RESUMO
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
Chemo-photothermal/photodynamic synergistic therapy is a new effective cancer treatment method to overcome the limitations of single chemotherapy. However, the limited low photothermal conversion efficiency, the hypoxic tumor microenvironment, and premature leakage of the drug constrain their clinical applications. To address these challenges, an all-in-one biodegradable polydopamine-coated UiO-66 framework nanomedicine (DUPM) was developed to co-deliver the drug doxorubicin hydrochloride (DOX) and the excellent photothermal material MoOx nanoparticles (NPs). The results showed that DUPM exhibited good physicochemical stability and efficiently accumulated tumor tissues under pH-, glutathione-, and NIR-triggered drug release behaviour. Of note, the synthesized MoOx NPs endowed DUPM with self-supporting oxygen production and generated more reactive oxygen species (1O2 and·OH), besides, it induces Mo-mediated redox reaction to deplete excessive glutathione thus relieving tumor hypoxia to enhance PDT, further improving synergistic therapy. Meanwhile, DUPM showed strong absorption in the near-infrared range and high photothermal conversion efficiency at 808 nm (51.50%) to realize photoacoustic imaging-guided diagnosis and treatment of cancer. Compared with monotherapy, the in vivo anti-tumor efficacy results showed that DUMP exerted satisfactory tumor growth inhibition effects (94.43%) with good biocompatibility. This study provides a facile strategy to develop intelligent multifunctional nanoparticles with tumor hypoxia relief for improving synergistic therapy and diagnosis against breast cancer.
Assuntos
Neoplasias da Mama , Nanopartículas , Técnicas Fotoacústicas , Fotoquimioterapia , Humanos , Feminino , Neoplasias da Mama/diagnóstico por imagem , Neoplasias da Mama/tratamento farmacológico , Técnicas Fotoacústicas/métodos , Hipóxia Tumoral , Doxorrubicina/farmacologia , Doxorrubicina/uso terapêutico , Glutationa , Linhagem Celular Tumoral , Fotoquimioterapia/métodos , Microambiente TumoralRESUMO
Purpose: To explore the effectiveness of the model based on non-negative matrix factorization (NMF), analyze the tumor microenvironment and immune microenvironment for evaluating the prognosis of lung adenocarcinoma, establish a risk model, and screen independent prognostic factors. Methods: Downloading the transcription data files and clinical information files of lung adenocarcinoma from TCGA database and GO database, the R software was used to establish the NMF cluster model, and then the survival analysis between groups, tumor microenvironment analysis, and immune microenvironment analysis was performed according to the NMF cluster result. R software was used to construct prognostic models and calculate risk scores. Survival analysis was used to compare survival differences between different risk score groups. Results: Two ICD subgroups were established according to the NMF model. The survival of the ICD low-expression subgroup was better than that of the ICD high-expression subgroup. Univariate COX analysis screened out HSP90AA1, IL1, and NT5E as prognostic genes, and the prognostic model established on this basis has clinical guiding significance. Conclusion: The model based on NMF has the prognostic ability for lung adenocarcinoma, and the prognostic model of ICD-related genes has a certain guiding significance for survival.
RESUMO
Background: Effective treatment for patients with advanced unresectable hepatocellular carcinoma (HCC) is severely lacking. The most common clinical treatments include a combination of immunotherapy, molecular targeted agents, and transarterial chemoembolization (TACE). The combinations of therapies most likely to lead to complete recovery are unclear. The cases in this study were treated with TACE therapy and radiofrequency ablation followed by massive tumor antigen release as a way to enhance the effect of immune and targeted therapy, and TACE therapy followed by combination with programmed death 1 (PD-1) inhibitors and molecular targeted drugs may achieve better efficacy. We share two cases of advanced HCC patients who achieved complete response (CR) after treatment with PD-1 inhibitor combined with Lenvatinib and TACE and radiofrequency ablation to provide a reference for the treatment choice of advanced HCC patients. Case Description: We report two case studies of two Chinese men with advanced primary HCC (Barcelona Clinic Liver Cancer stage C) involving portal vein carcinoma thrombosis and Child-Pugh A liver function. Complete regression of the lesions and thrombosis was reached after TACE and radiofrequency ablation, followed by the combination of PD-1 inhibitor and Lenvatinib. Conclusions: We speculate that patients with advanced HCC with Child-Pugh A liver function may have better efficacy if they are treated with TACE and radiofrequency ablation followed by tumor necrosis and release of intratumoral antigens to achieve the effect of intensive immune and targeted therapy, and then sequential application of PD-1 inhibitors combined with molecular targeted drugs for conversion therapy. Further stimulate the body's immunity, so that the patient may reach CR. However, because surgical resection pathology was not performed, it is not clear whether pathological CR was achieved and the future prognosis remains to be further observed.
RESUMO
BACKGROUND: Ovarian cancer (OVC) is a devastating disease worldwide; therefore the identification of prognostic biomarkers is urgently needed. We aimed to determine a robust microRNA signature-based risk score system that could predict the overall survival (OS) of patients with OVC. METHODS: We extracted the microRNA expression profiles and corresponding clinical data of 467 OVC patients from The Cancer Genome Atlas (TCGA) database and further divided this data into training, validation and complete cohorts. The key prognostic microRNAs for OVC were identified and evaluated by robust likelihood-based survival analysis (RLSA) and multivariable Cox regression. Time-dependent receiver operating characteristic (ROC) curves were then constructed to evaluate the prognostic performance of these microRNAs. A total of 172 ovarian cancer samples and 162 normal ovarian tissues were used to verify the credibility and accuracy of the selected markers of the TCGA cohort by quantitative real-time polymerase chain reaction (PCR). RESULTS: We successfully established a risk score system based on a six-microRNA signature (hsa-miR-3074-5p, hsa-miR-758-3p, hsa-miR-877-5p, hsa-miR-760, hsa-miR-342-5p, and hsa-miR-6509-5p). This microRNA based system is able to characterize patients as either high or low risk. The OS of OVC patients, with either high or low risk, was significantly different when compared in the training cohort (p < 0.001), the validation cohort (p < 0.001) and the complete cohort (p < 0.001). Analysis of clinical samples further demonstrated that these microRNAs were aberrantly expressed in OVC tissues. The six-miRNA-based signature was correlated with the prognosis of OVC patients (p < 0.001). CONCLUSIONS: The study established a novel risk score system that is predictive of patient prognosis and is a potentially useful guide for the personalized treatment of OVC patients.
Assuntos
MicroRNAs , Neoplasias Ovarianas , Biomarcadores Tumorais/genética , Biomarcadores Tumorais/metabolismo , Carcinoma Epitelial do Ovário , Feminino , Perfilação da Expressão Gênica , Humanos , Funções Verossimilhança , MicroRNAs/genética , MicroRNAs/metabolismo , Neoplasias Ovarianas/genética , Prognóstico , Fatores de RiscoRESUMO
BACKGROUND: Lenvatinib is regarded as the first-line therapy for patients with unresectable hepatocellular carcinoma (HCC). This study assessed the efficacy and safety of lenvatinib with or without immune checkpoint inhibitors (ICIs) in patients with unresectable HCC. METHODS: In this multicentric retrospective study, patients with unresectable HCC who treated with lenvatinib with or without ICIs would be enrolled. Overall survival, progression-free survival, objective response rate, and disease control rate were calculated to assess the antitumor response. RESULTS: Between January 2019 and August 2020, 65 patients received lenvatinib plus ICIs while other 45 patients received lenvatinib. The baseline characteristics were comparable between the two groups. Lenvatinib plus ICIs provided significantly higher overall survival (hazard ratio = 0.47, 95% CI 0.26-0.85; p = 0.013) and progression-free survival (hazard ratio = 0.35, 95% CI 0.20-0.63; p < 0.001) than lenvatinib monotherapy. Moreover, patients with lenvatinib plus ICIs had significantly higher objective response rate (41.5% vs 20.0%, p = 0.023) and disease control rate (72.3% vs 46.7%, p = 0.009) per RECIST v1.1 than those with lenvatinib. No treatment-related deaths were observed. Grade 3 or greater adverse events occurring in 10% or more of patients in either treatment group were hypertension [13 (20.0%) of 65 patients treated with lenvatinib plus ICIs vs 8 (17.8%) of 45 patients treated with lenvatinib], and palmar-plantar erythrodysesthesia [seven (10.8%) vs two (4.4%)]. CONCLUSIONS: In this real-world study, lenvatinib combined with ICIs showed significantly promising efficacy and manageable safety than lenvatinib alone in patients with unresectable HCC.
Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , Carcinoma Hepatocelular/patologia , Humanos , Inibidores de Checkpoint Imunológico/uso terapêutico , Neoplasias Hepáticas/patologia , Compostos de Fenilureia/uso terapêutico , Quinolinas , Estudos RetrospectivosRESUMO
Herein, polypyrrole/titanium oxide/reduced graphene oxide (PTi/r-GO) electrodes were prepared and successfully applied for the photoelectrocatalytic (PEC) degradation of methyl orange (MO) under visible light. Polypyrrole-TiO2 composites rich in p-n heterojunctions were first prepared, then modified with r-GO to improve the electrical conductivity and facilitate charge separation under visible light irradiation. The obtained PTi/r-GO composites were then deposited onto a titanium mesh, which served as the working electrode in PEC experiments. A MO removal efficiency of 93% was achieved in 50 min using PTi/r-GO electrode under PEC conditions (Xe lamp, λ > 420 nm, bias of 0.6 V, 0.1 M Na2SO4 electrolyte), which was far higher than MO removal efficiencies under electrocatalytic oxidation (22%) or photocatalytic oxidation (47%) conditions. This confirmed that excellent activity of the PTi/r-GO electrode under PEC conditions was due to a combination of electrochemical and photocatalytic oxidation processes (involving â¢OH and â¢O2- generation). Further, PTi/r-GO was very stable under the applied PEC conditions, with the MO removal efficiency remaining >90% after five cycles. PEC degradation pathways for MO on PTi/r-GO were explored, with a number of key intermediates in the MO mineralization process identified. Results demonstrate that PEC electrodes combining p-type polypyrrole, n-type TiO2 and rGO are very effective in the treatment of hazardous organic compounds in wastewater.
Assuntos
Polímeros , Titânio , Catálise , Corantes , Eletrodos , Grafite , Luz , PirróisRESUMO
BACKGROUND AND AIMS: Protein phosphatase 2A (PP2A) is associated with many cancers. This study aimed to clarify whether PPP2CA, which encodes the alpha isoform of the catalytic subunit of PP2A, plays a role in hepatocellular carcinoma (HCC) and to identify the potential underlying molecular pathways. METHODS: Based on bioinformatics, public databases and our in-house RNA-Seq database, we analyzed the clinical value and molecular mechanism of PPP2CA in HCC. RESULTS: Data were analyzed from 2,545 patients with HCC and 1,993 controls without HCC indexed in The Cancer Genome Atlas database, the Gene Expression Omnibus database and our in-house RNA-Seq database. PPP2CA expression was significantly higher in HCC tissue than in non-cancerous tissues (standardized mean difference: 0.69, 95% confidence interval [CI]: 0.50-0.89). PPP2CA expression was able to differentiate HCC from non-HCC, with an area under the summary receiver operator characteristic curve of 0.79 (95% CI: 0.75-0.83). Immunohistochemistry of tissue sections confirmed that PPP2CA protein was up-regulated in HCC tissues. High PPP2CA expression in HCC patients was associated with shorter overall, progression-free and disease-free survival. Potential molecular pathways through which PPP2CA may be involved in HCC were determined using miRWalk 2.0 as well as analysis of Gene Ontology categories, Kyoto Encyclopedia of Genes and Genomes pathways, and protein-protein interaction networks. CONCLUSIONS: PPP2CA is up-regulated in HCC and higher expression correlates with worse prognosis. PPP2CA shows potential as a diagnostic marker for HCC. Future studies should examine whether PPP2CA contributes to HCC through the candidate microRNAs, pathways and hub genes identified in this study.
RESUMO
Efficient CO2 reduction with earth-abundant photocatalysts is a highly attractive but very challenging process for chemists. Herein, we synthesized an indium-porphyrin framework, In(H2TCPP)(1-n)[Fe(TCPP)(H2O)](1-n)[DEA](1-n) (In-FenTCPP-MOF; H2TCPP = tetrakis(4-benzoic acid)porphyrine; DEA = diethylamine), with a porphyrin ring supporting the single-site iron for the high-performance visible-light-driven conversion of CO2 to CO. A high CO yield of 3469 µmol g-1 can be achieved by a 24 h photocatalytic reaction with a high CO selectivity (ca. 99.5%). This activity was much higher than that of its cobalt analogues or the Fe-free indium-based metal-organic framework (MOF). Systematic experimental and theoretical studies indicate that the porphyrin-supported iron centers in the MOF matrix serve as efficient active sites, which can accept electrons from the photoexcited MOFs in order to mediate CO2 reduction.
RESUMO
Background: The number of patients suffering from coronary heart disease with cancer is rising. There is scarce evidence concerning the biomarkers related to prognosis among patients undergoing percutaneous coronary intervention (PCI) with cancer. Thus, the aim of this study was to investigate the association between red blood cell distribution width (RDW) and prognosis in this population.Methods: A total of 172 patients undergoing PCI with previous history of cancer were enrolled in this retrospective study. The endpoint was long-term all-cause mortality. According to tertiles of RDW, the patients were classified into three groups: Tertile 1 (RDW <12.8%), Tertile 2 (RDW ≥12.8% and <13.5%) and Tertile 3 (RDW ≥13.5%).Results: During an average follow-up period of 33.3 months, 29 deaths occurred. Compared with Tertile 3, mortality of Tertile 1 and Tertile 2 was significantly lower in the Kaplan-Meier analysis. In multivariate Cox regression analysis, RDW remained an independent risk factor of mortality (HR: 1.938, 95% CI: 1.295-2.655, p < 0.001). The all-cause mortality in Tertile 3 was significantly higher than that in Tertile 1 (HR: 5.766; 95% CI: 1.426-23.310, p = 0.014).Conclusions: An elevated RDW level (≥13.5%) was associated with long-term all-cause mortality among patients undergoing PCI with previous history of cancer.
Assuntos
Biomarcadores/sangue , Doença das Coronárias/cirurgia , Índices de Eritrócitos , Eritrócitos/metabolismo , Neoplasias/complicações , Intervenção Coronária Percutânea/métodos , Idoso , Doença das Coronárias/complicações , Doença das Coronárias/mortalidade , Feminino , Humanos , Estimativa de Kaplan-Meier , Masculino , Pessoa de Meia-Idade , Prognóstico , Estudos Retrospectivos , Fatores de Risco , Taxa de SobrevidaRESUMO
Aim: To explore clinical factors associated with extent of liver regeneration after hemihepatectomy to treat hepatocellular carcinoma (HCC).Methods: Future liver remnant volume (as a percentage of functional liver volume, %FLRV) and remnant liver volume were measured preoperatively and at 1, 5, 9, and 13 weeks postoperatively.Results: After hepatectomy, 1 of 125 patients (0.8%) died within 3 months, 13 (10.4%) experienced liver failure, and 99 (79.2%) experienced complications. %FLRV was able to predict liver failure with an area under the receiver operating characteristic curve of 0.900, and a cut-off value of 42.7% showed sensitivity of 85.7% and specificity of 88.6%. Postoperative median growth ratio was 21.3% at 1 week, 30.9% at 5 weeks, 34.6% at 9 weeks, and 37.1% at 13 weeks. Multivariate analysis identified three predictors associated with liver regeneration: FLRV < 601 cm3, %FLRV, and liver cirrhosis. At postoperative weeks (POWs) 1 and 5, liver function indicators were significantly better among patients showing high extent of regeneration than among those showing low extent, but these differences disappeared by POW 9.Conclusions: FLRV, %FLRV, and liver cirrhosis strongly influence extent of liver regeneration after hepatectomy. %FLRV values below 42.7% are associated with greater risk of post-hepatectomy liver failure.
Assuntos
Carcinoma Hepatocelular , Hepatectomia , Falência Hepática , Neoplasias Hepáticas , Regeneração Hepática , Adulto , Idoso , Carcinoma Hepatocelular/epidemiologia , Carcinoma Hepatocelular/fisiopatologia , Carcinoma Hepatocelular/cirurgia , Feminino , Seguimentos , Humanos , Falência Hepática/epidemiologia , Falência Hepática/etiologia , Falência Hepática/fisiopatologia , Neoplasias Hepáticas/epidemiologia , Neoplasias Hepáticas/fisiopatologia , Neoplasias Hepáticas/cirurgia , Masculino , Pessoa de Meia-IdadeRESUMO
Improving the stability of lead halide perovskite quantum dots (QDs) in a system containing water is the key for their practical application in artificial photosynthesis. Herein, we encapsulate low-cost CH3 NH3 PbI3 (MAPbI3 ) perovskite QDs in the pores of earth-abundant Fe-porphyrin based metal organic framework (MOF) PCN-221(Fex ) by a sequential deposition route, to construct a series of composite photocatalysts of MAPbI3 @PCN-221(Fex ) (x=0-1). Protected by the MOF the composite photocatalysts exhibit much improved stability in reaction systems containing water. The close contact of QDs to the Fe catalytic site in the MOF, allows the photogenerated electrons in the QDs to transfer rapidly the Fe catalytic sites to enhance the photocatalytic activity for CO2 reduction. Using water as an electron source, MAPbI3 @PCN-221(Fe0.2 ) exhibits a record-high total yield of 1559â µmol g-1 for photocatalytic CO2 reduction to CO (34 %) and CH4 (66 %), 38â times higher than that of PCN-221(Fe0.2 ) in the absence of perovskite QDs.
RESUMO
Inflammation serves a critical role in the pathophysiology of intracerebral hemorrhage (ICH)-induced brain injury. Eupatilin, a pharmacologically active flavone derived from Artemisia sp., has been reported to have antioxidant, anti-inflammatory, anti-allergic and antitumor activities. However, the effect of eupatilin in ICH has not been well studied. The aim of the present study was to investigate the effect of eupatilin on ICH-induced microglial inflammation. The MTT and Transwell migration assay results revealed that eupatilin significantly inhibited microglial migration. It also decreased the production of inflammatory cytokines in erythrocyte lysis-induced BV2 cells, as well as the level of intracellular reactive oxygen species. The anti-inflammatory mechanism of eupatilin was also investigated using ELISAs and western blotting and the results demonstrated that eupatilin was able to inhibit erythrocyte lysis-induced NF-κB activation in BV2 cells. Taken together, the results of the present study suggest that eupatilin serves neurological protective effects via inhibiting microglial inflammation, providing an experimental basis for the use of eupatilin as a therapeutic target for ICH.
RESUMO
The aim of this study was to investigate the diagnostic value of the platelet count-to-spleen volume ratio (PSR) for diagnosing hepatic fibrosis in patients with hepatocellular carcinoma (HCC). In this interim analysis of an on-going prospective study, 117 patients with HCC and with or without cirrhosis or fibrosis in different stages were analyzed. Fibrosis staging negatively correlated with PSR and the liver volume-to-spleen volume ratio (LSR), while it positively correlated with aspartate aminotransferase-to-platelet ratio index (APRI), Frons' index, S-index and a fibrosis index based on four factors (FIB-4). The area under the receiver operating characteristic curve (AUROC) was significantly larger for PSR (0.777) than LSR (0.633, P = 0.002). Among patients with significant fibrosis, AUROC for PSR did not differ significantly from the AUROCs for APRI (0.789, P = 0.825), Frons' index (0.674, P = 0.102), FIB-4 (0.704, P = 0.251) or S-index (0.696, P = 0.204). Among patients with severe fibrosis, AUROC was significantly higher for PSR (0.808) than for LSR (0.685, P = 0.003), Frons' index (0.673, P = 0.014), FIB-4 (0.684, P = 0.029), or S-index (0.672, P = 0.016); in contrast, the AUROC for PSR was not significantly different from that for APRI (0.739, P = 0.215). Among patients with cirrhosis, AUROC was significantly higher for PSR (0.814) than for LSR (0.671, P = 0.001) or S-index (0.679, P = 0.022), while the AUROC for PSR did not differ significantly from those for APRI (0.711, P = 0.105), Frons' index (0.722, P = 0.061) or FIB-4 (0.708, P = 0.079). Our results suggest that PSR may be a useful non-invasive model for diagnosing liver fibrosis stage in patients with HCC in China.
Assuntos
Carcinoma Hepatocelular/diagnóstico , Cirrose Hepática/diagnóstico , Neoplasias Hepáticas/diagnóstico , Carcinoma Hepatocelular/patologia , Feminino , Humanos , Fígado/diagnóstico por imagem , Fígado/patologia , Cirrose Hepática/patologia , Neoplasias Hepáticas/patologia , Masculino , Pessoa de Meia-Idade , Modelos Biológicos , Estadiamento de Neoplasias , Curva ROC , Baço/diagnóstico por imagem , Baço/patologiaRESUMO
BACKGROUND: Surgery combined with new adjuvant chemotherapy is the primary treatment for early stage invasive and advanced stage breast cancer. Growing evidence indicates that patients with ERα-positive breast cancer show poor response to chemotherapeutics. However, ERα-mediated drug-resistant mechanisms remain unclear. METHODS: Levels of WW domain-binding protein 2 (WBP2) and drug-resistant gene were determined by western blotting and RT-PCR, respectively. Cell viability was measured by preforming MTT assay. CD243 expression and apoptosis rate were evaluated by flow cytometry. Interactions of WBP2/ERα and ERα/MDR1 were detected by co-immunoprecipitation and chromatin immunoprecipitation (ChIP) assay, respectively. RESULTS: There was an intrinsic link between WBP2 and ERα in drug-resistant cancer cells. Upregulation of WBP2 in MCF7 cells increased the chemoresistance to doxorubicin, while RNAi-mediated knockdown of WBP2 in MCF7/ADR cells sensitised the cancer cells to doxorubicin. Further investigation in in vitro and in vivo models demonstrated that WBP2 expression was directly correlated with MDR1, and WBP2 could directly modulate MDR1 transcription through binding to ERα, resulting in increased chemotherapy drug resistance. CONCLUSIONS: Our finding provides a new mechanism for the chemotherapy response of ERα-positive breast tumours, and WBP2 might be a key molecule for developing new therapeutic strategies to treat chemoresistance in breast cancer patients.
Assuntos
Proteínas Adaptadoras de Transdução de Sinal/fisiologia , Neoplasias da Mama/tratamento farmacológico , Receptor alfa de Estrogênio/fisiologia , Subfamília B de Transportador de Cassetes de Ligação de ATP/genética , Proteínas Adaptadoras de Transdução de Sinal/genética , Animais , Apoptose , Neoplasias da Mama/patologia , Doxorrubicina/uso terapêutico , Resistencia a Medicamentos Antineoplásicos , Receptor alfa de Estrogênio/genética , Feminino , Humanos , Células MCF-7 , Camundongos , Camundongos Endogâmicos BALB C , Transativadores , Transcrição GênicaRESUMO
p62 is a receptor that facilitates selective autophagy by interacting simultaneously with cargoes and LC3 protein on the autophagosome to maintain cellular homeostasis. However, the regulatory mechanism(s) behind this process and its association with breast cancer remain to be elucidated. Here, we report that Flightless-I (FliI), a novel p62-interacting protein, promotes breast cancer progression by impeding selective autophagy. FliI was highly expressed in clinical breast cancer samples, and heterozygous deletion of FliI retarded the development of mammary tumors in PyVT mice. FliI induced p62-recruited cargoes into Triton X-100 insoluble fractions (TI) to form aggregates, thereby blocking p62 recognition of LC3 and hindering p62-dependent selective autophagy. This function of Flil was reinforced by Akt-mediated phosphorylation at Ser436 and inhibited by phosphorylation of Ulk1 at Ser64. Obstruction of autophagic clearance of p62-recruited cargoes by FliI was associated with the accumulation of oxidative damage on proteins and DNA, which could contribute to the development of cancer. Heterozygous knockout of FliI facilitated selectively autophagic clearance of aggregates, abatement of ROS levels, and protein oxidative damage, ultimately retarding mammary cancer progression. In clinical breast cancer samples, Akt-mediated phosphorylation of FliI at Ser436 negatively correlated with long-term prognosis, while Ulk1-induced FliI phosphorylation at Ser64 positively correlated with clinical outcome. Together, this work demonstrates that FliI functions as a checkpoint protein for selective autophagy in the crosstalk between FliI and p62-recruited cargoes, and its phosphorylation may serve as a prognostic marker for breast cancer.Significance: Flightless-I functions as a checkpoint protein for selective autophagy by interacting with p62 to block its recognition of LC3, leading to tumorigenesis in breast cancer.Cancer Res; 78(17); 4853-64. ©2018 AACR.
Assuntos
Neoplasias da Mama/genética , Carcinogênese/genética , Proteínas dos Microfilamentos/genética , Proteínas Associadas aos Microtúbulos/genética , Proteínas de Ligação a RNA/genética , Receptores Citoplasmáticos e Nucleares/genética , Adulto , Idoso , Animais , Autofagossomos/metabolismo , Autofagossomos/patologia , Autofagia/genética , Proteína Homóloga à Proteína-1 Relacionada à Autofagia/genética , Mama/metabolismo , Mama/patologia , Neoplasias da Mama/patologia , Progressão da Doença , Feminino , Humanos , Peptídeos e Proteínas de Sinalização Intracelular/genética , Camundongos , Pessoa de Meia-Idade , Fosforilação , Ligação Proteica/genética , TransativadoresRESUMO
The development of highly efficient, low-cost and stable electrocatalysts for overall water splitting is highly desirable for the storage of intermittent solar energy and wind energy sources. Herein, we show for the first time that nickel can be extracted from NiFe-layered double hydroxide (NiFe-LDH) to generate an Ni2P@FePO x heterostructure. The Ni2P@FePO x heterostructure was converted to an Ni2P@NiFe hydroxide heterostructure (P-NiFe) during water splitting, which displays high electrocatalytic performance for both the hydrogen evolution reaction (HER) and oxygen evolution reaction (OER) in 1.0 M KOH solution, with an overpotential of 75 mV at 10 mA cm-2 for HER, and overpotentials of 205, 230 and 430 mV at 10, 100 and 1000 mA cm-2 for OER, respectively. Moreover, it could afford a stable current density of 10 mA cm-2 for overall water splitting at 1.51 V in 1.0 M KOH with long-term durability (100 h). This cell voltage is among the best reported values for bifunctional electrocatalysts. The results of theoretical calculations demonstrate that P-NiFe displays optimized adsorption energies for both HER and OER intermediates at the nickel active sites, thus dramatically enhancing its electrocatalytic activity.
RESUMO
WW domain-binding protein 2 (WBP2) has been demonstrated as oncogenic in breast cancer. Many studies have revealed the WBP2 gene as a high-risk gene for leukoariaosis and cerebral white matter lesions is important in the pathologic stage of glioma development. This study aimed to illustrate the underlying mechanism by which WBP2 regulates the process of glioma development. The expression pattern of WBP2 in several tumor cells was determined, clarifying the carcinogenic action of WBP2 in glioma cells. Overexpression of WBP2 in glioma cells promoted cell proliferation and migration, and the number of S-phase cells, whereas the depletion of WBP2 by RNAi-mediated knockdown restrained cell growth and cell cycle progression. Upregulation of WBP2 significantly enhanced the tumorigenic ability of U251 cells in vivo. MS/GST pulldown assay identified α-enolase (ENO1) and Homer protein homolog 3 (Homer3) as novel potent interaction partners of WBP2. Knockdown of ENO1 or Homer3 allowed cell growth and migration to return to normal levels. Furthermore, in vitro and in vivo experiments indicated that the oncogenic role of WBP2 in glioma was through modulating ENO1 and glycolysis activity via the ENO1-PI3K/Akt signaling pathway. Collectively, these results reveal that WBP2 plays a vital role in the occurrence and development of glioma, indicating a target gene for glioblastoma treatment.
Assuntos
Proteínas Adaptadoras de Transdução de Sinal/metabolismo , Biomarcadores Tumorais/metabolismo , Neoplasias Encefálicas/metabolismo , Proteínas de Ligação a DNA/metabolismo , Glioma/metabolismo , Camundongos Nus/metabolismo , Fosfopiruvato Hidratase/metabolismo , Proteínas Supressoras de Tumor/metabolismo , Proteínas Adaptadoras de Transdução de Sinal/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Animais , Biomarcadores Tumorais/genética , Neoplasias Encefálicas/genética , Neoplasias Encefálicas/fisiopatologia , Ciclo Celular , Movimento Celular , Proliferação de Células , Proteínas de Ligação a DNA/genética , Feminino , Glioma/genética , Glioma/fisiopatologia , Glicólise , Proteínas de Arcabouço Homer/genética , Proteínas de Arcabouço Homer/metabolismo , Humanos , Masculino , Camundongos , Camundongos Nus/genética , Pessoa de Meia-Idade , Oncogenes , Fosfopiruvato Hidratase/genética , Ligação Proteica , Transativadores , Proteínas Supressoras de Tumor/genéticaRESUMO
Cathodic polarization antifouling deserves attention because of its environmentally friendly nature and good sustainability. It has been proven that cathodic voltages applied on metal substrates exhibit outstanding antifouling effects. However, most metals immersed in marine environment are protected by insulated anticorrosive coatings, restricting the cathodic polarization applied on metals. This study developed a conducting polypyrrole (PPy)/acrylic resin coating (σâ¯=â¯0.18â¯Scm-1), which can be applied in cathodic polarization antifouling. The good stability and electro-activity of PPy in the negative polarity zone in alkalescent NaCl solution were verified by linear sweep voltammetry (LSV), chronoamperometry (CA), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS), demonstrating the feasibility of PPy as cathodic polarization material. Furthermore, the antifouling effects of PPy/acrylicresin coating on 24-h old Escherichia coli bacteria (E. coli) which formed on PPy/acrylic resin-coated plastic plate were measured under different cathodic potentials and treatment time, characterized by fluorescent microscope. The results suggest that at cathodic potential around -0.5â¯V (vs. saturated calomel electrode (SCE)), there was little trace of attached bacteria on the substrate after 20â¯min of treatment. PPy/acrylicresin-coated substrates were also subjected to repeated cycles of biofilm formation and electrochemical removal, where high removal efficiencies were maintained throughout the total polarization process. Under these conditions, the generation of hydrogen peroxide is believed to be responsible for the antifouling effects because of causing oxidative damage to cells, suggesting the potential of the proposed technology for application on insulated surfaces in various industrial settings.
Assuntos
Incrustação Biológica , Polímeros/química , Pirróis/química , Biofilmes , Eletricidade , Técnicas Eletroquímicas , Eletrodos , Escherichia coli/citologia , Estudos de Viabilidade , CinéticaRESUMO
Interleukin 2 (IL-2) is an anti-cancer cytokine that stimulates T cell propagation, triggering innate and adaptive immunity. IL-2 has been used for cancer therapy and has achieved curative effects. Recombinant adenovirus p53 injection (rAdp53) is a gene therapeutic agent that may improve the prognosis of patients with glioblastoma (GBM). In the present study, the effect of combined IL2 and rAdp53 treatment was studied. The ability of IL2 to stimulate immunoregulation and the ability of p53 to induce apoptosis for GBM was researched in the GBM tumor model. In addition, the activity of IL2 was analyzed. The antitumor potential of IL2 and rAdp53 was studied using xenograph mice carrying GBM cells. Tumorspecific CD4+ and CD8+ T cells were also analyzed in the GBMbearing models. The results demonstrated that IL2 and rAdp53 not only stimulated tumorspecific cytotoxic Tlymphocyte responses and increased regulatory CD4+ and cytotoxic CD8+ T cell proliferation, however additionally increased expression of apoptosisassociated genes. The treatment with IL2 and rAdp53 resulted in tumor regression and prolonged the survival of gliomabearing mice. Taken together, a combination of IL2 and rAdp53 treatment combines the effects of immunotherapy and oncolytic therapy and may be a comprehensive therapeutic schedule for clinical application in future cancer therapies.