RESUMO
BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
Assuntos
Transfusão de Sangue , DNA Viral/sangue , Herpesvirus Humano 6/genética , Herpesvirus Humano 7/genética , Herpesvirus Humano 8/genética , Reação em Cadeia da Polimerase Multiplex/métodos , DNA Viral/genética , Feminino , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Reação em Cadeia da Polimerase Multiplex/normas , Estudos Prospectivos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/métodos , Carga Viral/normasAssuntos
Infecções por HIV/diagnóstico , Infecções por HIV/virologia , HIV , Carga Viral/métodos , Genoma Viral , HIV/genética , Infecções por HIV/tratamento farmacológico , Infecções por HIV/imunologia , Humanos , Provírus/genética , Reação em Cadeia da Polimerase em Tempo Real/métodos , Carga Viral/normasRESUMO
AIMS: To evaluate the potential use of synthetic oligonucleotides as a standard curve for proviral load (PVL) of human T-cell leukaemia virus type 1 (HTLV-1) quantification in peripheral blood mononuclear cells (PBMC) of HTLV-1-infected individuals by quantitative real-time polymerase chain reaction (qPCR) analysis. METHODS AND RESULTS: Synthetic oligonucleotides based on HTLV-1 genome were customized to use as a standard curve. Twelve anti-HTLV-1-positive samples with known HTLV-1 PVL, previously quantified by qPCR assay using TARL-2 cells as a conventional standard curve, were submitted to the new protocol. The proviral quantification levels had a high concordance with qPCR results using a conventional standard curve. The results demonstrate that the conventional standard curve can be replaced by a synthetic standard curve due to its ability to quantification based on the linearity and qPCR efficiency and similar results with a validated qPCR assay using a conventional standard curve. CONCLUSIONS: Synthetic oligonucleotides standard curves could be a very useful tool on HTLV-1 diagnosis and absolute HTLV-1 PVL quantification. SIGNIFICANCE AND IMPACT OF THE STUDY: HTLV-1 PVL determination using synthetic oligonucleotides standard curve by qPCR could be a helpful alternative for the laboratories that monitor infected patients as an important prognostic factor in HTLV-1-associated diseases progression. Also, it can decrease costs and overcome the biological limitations of the plasmid curve.
Assuntos
Infecções por HTLV-I/diagnóstico , Vírus Linfotrópico T Tipo 1 Humano/isolamento & purificação , Provírus/isolamento & purificação , Reação em Cadeia da Polimerase em Tempo Real/métodos , Carga Viral/métodos , Adulto , DNA Viral/genética , Progressão da Doença , Genoma Viral/genética , Infecções por HTLV-I/sangue , Infecções por HTLV-I/virologia , Vírus Linfotrópico T Tipo 1 Humano/genética , Humanos , Leucócitos Mononucleares/virologia , Pessoa de Meia-Idade , Oligonucleotídeos/síntese química , Oligonucleotídeos/genética , Prognóstico , Provírus/genética , Reação em Cadeia da Polimerase em Tempo Real/normas , Carga Viral/normasRESUMO
Despite the adaptation of international standards, quantitative viral load testing of transplant-associated viruses continues to be limited by interlaboratory disagreement. Studies have suggested that this disagreement and the poor commutability of standards may, in some cases, be linked to amplicon size and the fragmentation of circulating viral DNA. We evaluated target fragmentation as a cause of noncommutability and pretest fragmentation of quantitative standards as a potential means of increasing commutability and interassay agreement. Forty-two cytomegalovirus (CMV)-positive and 41 Epstein-Barr virus (EBV)-positive plasma samples, together with two different quantitative standards for each virus, were tested as unknowns using 10 different quantitative PCR assays at 5 different laboratories. Standards were tested both intact and after intentional fragmentation by ultrasonication. Quantitative agreement between methods was assessed, together with commutability, using multiple statistical approaches. Most assays yielded results within 0.5 log10 IU/ml of the mean for CMV, while for EBV a greater variability of up to 1.5 log10 IU/ml of the mean was shown. Commutability showed marked improvement following fragmentation of both CMV standards but not after fragmentation of the EBV standards. These findings confirm the impact of amplicon size and target fragmentation on commutability for CMV and suggest that for some (but not all) viruses, interlaboratory harmonization can be improved through the use of fragmented quantitative standards.
Assuntos
Infecções por Citomegalovirus/diagnóstico , Infecções por Citomegalovirus/virologia , Citomegalovirus/genética , Infecções por Vírus Epstein-Barr/diagnóstico , Infecções por Vírus Epstein-Barr/virologia , Herpesvirus Humano 4/genética , Carga Viral/métodos , DNA Viral , Humanos , Reação em Cadeia da Polimerase em Tempo Real/métodos , Reação em Cadeia da Polimerase em Tempo Real/normas , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/normasRESUMO
BACKGROUND: Transcription-mediated amplification assays for HBV DNA detection have transitioned from the Ultrio to the Ultrio Plus assay, which features increased analytic sensitivity due to inclusion of a target enhancer reagent. The impact on HBV detection for different categories of HBV infection has not been fully evaluated. STUDY DESIGN AND METHODS: Hepatitis B virus (HBV) DNA and hepatitis B surface antigen (HBsAg) detection rates as well as viral load (VL) distributions in HBV nucleic acid test (NAT)-yield samples were compared during 1 year of screening of South African blood donors with the Ultrio assay and the subsequent year by the Ultrio Plus version. HBV-DNA concentration at the HBsAg seroconversion point was established by regression analysis using a set of antibody to hepatitis B core antigen-negative acute viremic samples. RESULTS: Ultrio Plus detected twofold more window-period (WP) NAT yield donations and 1.7-fold more occult HBV infections than Ultrio. The VL distribution data indicated that Ultrio not only missed samples of less than 100 copies/mL, but also a substantial number higher than this level. The VL at the HBsAg seroconversion point was estimated at 916 copies/mL, whereas the VL at the NAT-conversion points was calculated at 63 and 4.1 copies/mL for Ultrio and Ultrio Plus. This reduced the infectious WP (compared to HBsAg testing) by 10.3 and 20.4 days, respectively. CONCLUSION: The higher-than-expected increase in HBV-NAT yields after introduction of the Ultrio Plus assay is likely attributable to variable sensitivity of the former Ultrio assay for different HBV samples. Therefore, previously published HBV WP reduction and residual risk estimates based on analytical sensitivity of the Ultrio assay need to be revised.
Assuntos
Doadores de Sangue , Testes Diagnósticos de Rotina , Hepatite B/diagnóstico , Limite de Detecção , Reação em Cadeia da Polimerase em Tempo Real/normas , Bancos de Sangue/normas , Doadores de Sangue/estatística & dados numéricos , Calibragem , DNA Viral/sangue , Testes Diagnósticos de Rotina/métodos , Testes Diagnósticos de Rotina/normas , Hepatite B/sangue , Antígenos de Superfície da Hepatite B/sangue , Antígenos de Superfície da Hepatite B/imunologia , Vírus da Hepatite B/genética , Vírus da Hepatite B/imunologia , Humanos , Programas de Rastreamento/métodos , Programas de Rastreamento/normas , Valor Preditivo dos Testes , Reação em Cadeia da Polimerase em Tempo Real/métodos , Sensibilidade e Especificidade , Testes Sorológicos/métodos , Testes Sorológicos/normas , Fatores de Tempo , Carga Viral/fisiologia , Carga Viral/normas , Armazenamento de Sangue/métodosRESUMO
Real-time PCR are often used for the diagnosis and monitoring of Cytomegalovirus (CMV) and Epstein-Barr virus (EBV) infections in susceptible populations. In this context, we evaluated the analytical performances of the Abbott RealTime CMV/EBV maxCycle protocol automated on the m2000 platform (Abbott). It was compared to our routinely-used procedure consisting of a NucleoMag® DNA extraction automated on a STARlet platform followed by manually processed CMV and EBV quantitative real-time PCR (Diagenode). In this study, we showed that both EBV assays exhibited a similar sensitivity but with a better precision for the EBV Abbott RealTime assay. For the CMV performances, the Abbott assay was more sensitive and more precise than our routine method. The use of WHO International Standards also indicated a slight underestimation of the viral loads (-0.25 log10 IU/mL and -0.21 log10 IU/mL for CMV and EBV assays respectively) while these were rather overestimated with the Starlet/Diagenode method (0.48 log10 IU/mL and 0.19 log10 IU/mL for CMV and EBV assays respectively). These trends were confirmed using relevant whole-blood clinical samples and external quality controls. The workflows were also compared and we highlighted a significant technician hands-on time reduction (-63%) using the Abbott CMV/EBV maxCycle automated protocol.
Assuntos
Sangue/virologia , Citomegalovirus/isolamento & purificação , Herpesvirus Humano 4/isolamento & purificação , Reação em Cadeia da Polimerase em Tempo Real/métodos , Carga Viral/métodos , Automação Laboratorial/métodos , Citomegalovirus/genética , Herpesvirus Humano 4/genética , Humanos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Manejo de Espécimes/métodos , Carga Viral/normasRESUMO
Immunocompromised patients are at significant risk from BKV reactivation, causing allograft dysfunction or loss. Patient management relies on viral DNA monitoring, using a viral load cut-off to reduce immunosuppression. However, consistency between viral load detection assays cannot be achieved without an effective means of standardisation. We have worked with the WHO's Expert Committee on Biological Standardisation to develop suitable reference materials and undertake an international collaborative study to establish the 1st WHO International Standard for BKV detection assays. We report on the evaluation of two lyophilised candidate cell culture derived, whole virus preparations, undertaken by 33 expert laboratories. By employing the principles of biological standardisation, we show improved agreement across laboratories, demonstrating the suitability of either candidate for use as a primary order calibrant. Candidate 14/212 was established by the WHO ECBS with an assigned potency of 7.2 log10 International Units/mL intended for the calibration of BKV secondary reference materials.
Assuntos
Vírus BK , DNA Viral , Técnicas de Amplificação de Ácido Nucleico/normas , Carga Viral/normas , Calibragem , DNA Viral/análise , DNA Viral/química , Humanos , Padrões de Referência , Organização Mundial da SaúdeRESUMO
Despite advances in the standardization of quantitative DNAemia tests and efforts to better understand and characterize the performance of reference materials in different assays, it remains unclear how the commutability performance of reference materials is related to intra- and interassay agreement. Building upon previous work, we describe a comprehensive framework to determine the relationship of commutability with assay accuracy and agreement. The use of this framework is illustrated using previously generated data regarding the performance of four quantitative Epstein-Bar virus (EBV) PCR assays with the WHO and ABI standards as examples. The use of these statistical tools can link the performance characteristics of one or more assays with predetermined clinical decision limits and may help improve the development, validation, and clinical utility of such DNAemia tests.
Assuntos
Técnicas de Laboratório Clínico/métodos , DNA Viral/sangue , Testes Diagnósticos de Rotina/normas , Reação em Cadeia da Polimerase em Tempo Real/normas , Carga Viral/normas , Técnicas de Laboratório Clínico/normas , DNA Viral/genética , Interpretação Estatística de Dados , Infecções por Vírus Epstein-Barr/diagnóstico , Infecções por Vírus Epstein-Barr/virologia , Herpesvirus Humano 4/genética , Herpesvirus Humano 4/isolamento & purificação , Humanos , Padrões de Referência , Carga Viral/métodosRESUMO
The 2014 Ebola outbreak in West Africa brought great threat to public health worldwide. There was no approved antiviral therapy or vaccine available to control the disease at that time. Several kinds of Ebola vaccines were urgently under development across the world. Among these, the novel recombinant adenovirus type 5 vector-based Ebola vaccine (Ad5-EBOV)-the first Ebola vaccine based on the 2014 Zaire Guinea epidemic strain-was developed in China, and its safety and immunogenicity were demonstrated in China and Sierra Leone. The license to market the drug was approved on October 19, 2017, by the Chinese Food and Drug Administration. In order to standardize the test on the Ad5-EBOV virus titer, China's national standard substance for the virus titer of Ad5-EBOV was established according to the recommendations for the preparation, characterization, and establishment of international and other biological reference standards from the World Health Organization and Chinese Pharmacopoeia (third edition). The standard for the Ad5-EBOV virus titer was prepared with a volume of 0.5 mL per ampoule in lyophilized form. The samples of the standard, designated as A, B, C, D with different aims, were blinded and distributed to five laboratories to be collaboratively calibrated. The virus titer for this standard was determined with the antibody staining method according to the instructions in the Adeno-X™ Rapid Titer Kit. The homogeneity and stability of the standard substance were also satisfied. The virus titer standard value was 8.54 lg infectious units (IFU)/mL, and the 95% confidence interval was between 7.94 lg IFU/mL and 9.14 lg IFU/mL. This standard was approved by the Chinese national committee and is available on the National Institutes for Food and Drug Control Web site ( www.nifdc.org.cn ; lot no. 250019-201501).
Assuntos
Aprovação de Drogas , Vacinas contra Ebola/normas , Vacinas Sintéticas/normas , Carga Viral/normas , Adenoviridae/genética , China , Vacinas contra Ebola/imunologia , Ebolavirus/imunologia , Células HEK293 , Humanos , Vacinas Sintéticas/imunologiaRESUMO
Detection of acute HIV infection is critical for HIV public health and diagnostics. Clinical fourth-generation antigen (Ag)/antibody (Ab) combination (combo) and p24 Ag immunoassays have enhanced detection of acute infection compared to Ab-alone assays but require ongoing evaluation with currently circulating diverse subtypes. Genetically and geographically diverse HIV clinical isolates were used to assess clinical HIV diagnostic, blood screening, and next-generation assays. Three-hundred-member panels of 20 serially diluted well-characterized antibody-negative HIV isolates for which the researchers were blind to the results (blind panels) were distributed to manufacturers and end-user labs to assess the relative analytic sensitivity of currently approved and preapproved clinical HIV fourth-generation Ag/Ab combo or p24 Ag-alone immunoassays for the detection of diverse subtypes. The limits of detection (LODs) of virus were estimated for different subtypes relative to confirmed viral loads. Analysis of immunoassay sensitivity was benchmarked against confirmed viral load measurements on the blind panel. On the basis of the proportion of positive results on 300 observations, all Ag/Ab combo and standard sensitivity p24 Ag assays performed similarly and within half-log LODs, illustrating the similar breadth of reactivity and diagnostic utility. Ultrasensitive p24 Ag assays achieved dramatically increased sensitivities, while the rapid combo assays performed poorly. The similar performance of the different commercially available fourth-generation assays on diverse subtypes supports their use in broad geographic settings with locally circulating HIV clades and recombinant strains. Next-generation preclinical ultrasensitive p24 Ag assays achieved dramatically improved sensitivity, while rapid fourth-generation assays performed poorly for p24 Ag detection.
Assuntos
Sorodiagnóstico da AIDS/métodos , Sorodiagnóstico da AIDS/normas , Proteína do Núcleo p24 do HIV/sangue , Proteína do Núcleo p24 do HIV/imunologia , Infecções por HIV/diagnóstico , HIV/isolamento & purificação , Imunoensaio/normas , Carga Viral/normas , Benchmarking , HIV/imunologia , Anticorpos Anti-HIV/sangue , Antígenos HIV/sangue , Antígenos HIV/imunologia , Infecções por HIV/sangue , Humanos , Limite de Detecção , Sensibilidade e EspecificidadeRESUMO
Quantitative real-time PCR (qPCR) is increasingly being used for the detection of bovine leukemia virus (BLV) proviral DNA. Nevertheless, quality control for the validation and standardization of such tests is currently lacking. Therefore, the present study was initiated by three Office International des Epizooties (OIE) reference laboratories and three collaborating laboratories to measure the interlaboratory variability of six already developed and available BLV qPCR assays. For that purpose, an international panel of 58 DNA samples reflecting the dynamic range of the majority of the assays was distributed to six testing centers. Based on qualitative results, the overall agreement among all six laboratories was moderate. However, significant variability in the measurement of the BLV proviral DNA copy number was observed among different laboratories. Quantitative PCR assays, even when performed by experienced staff, can yield large variability in BLV proviral DNA copy numbers without harmonization. Further standardization of different factors (i.e., utilization of unified protocols and unique calibrators) should increase interlaboratory agreement.
Assuntos
Leucose Enzoótica Bovina/diagnóstico , Vírus da Leucemia Bovina/fisiologia , Provírus/genética , Reação em Cadeia da Polimerase em Tempo Real/normas , Carga Viral/métodos , Animais , Bovinos , Testes Diagnósticos de Rotina/normas , Laboratórios/normas , Vírus da Leucemia Bovina/genética , RNA Viral/genética , Carga Viral/normasRESUMO
ABTRACT: Establishing a cure for HIV is hindered by the persistence of latently infected cells which constitute the viral reservoir. Real-time qPCR, used for quantification of this reservoir by measuring HIV DNA, requires external calibration; a common choice of calibrator is the 8E5 cell line, which is assumed to be stable and to contain one HIV provirus per cell. In contrast, digital PCR requires no external calibration and potentially provides 'absolute' quantification. We compared the performance of qPCR and dPCR in quantifying HIV DNA in 18 patient samples. HIV DNA was detected in 18 by qPCR and in 15 by dPCR, the difference being due to the smaller sample volume analysed by dPCR. There was good quantitative correlation (R2 = 0.86) between the techniques but on average dPCR values were only 60% of qPCR values. Surprisingly, investigation revealed that this discrepancy was due to loss of HIV DNA from the 8E5 cell calibrant. 8E5 extracts from two other sources were also shown to have significantly less than one HIV DNA copy per cell and progressive loss of HIV from 8E5 cells during culture was demonstrated. We therefore suggest that the copy number of HIV in 8E5 extracts be established by dPCR prior to use as calibrator.
Assuntos
DNA Viral/análise , Erros de Diagnóstico , Infecções por HIV/diagnóstico , HIV/genética , Reação em Cadeia da Polimerase/normas , Carga Viral/normas , Calibragem , Linhagem Celular , DNA Viral/genética , Humanos , Reação em Cadeia da Polimerase/métodos , Carga Viral/métodosRESUMO
A retrospective audit of plasma human herpesvirus-8 (HHV-8) viral load testing was performed in three HIV treatment centres over 24 months. Reasons for testing (360 tests) were: symptoms of systemic inflammatory response syndrome (SIRS) (fever, lymphadenopathy and raised inflammatory markers); monitoring in known HHV-8 pathology other than Kaposi sarcoma (KS); investigation of known/suspected KS, and other/no reason. Of patients with multicentric Castleman disease (MCD), 14/16 (88%) had detectable plasma HHV-8, as did 27/45 (60%) with biopsy proven or clinically confirmed KS, and 6/19 (32%) with lymphoma. Neither of the two patients with MCD and no detectable HHV-8 had SIRS symptoms at the time of the test. There was wide variation between centres in the indications prompting HHV-8 testing, with a more conservative approach resulting in a higher proportion of positive results. Measuring plasma HHV-8 in the absence of SIRS symptoms, established HHV-8 disease monitoring, or confirmed/suspected KS is unlikely to yield detectable HHV-8 thus allowing potential cost savings.
Assuntos
Fidelidade a Diretrizes , Herpesvirus Humano 8/isolamento & purificação , RNA Viral/sangue , Carga Viral , Hiperplasia do Linfonodo Gigante/sangue , Hiperplasia do Linfonodo Gigante/epidemiologia , Herpesvirus Humano 8/genética , Humanos , Auditoria Médica , Reação em Cadeia da Polimerase/métodos , Síndrome de Resposta Inflamatória Sistêmica/epidemiologia , Carga Viral/normasRESUMO
Quantitative PCR is a diagnostic mainstay of clinical virology, and accurate quantitation of viral load among labs requires the use of international standards. However, the use of multiple passages of viral isolates to obtain sufficient material for international standards may result in genomic changes that complicate their use as quantitative standards. We performed next-generation sequencing to obtain single-nucleotide resolution and relative copy number of JC virus (JCV) clinical standards. Strikingly, the WHO international standard and the Exact v1/v2 prototype standards for JCV showed 8-fold and 4-fold variation in genomic coverage between different loci in the viral genome, respectively, due to large deletions in the large T antigen region. Intriguingly, several of the JCV standards sequenced in this study with large T antigen deletions were cultured in cell lines immortalized using simian virus 40 (SV40) T antigen, suggesting the possibility of transcomplementation in cell culture. Using a cutoff 5% allele fraction for junctional reads, 7 different rearrangements were present in the JC virus sequences present in the WHO standard across multiple library preparations and sequencing runs. Neither the copy number differences nor the rearrangements were observed in a clinical sample with a high copy number of JCV or a plasmid control. These results were also confirmed by the quantitative real-time PCR (qPCR), droplet digital PCR (ddPCR), and Sanger sequencing of multiple rearrangements. In summary, targeting different regions of the same international standard can result in up to an 8-fold difference in quantitation. We recommend the use of next-generation sequencing to validate standards in clinical virology.
Assuntos
Dosagem de Genes , Vírus JC/isolamento & purificação , Infecções por Polyomavirus/virologia , Reação em Cadeia da Polimerase em Tempo Real/normas , Padrões de Referência , Infecções Tumorais por Vírus/virologia , Carga Viral/normas , Humanos , Reação em Cadeia da Polimerase em Tempo Real/métodos , Análise de Sequência de DNA , Carga Viral/métodosRESUMO
It has been hoped that the recent availability of WHO quantitative standards would improve interlaboratory agreement for viral load testing; however, insufficient data are available to evaluate whether this has been the case. Results from 554 laboratories participating in proficiency testing surveys for quantitative PCR assays of cytomegalovirus (CMV), Epstein-Barr virus (EBV), BK virus (BKV), adenovirus (ADV), and human herpesvirus 6 (HHV6) were evaluated to determine overall result variability and then were stratified by assay manufacturer. The impact of calibration to international units/ml (CMV and EBV) on variability was also determined. Viral loads showed a high degree of interlaboratory variability for all tested viruses, with interquartile ranges as high as 1.46 log10 copies/ml and the overall range for a given sample up to 5.66 log10 copies/ml. Some improvement in result variability was seen when international units were adopted. This was particularly the case for EBV viral load results. Variability in viral load results remains a challenge across all viruses tested here; introduction of international quantitative standards may help reduce variability and does so more or less markedly for certain viruses.
Assuntos
Adenoviridae/isolamento & purificação , Herpesviridae/isolamento & purificação , Ensaio de Proficiência Laboratorial , Carga Viral/métodos , Carga Viral/normas , Viroses/virologia , Humanos , Reprodutibilidade dos Testes , Organização Mundial da SaúdeRESUMO
BACKGROUND: Inter-laboratory variability in quantifying pathogens involved in viral disease following transplantation may have a great impact on patient care, especially when pre-emptive strategies are used for prevention. OBJECTIVES: The aim of this study was to analyze the variability in quantifying CMV, EBV and BKV DNA from 15 virology laboratories of the Italian Infections in Transplant Working Group (GLaIT) involved in monitoring transplanted patients. STUDY DESIGN: Panels from international Quality Control programs for Molecular Diagnostics (QCMD, year 2012), specific for the detection of CMV in plasma, CMV in whole blood (WB), EBV and BKV were used. Intra- and inter-laboratory variability, as well as, deviations from QCMD consensus values were measured. RESULTS: 100% specificity was obtained with all panels. A sensitivity of 100% was achieved for EBV and BKV evaluations. Three CMV samples, with concentrations below 3 log10 copies/ml, were not detected by a few centers. Mean intra-laboratory variability (% CV) was 1.6 for CMV plasma and 3.0 for CMV WB. Mean inter-laboratory variability (% CV) was below 15% for all of the tested panels. Inter-laboratory variability was higher for CMV in WB with respect to the CMV plasma panel (3.0 vs 1.6% CV). The percentiles 87.7%, 58.6%, 89.6% and 74.7% fell within±0.5 log10 difference of the consensus values for CMV plasma, CMV WB, EBV and BKV panels, respectively. CONCLUSIONS: An acceptable intra- and inter-laboratory variability, in comparison with international standards was observed in this study. However, further harmonization in viral genome quantification is a reasonable goal for the future.
Assuntos
Vírus BK/isolamento & purificação , Citomegalovirus/isolamento & purificação , DNA Viral/análise , Herpesvirus Humano 4/isolamento & purificação , Transplantados , Carga Viral/métodos , Carga Viral/normas , Humanos , Itália , Reprodutibilidade dos TestesRESUMO
Given recent advances in the development of quantitative standards, particularly WHO international standards, efforts to better understand the commutability of reference materials have been made. Existing approaches in evaluating commutability include prediction intervals and correspondence analysis; however, the results obtained from existing approaches may be ambiguous. We have developed a "deviation-from-ideal" (DFI) approach to evaluate commutability of standards and applied it to the assessment of Epstein-Bar virus (EBV) load testing in four quantitative PCR assays, treating digital PCR as a reference assay. We then discuss advantages and limitations of the DFI approach as well as experimental design to best evaluate the commutability of an assay in practice.
Assuntos
Reação em Cadeia da Polimerase em Tempo Real/métodos , Reação em Cadeia da Polimerase em Tempo Real/normas , Padrões de Referência , Carga Viral/métodos , Carga Viral/normas , Herpesvirus Humano 4/genética , Herpesvirus Humano 4/isolamento & purificação , HumanosRESUMO
The first WHO international standard for Epstein-Barr virus (EBV) (WHO EBV standard) for nucleic acid amplification technology (NAT)-based assays was commercialized in January 2012 by the National Institute for Biological Standards and Control. In the study reported here, we compared whole-blood EBV DNA load (EDL) results from 12 French laboratories for seven samples (Quality Controls for Molecular Diagnostics 2013 proficiency panel) in order to determine whether expression in international units reduces interlaboratory variability in whole-blood EDLs. Each testing laboratory used a conversion factor to convert EDL results from copies per milliliter to international units per milliliter. This conversion factor was calculated from the WHO EBV standard according to the protocol described in this study (nine laboratories) or the recommendations of the PCR kit suppliers (three laboratories). The interlaboratory variability in whole-blood EDL results was reduced after standardization of the results using the WHO EBV standard. For the seven samples tested, standard deviations (SD) ranged from 0.41 to 0.55 when the results were expressed in log copies per milliliter, whereas the SD ranged from 0.17 to 0.32 when results were given in log international units per milliliter. Comparing the variance data (F test), we showed that the dispersion of whole-blood EDL results was significantly lower when they were expressed in log international units per milliliter (P < 0.001 for six of seven samples and P < 0.05 for one sample with a low mean EDL of 2.62 log IU/ml). This study showed that the use of the WHO EBV standard could improve the homogeneity of whole-blood EDL results between laboratories as well as the monitoring of patients at high risk of posttransplant lymphoproliferative disorders or other EBV-associated diseases.
Assuntos
Sangue/virologia , Infecções por Vírus Epstein-Barr/virologia , Herpesvirus Humano 4/isolamento & purificação , Técnicas de Amplificação de Ácido Nucleico/normas , Padrões de Referência , Carga Viral/normas , França , Humanos , Técnicas de Amplificação de Ácido Nucleico/métodos , Reprodutibilidade dos Testes , Carga Viral/métodos , Organização Mundial da SaúdeRESUMO
International guidelines define a BK virus (BKV) load of ≥4 log10 copies/ml as presumptive of BKV-associated nephropathy (BKVN) and a cutoff for therapeutic intervention. To investigate whether BKV DNA loads (BKVL) are comparable between laboratories, 2 panels of 15 and 8 clinical specimens (urine, whole blood, and plasma) harboring different BKV genotypes were distributed to 20 and 27 French hospital centers in 2013 and 2014, respectively. Although 68% of the reported results fell within the acceptable range of the expected result ±0.5 log10, the interlaboratory variation ranged from 1.32 to 5.55 log10. Polymorphisms specific to BKV genotypes II and IV, namely, the number and position of mutations in amplification target genes and/or deletion in standards, arose as major sources of interlaboratory disagreements. The diversity of DNA purification methods also contributed to the interlaboratory variability, in particular for urine samples. Our data strongly suggest that (i) commercial external quality controls for BKVL assessment should include all major BKV genotypes to allow a correct evaluation of BKV assays, and (ii) the BKV sequence of commercial standards should be provided to users to verify the absence of mismatches with the primers and probes of their BKV assays. Finally, the optimization of primer and probe design and standardization of DNA extraction methods may substantially decrease interlaboratory variability and allow interinstitutional studies to define a universal cutoff for presumptive BKVN and, ultimately, ensure adequate patient care.