Dietary fats and serum lipids in relation to the risk of ovarian cancer: a meta-analysis of observational studies.

Although numerous epidemiological studies investigated the association between dietary fat intakes or serum lipid levels and ovarian cancer risk, a consistent and explicit conclusion for specific dietary fats or serum lipids that increase the risk of ovarian cancer is not available. In this study, a systematic review and meta-analysis were conducted to assess the key dietary fats and serum lipids that increased the risk of ovarian cancer. Databases such as PubMed, Web of Science, and EMBASE were searched for observational studies. A total of 41 studies met the inclusion criteria, including 18 cohort and 23 case-control studies (109,507 patients with ovarian cancer and 2,558,182 control/non-ovarian cancer participants). Higher dietary intakes of total fat (RR = 1.19, 95% CI = 1.06-1.33, I2 = 60.3%), cholesterol (RR = 1.14, 95% CI = 1.03-1.26, I2 = 19.4%), saturated fat (RR = 1.13, 95% CI = 1.04-1.22, I2 = 13.4%), and animal fat (RR = 1.21, 95% CI = 1.01-1.43, I2 = 70.5%) were significantly associated with a higher risk of ovarian cancer. A higher level of serum triglycerides was accompanied by a higher risk of ovarian cancer (RR = 1.33, 95% CI = 1.02-1.72, I2 = 89.3%). This meta-analysis indicated that a higher daily intake of total fat, saturated fat, animal fat, and cholesterol and higher levels of serum triglycerides were significantly associated with an increased risk of ovarian cancer.

Early surgical treatment of closed reduction and internal fixation for a 30-day old intertrochanteric fracture with hemiplegia after acute stroke: A case report.

RATIONALE: Currently, there are no clear guidelines to determine whether and when to perform surgical hip repair in patients with acute stroke and hip fracture. PATIENT CONCERNS: In this case report, we report a case of 75-year-old woman admitted with left hip pain and limited mobility for 1 month. DIAGNOSES: Patient had a history of acute cerebral infarction 42 days ago, and diagnosed with a left intertrochanteric fracture at another hospital 30 days ago. INTERVENTION: Patient was treated with closed reduction and internal fixation with proximal femoral nail anti-rotation. OUTCOMES: At 2-year follow-up, the patient's basic function was restored. The fracture healed well, and the Harris hip score was 75. LESSONS: Without consistent guidelines, individualized treatment strategies including surgical methods and timing of surgery should be made to weigh the risks and benefits for patients with acute stroke and intertrochanteric fractures.

1α,25(OH)2D3 Radiosensitizes Cancer Cells by Activating the NADPH/ROS Pathway.

The radioresistance of tumors affect the outcome of radiotherapy. Accumulating data suggest that 1α,25(OH)2D3 is a potential anti-oncogenic molecule in various cancers. In the present study, we investigated the radiosensitive effects and underlying mechanisms of 1α,25(OH)2D3 in vitro and in vivo. We found that 1α,25(OH)2D3 enhanced the radiosensitivity of lung cancer and ovarian cancer cells by promoting the NADPH oxidase-ROS-apoptosis axis. Compared to the group that only received radiation, the survival fraction and self-renewal capacity of cancer cells treated with a combination of 1α,25(OH)2D3 and radiation were decreased. Both apoptosis and ROS were significantly increased in the combination group compared with the radiation only group. Moreover, N-acetyl-L-cysteine, a scavenger of intracellular ROS, reversed the apoptosis and ROS induced by 1α,25(OH)2D3, indicating that 1α,25(OH)2D3 enhanced the radiosensitivity of cancer cells in vitro by promoting ROS-induced apoptosis. Moreover, our results demonstrated that 1α,25(OH)2D3 promoted the ROS level via activating NADPH oxidase complexes, NOX4, p22phox, and p47phox. In addition, knockdown of the vitamin D receptor (VDR) abolished the radiosensitization of 1α,25(OH)2D3, which confirmed that 1α,25(OH)2D3 radiosensitized tumor cells that depend on VDR. Similarly, our study also evidenced that vitamin D3 enhanced the radiosensitivity of cancer cells in vivo and extended the overall survival of mice with tumors. In summary, these results demonstrate that 1α,25(OH)2D3 enhances the radiosensitivity depending on VDR and activates the NADPH oxidase-ROS-apoptosis axis. Our findings suggest that 1α,25(OH)2D3 in combination with radiation enhances lung and ovarian cell radiosensitivity, potentially providing a novel combination therapeutic strategy.

Somatic and germline mutations in the tumor suppressor gene PARK2 impair PINK1/Parkin-mediated mitophagy in lung cancer cells.

PARK2, which encodes Parkin, is a disease-causing gene for both neurodegenerative disorders and cancer. Parkin can function as a neuroprotector that plays a crucial role in the regulation of mitophagy, and germline mutations in PARK2 are associated with Parkinson's disease (PD). Intriguingly, recent studies suggest that Parkin can also function as a tumor suppressor and that somatic and germline mutations in PARK2 are associated with various human cancers, including lung cancer. However, it is presently unknown how the tumor suppressor activity of Parkin is affected by these mutations and whether it is associated with mitophagy. Herein, we show that wild-type (WT) Parkin can rapidly translocate onto mitochondria following mitochondrial damage and that Parkin promotes mitophagic clearance of mitochondria in lung cancer cells. However, lung cancer-linked mutations inhibit the mitochondrial translocation and ubiquitin-associated activity of Parkin. Among all lung cancer-linked mutants that we tested, A46T Parkin failed to translocate onto mitochondria and could not recruit downstream mitophagic regulators, including optineurin (OPTN) and TFEB, whereas N254S and R275W Parkin displayed slower mitochondrial translocation than WT Parkin. Moreover, we found that deferiprone (DFP), an iron chelator that can induce mitophagy, greatly increased the death of A46T Parkin-expressing lung cancer cells. Taken together, our results reveal a novel mitophagic mechanism in lung cancer, suggesting that lung cancer-linked mutations in PARK2 are associated with impaired mitophagy and identifying DFP as a novel therapeutic agent for PARK2-linked lung cancer and possibly other types of cancers driven by mitophagic dysregulation.

Evaluation of the association between urinary cadmium levels below threshold limits and the risk of diabetes mellitus: a dose-response meta-analysis.

As cadmium levels are increasing in the environment, the adverse effects of cadmium exposure specifically associated with chronic diseases are receiving increasing attention. Several population-based studies have been conducted on the association between cadmium and diabetes mellitus (DM) but have reported controversial results. Here, we aimed to evaluate the association between cadmium exposure and DM. In this meta-analysis, a random effects model was used because there was evidence of heterogeneity among studies. A dose-response relationship was assessed through a restricted cubic spline model with three knots. The results showed a positive association between cadmium levels in the body and DM (OR = 1.27; 95% CI, 1.07-1.52). The cadmium levels in the body were defined on the basis of combined urinary and blood cadmium. Subgroup analysis further indicated a positive association between urinary cadmium levels and DM (OR = 1.31; 95% CI, 1.02-1.69). The dose-response analysis results showed a positive association between levels of urinary cadmium above 2.43 µg/g creatinine and DM, and the risk of DM increased by 16% for each l µg/g creatinine increase in urinary cadmium levels. The results from our meta-analysis indicate that cadmium levels in the body are positively associated with DM, and urinary cadmium levels above 2.43 µg/g creatinine are associated with an increased risk of DM.

Nut consumption in relation to all-cause and cause-specific mortality: a meta-analysis 18 prospective studies.

Several previous meta-analyses show a consistent inverse association between nut consumption and all-cause mortality, but the associations with cause-specific mortality remain uncertain. A recent meta-analysis on nut consumption and multiple health outcomes combined incidence and mortality outcomes across most of the analyses, which may have introduced heterogeneity across studies. We conducted an updated meta-analysis to evaluate the nut-mortality association. We searched PubMed and EMBASE and we contacted authors for additional data. The final analyses included 18 prospective studies. The random-effects summary RRs for high compared with low nut consumption were 0.81 (95% CI: 0.78-0.84) for all-cause mortality (18 studies with 81 034 deaths), 0.75 (95% CI: 0.71-0.79) for CVD mortality (17 studies with 20 381 deaths), 0.73 (95% CI: 0.67-0.80) for CHD mortality (14 studies with 10 438 deaths), 0.82 (95% CI: 0.73-0.91) for stroke mortality (13 studies with 4850 deaths) and 0.87 (95% CI: 0.80-0.93) for cancer mortality (11 studies 21 353 deaths). These results were broadly consistent within subgroups according to various study and population characteristics and within sensitivity analyses that took into account potential confounders. Peanut (5 studies) and tree nut (3 studies) consumption were similarly associated with mortality risks. Dose-response analyses suggested evidence for nonlinear associations between nut consumption and mortality (P-nonlinearity <0.001 for all outcomes except cancer mortality), with mortality risk levelling off at the consumption of about 3 servings per week (12 g d-1). Our findings suggest that nut consumption is associated with reduced all-cause and cause-specific mortality, with the strongest reduction for CHD mortality. Both tree nuts and peanuts may lower mortality and most of the survival benefits may be achieved at a relative low level of nut consumption.

Alleviation of ischaemia-reperfusion injury by endogenous estrogen involves maintaining Bcl-2 expression via the ERα signalling pathway.

The neuroprotective effects of estrogen against cerebral ischaemia have been confirmed by multiple basic and clinical studies. However, most of these studies used exogenous estrogen administered via different injection methods, and the neuroprotective effects of endogenous estrogen produced by ovaries during different phases of estrous cycle and the underlying mechanisms involved have rarely been explored. In this study, we first identified the stage of estrous cycle via vaginal smears and then measured serum estradiol levels at each phase via radioimmunoassay. We found that the estradiol level was highest in the proestrous and lowest in the diestrous. However, ovariectomy or treatment with the aromatase inhibitor letrozole significantly decreased estradiol levels compared to that of rats in diestrous. Western blotting showed that ovariectomy or letrozole treatment significantly decreased ERα and Bcl-2 protein expression and dramatically increased Bax protein expression compared with the rats in diestrous or proestrous. Rats also underwent 2h of ischaemia via middle cerebral artery occlusion followed by a 24-h reperfusion. Ovariectomy or letrozole treatment significantly decreased the neurological scores and the number of intact neurons detected via Nissl staining and dramatically increased the infarct volume detected via TTC staining and the extent of apoptosis detected via TUNEL staining and Western blotting for cleaved-caspase 3 protein expression. These results demonstrate that endogenous estrogen alleviates ischaemia-reperfusion injury by maintaining Bcl-2 expression via ERα signalling pathway and highlight the neuroprotective effects of endogenous estrogen during different stages of the estrous cycle, providing preliminary information on the underlying mechanism of this process.

1α,25(OH)2D3 Suppresses the Migration of Ovarian Cancer SKOV-3 Cells through the Inhibition of Epithelial-Mesenchymal Transition.

Ovarian cancer is the most lethal gynecological malignancy due to its high metastatic ability. Epithelial-mesenchymal transition (EMT) is essential during both follicular rupture and epithelium regeneration. However, it may also accelerate the progression of ovarian carcinomas. Experimental studies have found that 1α,25-dihydroxyvitamin-D3 [1α,25(OH)2D3] can inhibit the proliferation of ovarian cancer cells. In this study, we investigated whether 1α,25(OH)2D3 could inhibit the migration of ovarian cancer cells via regulating EMT. We established a model of transient transforming growth factor-ß1(TGF-ß1)-induced EMT in human ovarian adenocarcinoma cell line SKOV-3 cells. Results showed that, compared with control, 1α,25(OH)2D3 not only inhibited the migration and the invasion of SKOV-3 cells, but also promoted the acquisition of an epithelial phenotype of SKOV-3 cells treated with TGF-ß1. We discovered that 1α,25(OH)2D3 increased the expression of epithelial marker E-cadherin and decreased the level of mesenchymal marker, Vimentin, which was associated with the elevated expression of VDR. Moreover, 1α,25(OH)2D3 reduced the expression level of transcription factors of EMT, such as slug, snail, and ß-catenin. These results indicate that 1α,25(OH)2D3 suppresses the migration and invasion of ovarian cancer cells by inhibiting EMT, implying that 1α,25(OH)2D3 might be a potential therapeutic agent for the treatment of ovarian cancer.

Circulating 25-hydroxyvitamin D and risk of lung cancer: a dose-response meta-analysis.

BACKGROUND: Mounting experimental evidence supports a protective effect of high 25-hydroxyvitamin D (25[OH]D), a good indicator of vitamin D status, on risk of various cancers including lung cancer. However, prospective observational studies examining the 25(OH)D-lung cancer association reported inconsistent findings. A dose-response meta-analysis was carried out to elucidate the subject. METHODS: Potentially eligible studies were identified by searching PubMed and EMBASE databases, and by carefully reviewing the bibliographies of retrieved publications. The summary relative risks (RRs) with 95% confidence intervals (CIs) were calculated using the random-effects model. RESULTS: Thirteen reports from ten prospective studies were included, totaling 2,227 lung cancer events. Results of the meta-analysis showed a significant 5% (RR 0.95, 95% CI 0.91-0.99) reduction in the risk of lung cancer for each 10 nmol/L increment in 25(OH)D concentrations. This inverse association was not significantly modified by area, study duration, sex, methods for 25(OH)D measurement, baseline 25(OH)D levels, or quality score of included studies. There was evidence of a nonlinear relationship between 25(OH)D and risk of lung cancer (p-nonlinearity = 0.02), with the greatest reductions in risk observed at 25(OH)D of nearly 53 nmol/L, and remained protective until approximately 90 nmol/L. Further increases showed no significant association with cancer risk, but scanty data were included in the analyses of high-level 25(OH)D. There was no evidence of publication bias. CONCLUSION: This dose-response meta-analysis of prospective studies suggests that 25(OH)D may be associated with reduced risk of lung cancer, in particular among subjects with vitamin D deficiencies.

[Effect of soluble PD-L1 released by lung cancer cells in regulating the function of T lymphocytes].

OBJECTIVE: To explore the expression of soluble programmed death ligand-1 on lung cancer cells and to clarify its biological function through PD-1/PD-L1 pathway in regulating the function of T lymphocytes. METHODS: Labeled monoclonal antibody and flow cytometry were used to analyze the expression of PD-L1 and its receptor PD-l on lung cancer cells and human T lymphocytes, respectively. The level of sPD-L1 in the supernatant of lung cancer cells was determined with an ELISA kit. The inhibition of proliferation of T lymphocytes by mPD-L1 and sPD-L1 was studied using CCK-8 incorporation. RESULTS: Low or no expression [(16.08 ± 2.28)%] of PD-1 was found on resting T lymphocytes from human peripheral blood with flow cytometry, but up-regulated expression of PD-1 [(78.06 ± 7.21)%] was found on the surface of activated T lymphocytes. Soluble PD-L1 was found in supernatant of some lung cancer cell lines, such as H1299, HO8910, SPCA-1, H460, H446 cells, with PD-L1 expressing on their cell surface [(78.34 ± 10.25)%, (68.17 ± 11.56)%, (45.32 ± 7.98)%, (47.52 ± 9.62)% and (40.95 ± 8.56)%, respectively], but very low expression on A549 cells [(16.02 ± 6.28)%]. The level of mPD-L1 on H1299 cells was highest [(78.34 ± 10.25)%], compared with HO8910 cells (68.17 ± 11.56)%, SPCA-1 cells (45.32 ± 7.98)%, H446 cells (40.95 ± 8.56)%, and H460 cells (47.52 ± 9.62)%. At the same time, the sPD-L1 level on H1299 cells was low [(0.17 ± 0.01) ng/ml], compared with HO8910 cells (0.30 ± 0.03) ng/ml, SPCA-1cells (0.59 ± 0.03) ng/ml, H446 cells (0.34 ± 0.02) ng/ml, and H460 cells (0.57 ± 0.03) ng/ml, but not expressed on A549 cells. PD-L1 expressing H1299 cells inhibited the proliferation of T lymphocytes in the co-culture system. Supernatant of the cultured PD-L1(+) lung cancer cells also inhibited T cell proliferation. Anti-human PD-L1 blocking antibody could partly restore the proliferation capacity of T lymphocytes. CONCLUSIONS: Membrane-bound PD-L1 and soluble PD-L1 released from lung cancer cells can effectively inhibit the proliferation of T lymphocytes in mixed culture system and down-regulate cell-mediated immunity in vitro. This may lead to inactivation of tumor antigen-specific T cells and immune escape of lung cancer cells.

[The effect of ferric ion on the differentiation of osteoclast and bone resorption].

OBJECTIVE: To explore the effects of ferric ion on the differentiation from both RAW264.7 and bone marrow macrophages to osteoclast in vitro and bone resorption in vivo. METHODS: In the presence of 50 ng/ml receptor activator of nuclear factor kappa-B ligand (RANKL), RAW264.7 was treated with ferric ammonium citrate (FAC). The formation of osteoclast was observed by staining of tartrate-resistant acid phosphatase (TRAP) and the TRAP positive cell counted. The expression levels of TRAP, cathepsin-K, nuclear factor of activated T cells c1 (NFATc1) and (receptor activator of NF-κB) RANK were measured by reverse transcription-polymerase chain reaction (RT-PCR).The control and iron overload groups were established by the intraperitoneal injection of normal saline and FAC. In vivo imaging system was employed to determine the bone density of femoral midportion and the fourth lumbar vertebra. After that, the bone marrow cells of femurs were used for osteoclast culture. The serum levels of ferritin, TRAP-5b, RANKL, osteoprotegerin (OPG) and C-terminal cross-linking telopeptide (CTX) were measured by enzyme-linked immunosorbent assay (ELISA). RESULTS: Ferric ion could stimulate the formation of TRAP positive cells in a dose-dependent manner. The expression levels of TRAP, cathepsin-K and NFATc1 in the FAC treated group were significantly higher those of the control group (P < 0.05) while the expression of RANK showed no statistical difference among these groups (P = 0.967). The bone marrow density of femoral midportion and the fourth lumbar vertebra of the iron-overload group decreased significantly versus the control group. The concentrations of ferritin, TRAP-5b, RANKL and CTX of the iron overload group were markedly higher than those of the control group (P < 0.05). Moreover, the concentration of ferritin showed a positive correlation with TRAP-5b and CTX respectively in the iron-overload group (r = 0.65, r = 0.76, P < 0.05). But no significant differences existed in the concentration of OPG for two groups (P > 0.05). CONCLUSION: Ferric ion may enhance the differentiation of osteoclast in vitro as well as bone resorption in vivo.

Residential radon and lung cancer risk: an updated meta- analysis of case-control studies.

BACKGROUND: Numbers of epidemiological studies assessing residential radon exposure and risk of lung cancer have yielded inconsistent results. METHODS: We therefore performed a meta-analysis of relevant published case- control studies searched in the PubMed database through July 2011 to examine the association. The combined odds ratio (OR) were calculated using fixed- or random-effects models. Subgroup and dose-response analyses were also performed. RESULTS: We identified 22 case-control studies of residential radon and lung cancer risk involving 13,380 cases and 21,102 controls. The combined OR of lung cancer for the highest with the lowest exposure was 1.29 (95% CI 1.10-1.51). Dose-response analysis showed that every 100 Bq/m3 increment in residential radon exposure was associated with a significant 7% increase in lung cancer risk. Subgroup analysis displayed a more pronounced association in the studies conducted in Europe. Studies restricted to female or non-smokers demonstrated weakened associations between exposure and lung cancer. CONCLUSIONS: This meta- analysis provides new evidence supporting the conclusion that residential exposure to radon can significantly increase the risk of lung cancer in a dose-response manner.

Ferric ion could facilitate osteoclast differentiation and bone resorption through the production of reactive oxygen species.

Iron overload is widely regarded as a risk factor for osteoporosis. It has been demonstrated that iron can inhibit osteoblast differentiation. However, the effects of iron on osteoclast differentiation and bone resorption remain controversial. In this study, we found that ferric ion promoted Receptor Activator of Nuclear Factor κ B Ligand (RANKL)-induced osteoclast (OC) formation in both RAW264.7 cells and bone marrow-derived macrophages (BMMs), and this effect was accompanied by elevated levels of reactive oxygen species (ROS) and oxidative stress. Moreover, this effect was attenuated by the administration of antioxidant N-acetyl-L-cysteine (NAC). Therefore, we conclude that ferric ion can promote osteoclast differentiation and bone resorption through the production of ROS.

[The level of soluble programmed death-1 in peripheral blood of patients with lung cancer and its clinical implications].

OBJECTIVE: To analyze the expression of soluble programmed death-1 ligand 1 (sPD-L1) in the serum of patients with lung cancer and to explore its biological and clinical implications. METHODS: Fifty-five male and twenty-six female lung cancer patients ages 34 to 87 years (mean age 65 ± 6) were selected from the Department of Respiratory Diseases in The Second Affiliated Hospital of Soochow University from June 2009 to March 2011. All lung cancer patients were newly-diagnosed, treatment-free and confirmed by histopathology or cytopathology. Eight-eight healthy volunteers matching in sex and age from the Healthcare Center of the hospital were also enrolled as controls. The sPD-L1 protein expression in serum was determined by Western blot and self-developed ELISA kit. Fluorescence-labeled monoclonal antibody and cytometry were used to examine changes in lymphocyte subsets in the peripheral blood of lung cancer patients and healthy controls. RESULTS: A higher level of sPD-L1 level in the lung cancer patients [1.6 (0.7 - 7.8) µg/L] was found compared to the control group [0.9 (0.4 - 3.7) µg/L] (P < 0.001). High expression of sPD-L1 in the lung cancer patients was closely correlated to lymph node metastasis and the extent of distant metastasis (χ(2) = 5.636, P < 0.05; χ(2) = 4.601, P < 0.05). The sPD-L1 level in lung cancer patients with objective response to treatment (complete response + partial response) was 2.7 (1.6 - 7.0) µg/L and 1.1 (0.8 - 1.7) µg/L before and after treatment, respectively (P < 0.01). The level of sPD-L1 with progression disease was 1.9 (1.3 - 8.5 µg/L) which was significantly increased compared to the baseline level 1.4 (0.8 - 2.2) µg/L (P < 0.01). Additionally, abnormal changes of T and B lymphocytes and their subsets were found, with a significant decrease of CD(8)(+) T lymphocytes (P < 0.05) and a rise in CD(4)/CD(8) ratio (P < 0.05). Further double-labeling study showed increased percentages of CD(4)(+)PD-1(+) T lymphocytes and CD(8)(+)PD-1(+) T lymphocytes (P < 0.05). CONCLUSIONS: The elevated expression of sPD-L1 in lung cancer patients was closely related to lung cancer staging, metastasis and clinical response. sPD-L1 may become a predictive marker and an important anti-tumor target in individualized treatment of lung cancer.

Carvacrol, a food-additive, provides neuroprotection on focal cerebral ischemia/reperfusion injury in mice.

Carvacrol (CAR), a naturally occurring monoterpenic phenol and food additive, has been shown to have antimicrobials, antitumor, and antidepressant-like activities. A previous study demonstrated that CAR has the ability to protect liver against ischemia/reperfusion injury in rats. In this study, we investigated the protective effects of CAR on cerebral ischemia/reperfusion injury in a middle cerebral artery occlusion mouse model. We found that CAR (50 mg/kg) significantly reduced infarct volume and improved neurological deficits after 75 min of ischemia and 24 h of reperfusion. This neuroprotection was in a dose-dependent manner. Post-treatment with CAR still provided protection on infarct volume when it was administered intraperitoneally at 2 h after reperfusion; however, intracerebroventricular post-treatment reduced infarct volume even when the mice were treated with CAR at 6 h after reperfusion. These findings indicated that CAR has an extended therapeutic window, but delivery strategies may affect the protective effects of CAR. Further, we found that CAR significantly decreased the level of cleaved caspase-3, a marker of apoptosis, suggesting the anti-apoptotic activity of CAR. Finally, our data indicated that CAR treatment increased the level of phosphorylated Akt and the neuroprotection of CAR was reversed by a PI3K inhibitor LY-294002, demonstrating the involvement of the PI3K/Akt pathway in the anti-apoptotic mechanisms of CAR. Due to its safety and wide use in the food industry, CAR is a promising agent to be translated into clinical trials.

Enhanced radiosensitivity in 1,25-dihydroxyvitamin D3 deficient mice.

To investigate whether impaired osteogenesis resulting from vitamin D deficiency can influence hematopoiesis recovery after radiation, the 25-hydroxyvitamin D-1α-hydroxylase (1α-hydroxylase) gene knockout (KO) mice and wild type (WT) mice were subjected to different doses of gamma ray. The survival rates, peripheral blood cell counts and bone marrow cellularity were studied after irradiation (IR). The survival rates of the KO mice were significantly lower than that of WT mice after 6 or 8 Gy dose of radiation. The recovery of white blood cells in KO mice was significantly delayed compared with that in WT mice after radiation. The red blood cell number in WT mice was observed to increase more than that in KO mice at days 14 and 28 after radiation. The nadir platelet count in KO mice was nearly half of that in WT mice. Dramatically higher bone marrow cell numbers were found in WT mice compared with KO mice. Our findings demonstrate the enhanced radiosensitivity in 1,25-dihydroxyvitamin D3 (1,25-(OH)(2)D(3)) deficient mice.

[Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells].

OBJECTIVE: To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells. METHODS: PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy. RESULTS: The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference. CONCLUSION: Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

[Relationship between polymorphisms of DNA repair gene XRCC3 and susceptibility to lung cancer].

OBJECTIVE: To study the polymorphisms of DNA repair gene XRCC3 and the relationship between genetic variations and susceptibility to lung cancer. METHODS: A case-control study of 291 patients with lung cancer and 273 cancer-free subjects as a control group was conducted from September 2006 to January 2007 to detect XRCC3 polymorphisms at loci. Genotypes of XRCC3 were analyzed by real time PCR using Taqman probes. RESULTS: Compared with never smoking subjects with wild homozygous genotype (Thr/Thr), smokers with the same genotytpe (Thr/Thr) had increased risk of lung cancer, adjusted odds ratio (OR) was 2.467 (95% CI: 1.49 - 4.08, P < 0.001). Smokers with the heterozygous genotype (Thr/Met) also had increased risk of lung cancer, adjusted OR was 2.283 (95% CI: 1.21 - 6.60, P < 0.05). XRCC3 codon 241 homozygous genotype (Thr/Thr) and pack-years of smoking less than 30 had a weak protective effect on adenocarcinoma (OR = 0.49, 95% CI: 0.26 - 0.93, P < 0.05). Allel Met of XRCC3 codon 241 and smoking conferred an increased risk of squamous cell carcinoma (OR = 9.69, 95% CI: 3.27 - 28.72, P < 0.01). Those with allel Met of XRCC3 codon 241 and pack-years of smoking less than 30 or more than 30 had different risk of squamous cell carcinoma, the OR was 8.00 (95% CI: 1.97 - 32.52, P < 0.01), and 11.67 (95% CI: 2.98 - 45.73, P < 0.01) respectively. CONCLUSION: The results demonstrated that genetic polymorphism of XRCC3 DNA repair gene may contribute to the susceptibility to lung cancer and have synergistic effect with smoking.

[Exogenous estrogen improved calcium homeostasis and skeletal mineralization in vitamin D receptor gene knockout female mice].

It is well known that estrogen can inhibit bone absorption, decrease bone turnover and preserve bone mass. Some studies indicated that the effect of estrogen on calcium and bone is relative to vitamin D system, while others also reported that this effect of estrogen is independent of vitamin D. The genomic effect of 1alpha, 25(OH)(2)D(3)is mediated by the nuclear vitamin D receptor (VDR) in a ligand-dependent manner. Hypocalcemia, hyperparathyroidism and osteomalacia are developed in VDR gene knockout mice. To determine whether the effect of estrogen on calcium and bone is dependent on VDR, this study examined the effect of exogenous estrogen on calcium and bone homeostasis in VDR gene knockout mice. Male and female wild type (WT) and VDR gene knockout heterozygous mice were mated each other and the genotyping of their offsprings were determined by PCR. At age of 21-day, WT and knockout mice were weaned and treated by one of three different regimens: (1) WT-vehicle group: the WT mice were injected with normal saline; (2) VDR KO-vehicle group: the VDR gene knockout mice were injected with normal saline; (3) VDR KO-E group: the VDR gene knockout mice were subcutaneously injected with estradiol, 0.2 mug per mouse, once daily for 1 month. The bone mineral density (BMD) of mice was measured using dual-energy X-ray absorptiometry. All mice were sacrificed at age of 50-day. Blood was taken by heart puncture under anesthesia and serum calcium was measured by autoanalyser.Tibiae were removed, fixed and embedded with the methylmethacrylate (MMA), and undecalcified sections were cut. These sections were stained for mineral with the von Kossa staining procedure and counterstained with toluidine blue. Static histomorphometric analyses were performed on those stained sections. The results showed that the serum calcium level was (2.10+/-0.37) mmol/L in the VDR KO-vehicle mice and rose to (2.80+/-0.41) mmol/L in the VDR KO-E mice although it was still lower than WT-vehicle mice [(3.10+/-0.48) mmol/L]. BMD and mineralized trabeculer volume were increased significantly in VDR KO-E group compared with that in VDR KO-vehicle group. These results suggest that exogenous estrogen can improve calcium absorption and skeletal mineralization in a VDR-independent manner.