Mesenchymal Stromal Cells Increase the Natural Killer Resistance of Circulating Tumor Cells via Intercellular Signaling of cGAS-STING-IFNß-HLA.

Circulating tumor cells (CTCs) shed from primary tumors must overcome the cytotoxicity of immune cells, particularly natural killer (NK) cells, to cause metastasis. The tumor microenvironment (TME) protects tumor cells from the cytotoxicity of immune cells, which is partially executed by cancer-associated mesenchymal stromal cells (MSCs). However, the mechanisms by which MSCs influence the NK resistance of CTCs remain poorly understood. This study demonstrates that MSCs enhance the NK resistance of cancer cells in a gap junction-dependent manner, thereby promoting the survival and metastatic seeding of CTCs in immunocompromised mice. Tumor cells crosstalk with MSCs through an intercellular cGAS-cGAMP-STING signaling loop, leading to increased production of interferon-ß (IFNß) by MSCs. IFNß reversely enhances the type I IFN (IFN-I) signaling in tumor cells and hence the expression of human leukocyte antigen class I (HLA-I) on the cell surface, protecting the tumor cells from NK cytotoxicity. Disruption of this loop reverses NK sensitivity in tumor cells and decreases tumor metastasis. Moreover, there are positive correlations between IFN-I signaling, HLA-I expression, and NK tolerance in human tumor samples. Thus, the NK-resistant signaling loop between tumor cells and MSCs may serve as a novel therapeutic target.

A novel engineered IL-21 receptor arms T-cell receptor-engineered T cells (TCR-T cells) against hepatocellular carcinoma.

Strategies to improve T cell therapy efficacy in solid tumors such as hepatocellular carcinoma (HCC) are urgently needed. The common cytokine receptor γ chain (γc) family cytokines such as IL-2, IL-7, IL-15 and IL-21 play fundamental roles in T cell development, differentiation and effector phases. This study aims to determine the combination effects of IL-21 in T cell therapy against HCC and investigate optimized strategies to utilize the effect of IL-21 signal in T cell therapy. The antitumor function of AFP-specific T cell receptor-engineered T cells (TCR-T) was augmented by exogenous IL-21 in vitro and in vivo. IL-21 enhanced proliferation capacity, promoted memory differentiation, downregulated PD-1 expression and alleviated apoptosis in TCR-T after activation. A novel engineered IL-21 receptor was established, and TCR-T armed with the novel engineered IL-21 receptors (IL-21R-TCR-T) showed upregulated phosphorylated STAT3 expression without exogenous IL-21 ligand. IL-21R-TCR-T showed better proliferation upon activation and superior antitumor function in vitro and in vivo. IL-21R-TCR-T exhibited a less differentiated, exhausted and apoptotic phenotype than conventional TCR-T upon repetitive tumor antigen stimulation. The novel IL-21 receptor in our study programs powerful TCR-T and can avoid side effects induced by IL-21 systemic utilization. The novel IL-21 receptor creates new opportunities for next-generation TCR-T against HCC.

Loss of OVOL2 in Triple-Negative Breast Cancer Promotes Fatty Acid Oxidation Fueling Stemness Characteristics.

Triple-negative breast cancer (TNBC), the most aggressive subtype of breast cancer, has a poor prognosis and lacks effective treatment strategies. Here, the study discovered that TNBC shows a decreased expression of epithelial transcription factor ovo-like 2 (OVOL2). The loss of OVOL2 promotes fatty acid oxidation (FAO), providing additional energy and NADPH to sustain stemness characteristics, including sphere-forming capacity and tumor initiation. Mechanistically, OVOL2 not only suppressed STAT3 phosphorylation by directly inhibiting JAK transcription but also recruited histone deacetylase 1 (HDAC1) to STAT3, thereby reducing the transcriptional activation of downstream genes carnitine palmitoyltransferase1 (CPT1A and CPT1B). PyVT-Ovol2 knockout mice develop a higher number of primary breast tumors with accelerated growth and increased lung-metastases. Furthermore, treatment with FAO inhibitors effectively reduces stemness characteristics of tumor cells, breast tumor initiation, and metastasis, especially in OVOL2-deficient breast tumors. The findings suggest that targeting JAK/STAT3 pathway and FAO is a promising therapeutic strategy for OVOL2-deficient TNBC.

Atg5 deficiency in macrophages protects against kidney fibrosis via the CCR6-CCL20 axis.

BACKGROUND: Autophagy is a lysosome-dependent degradation pathway that regulates macrophage activation, differentiation, and polarization. Autophagy related 5 (Atg5) is a key protein involved in phagocytic membrane elongation in autophagic vesicles that forms a complex with Atg12 and Atg16L1. Alterations in Atg5 are related to both acute and chronic kidney diseases in experimental models. However, the role of macrophage-expressed Atg5 in acute kidney injury remains unclear. METHODS: Using a myeloid cell-specific Atg5 knockout (MΦ atg5-/-) mouse, we established renal ischemia/reperfusion and unilateral ureteral obstruction models to evaluate the role of macrophage Atg5 in renal macrophage migration and fibrosis. RESULTS: Based on changes in the serum urea nitrogen and creatinine levels, Atg5 deletion had a minimal effect on renal function in the early stages after mild injury; however, MΦ atg5-/- mice had reduced renal fibrosis and reduced macrophage recruitment after 4 weeks of ischemia/reperfusion injury and 2 weeks of unilateral ureteral obstruction injury. Atg5 deficiency impaired the CCL20-CCR6 axis after severe ischemic kidneys. Chemotactic responses of bone marrow-derived monocytes (BMDMs) from MΦ atg5-/- mice to CCL20 were significantly attenuated compared with those of wild-type BMDMs, and this might be caused by the inhibition of PI3K, AKT, and ERK1/2 activation. CONCLUSIONS: Our data indicate that Atg5 deficiency decreased macrophage migration by impairing the CCL20-CCR6 axis and inhibited M2 polarization, thereby improving kidney fibrosis.

Phenome-wide causal associations between osteoarthritis and other complex traits through the latent causal variable analysis.

BACKGROUND: Individuals with osteoarthritis present with comorbidities, and the potential causal associations remain incompletely elucidated. The present study undertook a large-scale investigation about the causality between osteoarthritis and variable traits, using the summary-level data of genome-wide association studies (GWAS). METHODS: The present study included the summary-level GWS data of knee osteoarthritis, hip osteoarthritis, hip or knee osteoarthritis, hand osteoarthritis, and other 1355 traits. Genetic correlation analysis was conducted between osteoarthritis and other traits through cross-trait bivariate linkage disequilibrium score regression. Subsequently, latent causal variable analysis was performed to explore the causal association when there was a significant genetic correlation. Genetic correlation and latent causal variable analysis were conducted on the Complex Traits Genomics Virtual Lab platform ( https://vl.genoma.io/ ). RESULTS: We found 133 unique phenotypes showing causal relationships with osteoarthritis. Our results confirmed several well-established risk factors of osteoarthritis, such as obesity, weight, BMI, and meniscus derangement. Additionally, our findings suggested putative causal links between osteoarthritis and multiple factors. Socioeconomic determinants such as occupational exposure to dust and diesel exhaust, extended work hours exceeding 40 per week, and unemployment status were implicated. Furthermore, our analysis revealed causal associations with cardiovascular and metabolic disorders, including heart failure, deep venous thrombosis, type 2 diabetes mellitus, and elevated cholesterol levels. Soft tissue and musculoskeletal disorders, such as hallux valgus, internal derangement of the knee, and spondylitis, were also identified to be causally related to osteoarthritis. The study also identified the putative causal associations of osteoarthritis with digestive and respiratory diseases, such as Barrett's esophagus, esophagitis, and asthma, as well as psychiatric conditions including panic attacks and manic or hyperactive episodes. Additionally, we observed osteoarthritis causally related to pharmacological treatments, such as the use of antihypertensive medications, anti-asthmatic drugs, and antidepressants. CONCLUSION: Our study uncovered a wide range of traits causally associated with osteoarthritis. Further studies are needed to validate and illustrate the detailed mechanism of those causal associations.

Clinical practice guidelines for prevention and treatment of postoperative gastrointestinal disorder with Integrated Traditional Chinese and Western Medicine (2023).

Postoperative gastrointestinal disorder (POGD) was a common complication after surgery under anesthesia. Strategies in combination with Traditional Chinese Medicine and Western medicine showed some distinct effects but standardized clinical practice guidelines were not available. Thus, a multidisciplinary expert team from various professional bodies including the Perioperative and Anesthesia Professional Committees of the Chinese Association of Integrative Medicine (CAIM), jointly with Gansu Province Clinical Research Center of Integrative Anesthesiology/Anesthesia and Pain Medical Center of Gansu Provincial Hospital of Traditional Chinese Medicine and WHO Collaborating Center for Guideline Implementation and Knowledge Translation/Chinese Grading of Recommendations, Assessment, Development, and Evaluation (GRADE) Center/Gansu Provincial Center for Medical Guideline Industry Technology/Evidence-based Medicine Center of Lanzhou University, was established to develop evidence-based guidelines. Clinical questions (7 background and 12 clinical questions) were identified through literature reviews and expert consensus meetings. Based on systematic reviews/meta-analyses, evidence quality was analyzed and the advantages and disadvantages of interventional measures were weighed with input from patients' preferences. Finally, 20 recommendations were developed through the Delphi-based consensus meetings. These recommendations included disease definitions, etiologies, pathogenesis, syndrome differentiation, diagnosis, and perioperative prevention and treatment.

The application and therapeutic effect of botulinum toxin type a (BTX-A) in the treatment of patients with pain after cancer treatment: a systematic review and meta-analysis.

BACKGROUND: Botulinum toxin type A (BTX-A) is a potential treatment for cancer pain. This study aimed to analyze the effectiveness and safety of BTX-A in the treatment of pain after cancer treatment. PATIENTS AND METHODS: Systematic searches of PubMed, Cochrane Library, and Embase databases were conducted. Randomized controlled trials evaluating the efficacy and safety of BTX-A compared with either placebo or active treatment in patients with pain after cancer treatment were included. The outcomes included pain intensity, quality of life, and adverse events. RESULTS: This systematic review included four studies of which two were included in the meta-analysis. Compared with a placebo, BTX-A injection in patients with pain after cancer treatment had a clinically meaningful reduction in self-reported pain post-treatment [mean difference=-1.79 (95% CI: -2.14--1.43), P <0.00001, I ²=0%]. CONCLUSION: This systematic review and meta-analysis demonstrated that BTX-A is safe and effective for pain relief in patients with pain after cancer treatment.

Discovery of Selective and Potent Macrocyclic CDK9 Inhibitors for the Treatment of Osimertinib-Resistant Non-Small-Cell Lung Cancer.

Effectiveness of epidermal growth factor receptor (EGFR) inhibitors, including Osimertinib, for treating non-small-cell lung cancer (NSCLC) is limited due to the continuous emergence of drug resistance. Hence, it is urgent to develop new therapeutic approaches. CDK9, a key regulator of RNA transcription, has emerged as a promising target for the development of antitumor drugs due to its crucial role in modulating the levels of antiapoptotic protein Mcl-1. Herein, we present the synthesis, optimization, and evaluation of selective CDK9 inhibitors with a macrocyclic scaffold that effectively suppresses the growth of NSCLC cells. Notably, compound Z11, a potent CDK9 inhibitor (IC50 = 3.20 nM) with good kinase selectivity, significantly inhibits cell proliferation and colony formation and induces apoptosis in Osimertinib-resistant H1975 cells. Furthermore, Z11 demonstrates a significant suppression of tumor growth in six patient-derived organoids, including three organoids resistant to Osimertinib. Overall, Z11 served as a promising macrocycle-based CDK9 inhibitor for treating Osimertinib-resistant NSCLC.

Discovery of novel flavonoid-based CDK9 degraders for prostate cancer treatment via a PROTAC strategy.

CDK9 plays a vital role in regulating RNA transcription and significantly impacts the expression of short-lived proteins such as Mcl-1 and c-Myc. Thus, targeting CDK9 holds great promise for the development of antitumor drugs. Natural flavonoid derivatives have recently gained considerable attention in the field of antitumor drug research due to their broad bioactivity and low toxicity. In this study, the PROTAC strategy was used to perform structural modifications of the flavonoid derivative LWT-111 to design a series of flavonoid-based CDK9 degraders. Notably, compound CP-07 emerged as a potent CDK9 degrader, effectively suppressing the proliferation and colony formation of 22RV1 cells by downregulating Mcl-1 and c-Myc. Moreover, CP-07 exhibited significant tumor growth inhibition with a TGI of 75.1% when administered at a dose of 20 mg/kg in the 22RV1 xenograft tumor model. These findings demonstrated the potential of CP-07 as a powerful flavonoid-based CDK9 degrader for prostate cancer therapy.

Navigating chimeric antigen receptor-engineered natural killer cells as drug carriers via three-dimensional mapping of the tumor microenvironment.

Chimeric antigen receptor (CAR)-modified natural killer (NK) cells are recognized as promising immunotherapeutic agents for cancer treatment. However, the efficacy and trafficking of CAR-NK cells in solid tumors are hindered by the complex barriers present in the tumor microenvironment (TME). We have developed a novel strategy that utilizes living CAR-NK cells as carriers to deliver anticancer drugs specifically to the tumor site. We also introduce a time-lapse method for evaluating the efficacy and tumor specificity of CAR-NK cells using a two-photon microscope in live mouse models and three-dimensional (3D) tissue slide cultures. Our results demonstrate that CAR-NK cells exhibit enhanced antitumor immunity when combined with photosensitive chemicals in both in vitro and in vivo tumor models. Additionally, we have successfully visualized the trafficking, infiltration, and accumulation of drug-loaded CAR-NK cells in deeply situated TME using non-invasive intravital two-photon microscopy. Our findings highlight that tumor infiltration of CAR-NK cells can be intravitally monitored through the two-photon microscope approach. In conclusion, our study demonstrates the successful integration of CAR-NK cells as drug carriers and paves the way for combined cellular and small-molecule therapies in cancer treatment. Furthermore, our 3D platform offers a valuable tool for assessing the behavior of CAR cells within solid tumors, facilitating the development and optimization of immunotherapeutic strategies with clinical imaging approaches.

Effects of intravenous chemotherapy after TURBT for high-risk nonmuscle invasive bladder cancer: results of a retrospective study.

PURPOSE: This study compared the efficacy and safety of intravenous chemotherapy combined with intravesical chemotherapy versus intravesical chemotherapy alone for high-risk nonmuscle invasive bladder cancer (HRNMIBC) patients after transurethral resection of the bladder tumor (TURBT) surgery. METHODS: A retrospective analysis was performed on 349 HRNMIBC cases admitted to TangDu hospital between January 2014 and June 2019. After TURBT, 262 patients received intravesical chemotherapy alone, whereas 87 patients underwent intravesical chemotherapy in combination with intravenous chemotherapy. The recurrence rate and progression rate were assessed by Chi-square test, the prognostic factors for tumor recurrence were predicted by univariable and multivariable Cox hazards analyses, recurrence-free survival (RFS) and progression-free survival (PFS) were calculated using the Kaplan-Meier method. RESULTS: In this study, the recurrence rate was 24.7% (19/77) in the intravenous chemotherapy combined group and 41.6% (102/245) in the intravesical chemotherapy group, while the progression rate was 6.5% (5/77) and 14.3% (35/245) in the two groups respectively. The two groups differed significantly in recurrence rate (p = 0.007) while the progression rate did not show a significant difference (p = 0.071). Multivariable analyses revealed that additional intravenous chemotherapy treatment was an independent prognostic factor for tumor recurrence in the cohort (hazard ratio [HR], 0.495, 95% confidence interval [CI], 0.275-0.892, p = 0.019). Kaplan-Meier curves showed significant differences in RFS and PFS between the two groups, with a log-rank P value of p < 0.005 and p = 0.045, respectively. Grade 3/4 toxicity was reported in 2 of 77 patients in the intravenous chemotherapy combined group, including nausea/vomiting 1.3% (1/77) and hypoleukemia 1.3% (1/77). CONCLUSION: Intravenous chemotherapy of gemcitabine and cisplatin combined with intravesical chemotherapy after TURBT can effectively reduce the postoperative recurrence rate, most toxicities were minor and reversible, and it may be considered as a new choice for HRNMIBC patients.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Primary diffuse large B-cell tumor of the uterus: a case report.

Primary diffuse large B-cell tumor of the uterus is a rare clinical condition with a similar clinical presentation to gynecologic tumors and is easily misdiagnosed. We report a case of a postmenopausal woman who presented with pelvic mass. Her ultrasound and MRI examinations suggested diffuse enlargement of the uterus, leading us to consider the diagnosis of lymphoma. The histological examination of the uterine mass confirmed the diagnosis of diffuse large B-cell lymphoma. The patient received 6 cycles of chemotherapy with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine and prednisone) and 2 cycles of consolidation therapy with R (rituximab). After treatment, the patient's uterus was significantly smaller than before and there was no sign of a recurrence.

Photoacoustic imaging-guided triple-responsive nanoparticles with tumor hypoxia relief for improving chemotherapy/ photothermal/photodynamic synergistic therapy against breast cancer.

Chemo-photothermal/photodynamic synergistic therapy is a new effective cancer treatment method to overcome the limitations of single chemotherapy. However, the limited low photothermal conversion efficiency, the hypoxic tumor microenvironment, and premature leakage of the drug constrain their clinical applications. To address these challenges, an all-in-one biodegradable polydopamine-coated UiO-66 framework nanomedicine (DUPM) was developed to co-deliver the drug doxorubicin hydrochloride (DOX) and the excellent photothermal material MoOx nanoparticles (NPs). The results showed that DUPM exhibited good physicochemical stability and efficiently accumulated tumor tissues under pH-, glutathione-, and NIR-triggered drug release behaviour. Of note, the synthesized MoOx NPs endowed DUPM with self-supporting oxygen production and generated more reactive oxygen species (1O2 and·OH), besides, it induces Mo-mediated redox reaction to deplete excessive glutathione thus relieving tumor hypoxia to enhance PDT, further improving synergistic therapy. Meanwhile, DUPM showed strong absorption in the near-infrared range and high photothermal conversion efficiency at 808 nm (51.50%) to realize photoacoustic imaging-guided diagnosis and treatment of cancer. Compared with monotherapy, the in vivo anti-tumor efficacy results showed that DUMP exerted satisfactory tumor growth inhibition effects (94.43%) with good biocompatibility. This study provides a facile strategy to develop intelligent multifunctional nanoparticles with tumor hypoxia relief for improving synergistic therapy and diagnosis against breast cancer.

Efficacy and safety of montelukast adjuvant therapy in adults with cough variant asthma: A systematic review and meta-analysis.

BACKGROUND: Montelukast is a highly selective and specific cysteinyl leukotriene receptor antagonist used in the treatment of asthma. Whether montelukast as adjuvant therapy can significantly and safely treat adults with cough variant asthma (CVA) remains inconclusive. AIMS: This meta-analysis systematically evaluated the efficacy and safety of montelukast as an adjuvant treatment for adults with CVA. MATERIALS AND METHODS: Randomized controlled trials (RCTs) on montelukast combined with inhaled corticosteroids (ICS) and long-acting ß2 agonists (LABAs) to treat CVA in adults, from inception to March 6, 2023, were retrieved from the CNKI, Wanfang, VIP, CBM, PubMed, Embase, Cochrane Library, and Web of Science databases and Clinical Trials website. Review Manager (version 5.4) and Stata (version 15.0) were used to conduct the meta-analysis. RESULTS: A total of 15 RCTs were ultimately included in the meta-analysis. It was established that montelukast as adjuvant therapy raised the total effective rate (RR = 1.20, 95% confidence interval [CI] [1.13, 1.27], P < 0.01) and improved the FEV1% (SMD = 0.91, 95% CI [0.40, 1.41], P < 0.01), PEF% (SMD = 0.63, 95% CI [0.38, 0.88], P < 0.01), FEV1 (SMD = 1.15, 95% CI [0.53, 1.77], P < 0.01), PEF (SMD = 0.64, 95% CI [0.42, 0.86], P < 0.01), and FEV1/FVC% (SMD = 0.76, 95% CI [0.51, 1.01], P < 0.01) and reduced the recurrence rate (RR = 0.28, 95% CI [0.15, 0.53], P < 0.01). The incidence of adverse reactions was higher in the montelukast auxiliary group compared to the control group but with no statistical difference (RR = 1.32, 95% CI [0.89, 1.96], P = 0.17). CONCLUSION: Existing evidence indicated that the use of montelukast as an adjuvant therapy had therapeutic efficacy superior to ICS + LABA alone for the treatment of adult patients with CVA. However, further research is needed, especially a combination of high-quality long-term prospective studies and carefully designed RCTs.

Evaluation of the up-to-7 criterion for determining the treatment of hepatocellular carcinoma in Barcelona Clinic Liver Cancer stage B: a single-center retrospective cohort study.

Background: At present, there are still disputes on the treatment of surgery for patients with stage B hepatocellular carcinoma (HCC). This study sought to investigate whether the up-to-7 criterion could be used to decide the treatment for HCC in Barcelona Clinic Liver Cancer stage B (BCLC-B). Methods: We analyzed 340 patients with HCC in BCLC-B who treated with hepatectomy or transcatheter arterial chemoembolization (TACE). Of the 285 HCC patients who underwent hepatectomy, 108 met the up-to-7 criterion and 177 exceeded it. All 55 patients in the TACE group met the up-to-7 criterion. We obtained the tumor status of the patients through inpatient medical records, outpatient medical records, and telephone follow-up of the hospital. We compared overall survival (OS) and progression-free survival (PFS) were compared between patients who met the up-to-7 criterion and who underwent either hepatectomy or TACE. OS and recurrence time were also compared between the patients who were treated with hepatectomy and who either met or exceeded the up-to-7 criterion. Across BCLC-B patients, we compared the OS of patients after surgical treatment between subgroups stratified by tumor number and diameter. Results: Patients who met the up-to-7 criterion had significantly higher OS rates after hepatectomy than TACE (P<0.001). However, the 2 groups did not differ in terms of PFS (P=0.758). Among the patients treated by hepatectomy, the OS rates were significantly higher in patients who met the up-to-7 criterion than in those who exceeded it (P=0.001). The recurrence rates did not differ between patients who met or exceeded the criterion (P=0.662). OS was significantly higher in patients with ≤3 tumors than those with >3 tumors (P=0.001). When we stratified patients with ≤3 tumors based in whether they met or exceeded the up-to-8 to up-to-15 criterion, OS was significantly better among those who met the criterion in all cases. Conclusions: Hepatectomy appears to be associated with better survival than TACE in patients with BCLC-B HCC who meet the up-to-7 criterion, but this criterion is not a strict indication for deciding whether to treat patients with BCLC-B surgically. Tumor number strongly affects the prognosis of BCLC-B patients after hepatectomy.

Construction of a non-negative matrix factorization model of immunogenic cell death-related genes in lung adenocarcinoma and analysis of survival prognosis.

Purpose: To explore the effectiveness of the model based on non-negative matrix factorization (NMF), analyze the tumor microenvironment and immune microenvironment for evaluating the prognosis of lung adenocarcinoma, establish a risk model, and screen independent prognostic factors. Methods: Downloading the transcription data files and clinical information files of lung adenocarcinoma from TCGA database and GO database, the R software was used to establish the NMF cluster model, and then the survival analysis between groups, tumor microenvironment analysis, and immune microenvironment analysis was performed according to the NMF cluster result. R software was used to construct prognostic models and calculate risk scores. Survival analysis was used to compare survival differences between different risk score groups. Results: Two ICD subgroups were established according to the NMF model. The survival of the ICD low-expression subgroup was better than that of the ICD high-expression subgroup. Univariate COX analysis screened out HSP90AA1, IL1, and NT5E as prognostic genes, and the prognostic model established on this basis has clinical guiding significance. Conclusion: The model based on NMF has the prognostic ability for lung adenocarcinoma, and the prognostic model of ICD-related genes has a certain guiding significance for survival.

Erratum: A Long Non-coding RNA Lnc712 Regulates Breast Cancer Cell Proliferation: Erratum.

[This corrects the article DOI: 10.7150/ijbs.36429.].

Progress on the Role of Estrogen and Progesterone Signaling in Mouse Embryo Implantation and Decidualization.

Embryo implantation and decidualization are key steps in establishing a successful pregnancy. Defects in embryo implantation and decidualization can cause a series of adverse chain reactions which can contribute to harmful pregnancy outcomes, such as embryo growth retardation, preeclampsia, miscarriage, premature birth, and so on. Approximately 75% of failed pregnancies are considered to be due to embryo implantation failure or defects. Decidualization, characterized by proliferation and differentiation of uterine stromal cells, is one of the essential conditions for blastocyst implantation, placental formation, and maintenance of pregnancy and is indispensable for the establishment of pregnancy in many species. Embryo implantation and decidualization are closely regulated by estrogen and progesterone secreted by the ovaries. Many cellular events and molecular signaling network pathways are involved in this process. This article reviews the recent advances in the molecular mechanisms of estrogen- and progesterone-regulating uterine receptivity establishment, blastocyst implantation, and decidualization, in order to better understand the underlying molecular mechanisms of hormonal regulation of embryo implantation and to develop new strategies for preventing or treating embryo implantation defects and improving the pregnancy rate of women.

Human health risk mitigation from arsenic in rice by crop rotation with a hyperaccumulator plant.

Exposure to arsenic (As) from a diet of contaminated rice is a widespread problem and a serious concern in several parts of the world. There is a need to develop sustainable, effective, and reliable strategies to reduce As accumulation in rice. Our goal was to develop and test a simple crop rotation method of alternating rice with the As hyperaccumulator plant, Chinese brake fern (Pteris vitatta L.), to reduce As concentrations in rice grains. A greenhouse column study was performed for 2 years using As-contaminated rice paddy soil from West Bengal. Rice was grown under flooded conditions and irrigated with As-contaminated water to simulate field conditions. Chinese brake fern was grown between two rice cycles in experimental columns, while control columns were left unplanted. Our results show that at the end of two cycles, there was a statistically significant decrease in soil As concentrations in the treatment columns compared to the control columns. After one rotation with the fern, there was a significant decline in As concentrations in rice grains in treatment plants and a concomitant decline in both noncarcinogenic and carcinogenic health risks. Our results indicate that there could be substantial benefit in implementing this simple crop rotation model to help lower human health risks from As exposure via rice ingestion.