratio values of 2899.38 and 877.3 were selected to establish a classification tree model. The results showed that the accuracy of CRC diagnosis was 89.5%, the accuracy of CRP diagnosis was 81.6%, and the overall accuracy of this approach was 86.3%. The overall sensitivity and specificity of diagnosis using the proteomics approach were 81.8% and 66.75%, respectively. The sensitivities and specificities of diagnoses based on CEA and carbohydrate antigen 19-9 expression were 55.6% and 91.3% and 65.4% and 65.2%, respectively. CONCLUSION: We demonstrated that serum proteomics may be helpful for the detection of CRC, and it may assist clinical practice for CRC diagnosis.

Development and validation of 68Ga-PSMA-11 PET/CT-based radiomics model to detect primary prostate cancer.

BACKGROUND: This study aimed to develop a novel analytic approach based on a radiomics model derived from 68Ga-prostate-specific membrane antigen (PSMA)-11 PET/CT for predicting intraprostatic lesions in patients with prostate cancer (PCa). METHODS: This retrospective study included consecutive patients with or without PCa who underwent surgery or biopsy after 68Ga-PSMA-11 PET/CT. A total of 944 radiomics features were extracted from the images. A radiomics model was constructed using the least absolute shrinkage and selection operator (LASSO) algorithm with tenfold cross-validation in the training set. PET/CT images for the test set were reviewed by experienced nuclear medicine radiologists. The sensitivity, specificity, positive predictive value, negative predictive value, and area under the receiver operating characteristic curve (AUC) were calculated for the model and radiologists' results. The AUCs were compared. RESULTS: The total of 125 patients (86 PCa, 39 benign prostate disease [BPD]) included 87 (61 PCa, 26 BPD) in the training set and 38 (61 PCa, 26 BPD) in the test set. Nine features were selected to construct the radiomics model. The model score differed between PCa and BPD in the training and test sets (both P < 0.001). In the test set, the radiomics model performed better than the radiologists' assessment (AUC, 0.85 [95% confidence interval 0.73, 0.97] vs. 0.63 [0.47, 0.79]; P = 0.036) and showed higher sensitivity (model vs radiologists, 0.84 [0.63, 0.95] vs. 0.74 [0.53, 0.88]; P = 0.002). CONCLUSION: Radiomics analysis based on 68Ga-PSMA-11 PET may non-invasively predict intraprostatic lesions in patients with PCa.

Genome-wide methylation profiling of early colorectal cancer using an Illumina Infinium Methylation EPIC BeadChip.

BACKGROUND: DNA methylation is a part of epigenetic modification, that is closely related to the growth and development of colorectal cancer (CRC). Specific methylated genes and methylated diagnostic models of tumors have become current research focuses. The methylation status of circulating DNA in plasma might serve as a potential biomarker for CRC. AIM: To investigate genome-wide methylation pattern in early CRC using the Illumina Infinium Human Methylation 850K BeadChip. METHODS: The 850K Methylation BeadChip was used to analyze the genome-wide methylation status of early CRC patients (n = 5) and colorectal adenoma patients (n = 5). Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways enrichment analyses were performed on the selected differentially methylated sites to further discover candidate methylation biomarkers in plasma. RESULTS: A total of 1865 methylated CpG sites with significant differences were detected, including 676 hypermethylated sites and 1189 hypomethylated sites. The distribution of these sites covered from the 1st to 22nd chromosomes and are mainly distributed on the gene body and gene promoter region. GO and KEGG enrichment analysis showed that the functions of these genes were related to biological regulation, molecular binding, transcription factor activity and signal transduction pathway. CONCLUSION: The study demonstrated that the Illumina Infinium Human Methylation 850K BeadChip can be used to investigate genome-wide methylation status of plasma DNA in early CRC and colorectal adenoma patients.

Confining High-Valence Iridium Single Sites onto Nickel Oxyhydroxide for Robust Oxygen Evolution.

Enhancing activity and stability of iridium- (Ir-) based oxygen evolution reaction (OER) catalysts is of great significance in practice. Here, we report a vacancy-rich nickel hydroxide stabilized Ir single-atom catalyst (Ir1-Ni(OH)2), which achieves long-term OER stability over 260 h and much higher mass activity than commercial IrO2 in alkaline media. In situ X-ray absorption spectroscopy analysis certifies the obvious structure reconstruction of catalyst in OER. As a result, an active structure in which high-valence and peripheral oxygen ligands-rich Ir sites are confined onto the nickel oxyhydroxide surface is formed. In addition, the precise introduction of atomized Ir not only surmounts the large-range dissolution and agglomeration of Ir but also suppresses the dissolution of substrate in OER. Theoretical calculations further account for the activation of Ir single atoms and the promotion of oxygen generation by high-valence Ir, and they reveal that the deprotonation process of adsorbed OH is rate-determining.

177Lu-PSMA-I&T Radioligand Therapy for Treating Metastatic Castration-Resistant Prostate Cancer: A Single-Centre Study in East Asians.

Purpose: There is increasing evidence for convincing efficacy and safety of 177Lu-labled prostate-specific membrane antigen (PSMA)-targeted radioligand therapy (PRLT) for metastatic castration-resistant prostate cancer (mCRPC). However, data are not available regarding the feasibility of 177Lu-labled PSMA-targeted RLT in East Asians. The present study summarized the first experience with 177Lu-PSMA-I&T therapy for mCRPC in China. Methods: Forty consecutive patients with mCRPC were enrolled from December 2019 to September 2021. Eligible patients received 177Lu-PSMA-I&T RLT at intervals of 8-12 weeks. Toxicity was assessed based on standardized physicians' reports and the Common Toxicity Criteria for Adverse Events criteria. Response to PRLT was evaluated according to the changes of prostate specific antigen (PSA) response and imaging response. Quality of life (QOL), Karnofsky performance status (KPS) and pain (visual analogue scale, VAS) were also evaluated. The impacts of baseline parameters on the therapeutic effects were explored by univariate and multivariate logistic regression analyses. Results: All patients underwent a total of 86 cycles of 177Lu-PSMA-I&T (range: 1-5 cycles) with dosages of 3.70-14.43GBq per cycle, with a median of 8 months followed up. Six patients (15%) developed mild reversible xerostomia during follow-up, and 28 patients (70%) experienced grade 1-4 bone marrow dysfunction. Changes in PSA were assessed after therapy, accompanied by the partial response (PR) in 25 patients (62.5%), the stable disease (SD) in 5 patients (12.5%), and the progressive disease (PD) in 10 patients (25%), respectively. QOL, KPS (%) and VAS scores were improved significantly due to treatment (P<0.05). Overweight and elevated AST, ALP, and LDH were associated with poor outcomes. Conclusions: 177Lu-PSMA-I&T achieves the favourable response and well tolerance in mCRPC, which associates with not only PSA decline but also with tumor remission including lymphadenopathy and bone metastasis. We also find that patients with overweight and high AST, ALP, and LDH should be cautious to undergo the PRLT. Large-cohort studies are warranted to confirm the initial findings and elucidate the survival benefit of the treatment.

68Ga-DOTA-NT-20.3 Neurotensin Receptor 1 PET Imaging as a Surrogate for Neuroendocrine Differentiation of Prostate Cancer.

Prostate-specific membrane antigen (PSMA)-negative neuroendocrine prostate cancer (PCa) is a subtype of PCa likely to be lethal, with limited clinical diagnostic and therapeutic options. High expression of neurotensin receptor subtype 1 (NTR1) is associated with neuroendocrine differentiation of PCa, which makes NTR1 a potential target for neuroendocrine PCa. In this study, the NTR1-targeted tracer 68Ga-DOTA-NT-20.3 was synthesized, and its affinity to androgen-dependent (LNCap) and androgen-independent (PC3) xenografts was determined. Methods: 68Ga-DOTA-NT-20.3 was labeled using an automated synthesizer module, and its stability, labeling yield, and radiochemical purity were analyzed by radio-high-performance liquid chromatography. Receptor binding affinity was evaluated in NTR1-positive PC3 cells by a competitive binding assay. The biodistribution of 68Ga-DOTA-NT-20.3 in vivo was evaluated in PC3 and LNCap xenografts by small-animal PET imaging. NTR1 expression was identified by immunohistochemistry and immunofluorescence evaluation. Results: 68Ga-DOTA-NT-20.3 was synthesized successfully, with a yield of 88.07% ± 1.26%, radiochemical purity of at least 99%, and favorable stability. The NTR1 affinity (half-maximal inhibitory concentration) for 68Ga-DOTA-NT-20.3 was 7.59 ± 0.41 nM. Small-animal PET/CT of PC3 xenograft animals showed high-contrast images with intense tumor uptake, which revealed specific NTR1 expression. The tumors showed significant radioactivity (4.95 ± 0.67 percentage injected dose per gram of tissue [%ID/g]) at 1 h, which fell to 1.95 ± 0.17 %ID/g (P < 0.01, t = 8.72) after specific blockage by neurotensin. LNCap xenografts had no significant accumulation (0.81 ± 0.06 %ID/g) of 68Ga-DOTA-NT-20.3 at 1 h. In contrast, 68Ga-PSMA-11 was concentrated mainly in LNCap xenografts (8.60 ± 2.11 %ID/g), with no significant uptake in PC3 tumors (0.53 ± 0.05 %ID/g), consistent with the in vitro immunohistochemistry findings. Biodistribution evaluation showed rapid clearance from the blood and main organs (brain, heart, lung, liver, muscle, and bone), with significantly high tumor-to-liver (4.41 ± 0.73) and tumor-to-muscle (12.34 ± 1.32) ratios at 60 min after injection. Conclusion: 68Ga-DOTA-NT-20.3 can be efficiently prepared with a high yield and high radiochemical purity. Its favorable biodistribution and prominent NTR1 affinity make 68Ga-DOTA-NT-20.3 a potential radiopharmaceutical for the detection of PSMA-negative PCa and identification of neuroendocrine differentiation.

A reverse transcription-cross-priming amplification method with lateral flow dipstick assay for the rapid detection of Bean pod mottle virus.

Bean pod mottle virus (BPMV) is a destructive virus that causes serious economic losses in many countries every year, highlighting the importance of its effective detection. In this study, we developed a fast reverse transcription-cross-priming amplification (RT-CPA) coupled with lateral flow dipstick (LFD) diagnostic method for BPMV detection. The RT-CPA-LFD assay that targets the coat protein gene of BPMV was highly specific against diagnosing four other common viruses transmitted by soybean seeds, i.e., Southern bean mosaic virus (SBMV), Tomato ringspot virus (ToRSV), Arabis mosaic virus (ArMV), and Tobacco ringspot virus (TRSV). The sensitivities of the real-time fluorescent RT-CPA and the RT-CPA-LFD assay were at least 50 pg/µl and 500 pg/µl, respectively. Despite a compromise in the limit of detection of the RT-CPA method compared with TaqMan-MGB real-time RT-PCR, our results demonstrated a notably better performance in the detection of field samples of BPMV-infested soybean seeds. With the advantages of efficiency and convenience by visual determination, the RT-CPA-LFD assay presents a potential application for the rapid and accurate detection of BPMV in routine tests.

Dosimetry of 177Lu-DOTATOC first circle treatment in patients with advanced metastatic neuroendocrine tumors: A pilot study in China.

First cycle dosimetry calculation of 177Lu-DOTATOC (single activity:1.59-3.49 GBq) was carried out in eight patients with advanced neuroendocrine tumors (NETs) who underwent whole-body planar (0.5, 24, 48, 72 h) and SPECT/CT scans (24 h). Focal uptake of 177Lu-DOTATOC was found in primary and metastatic tumors. Organs with the highest absorbed doses per injected activity were tumors (1.293 ± 0.862 mGy/MBq) and spleen (0.461 ± 0.408 mGy/MBq), while low absorbed doses were observed in kidneys (0.384 ± 0.112 mGy/MBq) and bone marrow (0.0297 ± 0.0123 mGy/MBq). 177Lu-DOTATOC is safe, well-tolerated and appropriate in Chinese NETs patients for PRRT.

Nightshade Curly Top Virus: A Possible New Virus of the Genus Topocuvirus Infecting Solanum nigrum in China.

Virus-like symptoms, including leaf deformation and curling, were observed on nightshade (Solanum nigrum) in Zhejiang Province, China. To identify possible pathogenic viruses or viroids, a symptomatic sample was subjected to deep sequencing of small interfering RNAs. Assembly of the resulting sequences led to identification of a novel geminivirus, provisionally designated nightshade curly top virus (NCTV). The complete genomic DNA sequence is 2,867 nucleotides and encodes seven open reading frames. NCTV shares 77.1% overall nucleotide sequence identity, 86.3% coat protein amino acid identity, and 78.9% replication-associated protein amino acid sequence identity with Tomato pseudo-curly top virus, a member of the genus Topocuvirus. PCR screening of nightshade field isolates indicated that NCTV is widely distributed in Zhejiang. Agrobacterium-mediated inoculation revealed that NCTV is highly infectious to Nicotiana benthamiana, S. nigrum, S. lycopersicum, and S. tuberosum. Based on pairwise comparisons and phylogenetic analyses, NCTV is proposed as a provisional member of the genus Topocuvirus.

Transarterial chemoembolization with hepatic arterial infusion chemotherapy plus S-1 for hepatocellular carcinoma.

BACKGROUND: Transarterial chemoembolization (TACE) and hepatic arterial infusion chemotherapy (HAIC) have shown promising local benefits for advanced hepatocellular carcinoma (HCC). S-1, a composite preparation of a 5-fluorouracil prodrug, has proven to be a convenient oral chemotherapeutic agent with definite efficacy against advanced HCC. AIM: To evaluate the efficacy and safety of TACE followed by HAIC with or without oral S-1 for treating advanced HCC. METHODS: In this single-center, open-label, prospective, randomized controlled trial, 117 participants with advanced HCC were randomized to receive TACE followed by oxaliplatin-based HAIC either with (TACE/HAIC + S-1, n = 56) or without (TACE/HAIC, n = 61) oral S-1 between December 2013 and September 2017. Two participants were excluded from final analysis for withdrawing consent. The primary endpoint was progression-free survival (PFS) and secondary endpoints included overall survival (OS), objective response rate, disease control rate and safety. RESULTS: In total, 115 participants (100 males and 15 females; mean age, 57.7 years ± 11.9) were analyzed. The median PFS and OS were 5.0 mo (0.4-58.6 mo) (95% confidence interval (CI): 3.82 to 6.18) vs 4.4 mo (1.1-54.4 mo) (95%CI: 2.54 to 6.26; P = 0.585) and 8.4 mo (0.4-58.6 mo) (95%CI: 6.88 to 9.92) vs 8.3 mo (1.4-54.4 m) (95%CI: 5.71 to 10.96; P = 0.985) in the TACE/HAIC + S-1 and TACE/HAIC groups, respectively. The objective response rate and disease control rate were 30.9% vs 18.4% and 72.7% vs 56.7% in the TACE/HAIC + S-1 and TACE/HAIC groups, respectively. Grade 3/4 adverse events had a similar frequency in both treatment groups. CONCLUSION: No improvements in tumor response rates, PFS or OS were observed with the addition of S-1 to TACE/HAIC in advanced HCC. Both treatment regimens had a similar safety profile.