RESUMO
Human Herpesvirus 8 (HHV-8) has been classified by sequence analysis of open reading frame (ORF) K1, ORF K15, and variable sequence loci within the central constant region. The purpose of this study was to examine the molecular epidemiology of HHV-8 in an Irish population. This retrospective study included 30 patients who had HHV-8 DNA detected in plasma. Nested end-point PCR was used to characterise four regions of the HHV-8 genome, K1, T0.7 (K12), ORF 75, and K15. Sequencing data were obtained for 23 specimens from 19 patients. Phylogenetic analysis of ORF K1 demonstrated that subtypes A, B, C and F were present in 37%, 11%, 47% and 5%, respectively. For T0.7 and ORF 75, sequencing data were obtained for 12 patients. For T0.7, subtypes A/C, J, B, R and Q were present in 58%, 17%, 8%, 8%, and 8%, respectively. For ORF 75, subtypes A, B, C and D were present in 58%, 8%, 25%, and 8%, respectively. K15 sequences were determined for 13 patients. 69% had the P allele and 31% had the M allele. The data generated by this study demonstrate that a broad variety of HHV-8 subtypes are represented in patients exhibiting HHV-8-related disease in Ireland, a low prevalence country. The predominance of C and A K1 subtypes was as expected for a Western European population. The 31% prevalence for K15 subtype M was higher than expected for a Western European population. This may represent the changing and evolving epidemiology in Ireland due to altered migration patterns.
Assuntos
DNA Viral , Infecções por Herpesviridae , Herpesvirus Humano 8 , Epidemiologia Molecular , Filogenia , Análise de Sequência de DNA , Humanos , Irlanda/epidemiologia , Infecções por Herpesviridae/epidemiologia , Infecções por Herpesviridae/virologia , Herpesvirus Humano 8/genética , Herpesvirus Humano 8/classificação , Herpesvirus Humano 8/isolamento & purificação , Masculino , Feminino , Estudos Retrospectivos , Pessoa de Meia-Idade , Adulto , DNA Viral/genética , Idoso , Adulto Jovem , Reação em Cadeia da Polimerase , Genótipo , Adolescente , Fases de Leitura Aberta , Idoso de 80 Anos ou mais , Criança , Dados de Sequência MolecularRESUMO
OBJECTIVE: Kaposi sarcoma is a vascular tumor that affects the pulmonary system. However, the diagnosis of airway lesions suggestive of pulmonary Kaposi sarcoma (pKS) is reliant on bronchoscopic visualization. We evaluated the role of Kaposi sarcoma herpesvirus (KSHV) viral load in bronchoalveolar lavage (BAL) as a diagnostic biomarker in patients with bronchoscopic evidence of pKS and evaluated inflammatory cytokine profiles in BAL and blood samples. DESIGN: In this retrospective study, we evaluated KSHV viral load and cytokine profiles within BAL and blood samples in patients who underwent bronchoscopy for suspected pKS between 2016 and 2021. METHODS: KSHV viral load and cytokine profiles were obtained from both the circulation and BAL samples collected at the time of bronchoscopy to evaluate compartment-specific characteristics. BAL was centrifuged and stored as cell pellets and KSHV viral load was measured using primers for the KSHV K6 gene regions. RESULTS: We evaluated 38 BAL samples from 32 patients (30 with HIV co-infection) of whom 23 had pKS. In patients with airway lesions suggestive of pKS, there was higher KSHV viral load (median 3188 vs. 0âcopies/10 6 cell equivalent; P â=â0.0047). A BAL KSHV viral load cutoff of 526âcopies/10 6 cells had a sensitivity of 72% and specificity of 89% in determining lesions consistent with pKS. Those with pKS also had higher IL-1ß and IL-8 levels in BAL. The 3-year survival rate for pKS patients was 55%. CONCLUSION: KSHV viral load in BAL shows potential for aiding in pKS diagnosis. Patients with pKS also have evidence of cytokine dysregulation in BAL.
Assuntos
Líquido da Lavagem Broncoalveolar , Citocinas , Herpesvirus Humano 8 , Sarcoma de Kaposi , Carga Viral , Humanos , Sarcoma de Kaposi/virologia , Sarcoma de Kaposi/diagnóstico , Herpesvirus Humano 8/isolamento & purificação , Masculino , Feminino , Estudos Retrospectivos , Pessoa de Meia-Idade , Líquido da Lavagem Broncoalveolar/virologia , Líquido da Lavagem Broncoalveolar/citologia , Adulto , Citocinas/análise , Broncoscopia , Neoplasias Pulmonares/diagnóstico , Neoplasias Pulmonares/virologia , Neoplasias Pulmonares/patologia , Biomarcadores/análise , Infecções por HIV/complicações , Infecções por HIV/diagnóstico , Idoso , Lavagem BroncoalveolarRESUMO
Kaposi sarcoma (KS)-associated herpesvirus (KSHV/HHV-8) was first sequenced from the body cavity (BC) lymphoma cell line, BC-1, in 1996. Few other KSHV genomes have been reported. Our knowledge of sequence variation for this virus remains spotty. This study reports additional genomes from historical US patient samples and from African KS biopsies. It describes an assay that spans regions of the virus that cannot be covered by short read sequencing. These include the terminal repeats, the LANA repeats, and the origins of replication. A phylogenetic analysis, based on 107 genomes, identified three distinct clades; one containing isolates from USA/Europe/Japan collected in the 1990s and two of Sub-Saharan Africa isolates collected since 2010. This analysis indicates that the KSHV strains circulating today differ from the isolates collected at the height of the AIDS epidemic. This analysis helps experimental designs and potential vaccine studies.
Assuntos
Genoma Viral , Genômica , Genótipo , Infecções por Herpesviridae/virologia , Herpesvirus Humano 8/classificação , Herpesvirus Humano 8/genética , Sarcoma de Kaposi/virologia , Adulto , Linhagem Celular , Feminino , Regulação Viral da Expressão Gênica , Genômica/métodos , Infecções por Herpesviridae/diagnóstico , Herpesvirus Humano 8/isolamento & purificação , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Pessoa de Meia-Idade , Fenótipo , Filogenia , Recombinação GenéticaRESUMO
The Kaposi's sarcoma associated herpesvirus protein ORF45 binds the extracellular signal-regulated kinase (ERK) and the p90 Ribosomal S6 kinase (RSK). ORF45 was shown to be a kinase activator in cells but a kinase inhibitor in vitro, and its effects on the ERK-RSK complex are unknown. Here, we demonstrate that ORF45 binds ERK and RSK using optimized linear binding motifs. The crystal structure of the ORF45-ERK2 complex shows how kinase docking motifs recognize the activated form of ERK. The crystal structure of the ORF45-RSK2 complex reveals an AGC kinase docking system, for which we provide evidence that it is functional in the host. We find that ORF45 manipulates ERK-RSK signaling by favoring the formation of a complex, in which activated kinases are better protected from phosphatases and docking motif-independent RSK substrate phosphorylation is selectively up-regulated. As such, our data suggest that ORF45 interferes with the natural design of kinase docking systems in the host.
Assuntos
Cristalografia por Raios X/métodos , Herpesvirus Humano 8/metabolismo , Proteínas Imediatamente Precoces/metabolismo , Proteína Quinase 1 Ativada por Mitógeno/química , Proteínas Quinases S6 Ribossômicas 90-kDa/química , Sarcoma de Kaposi/metabolismo , Linhagem Celular , Biologia Computacional , Herpesvirus Humano 8/química , Herpesvirus Humano 8/isolamento & purificação , Humanos , Proteínas Imediatamente Precoces/química , Proteína Quinase 1 Ativada por Mitógeno/metabolismo , Fosforilação , Proteínas Quinases S6 Ribossômicas 90-kDa/metabolismo , Sarcoma de Kaposi/patologia , Sarcoma de Kaposi/virologia , Transdução de SinaisRESUMO
OBJECTIVES: To evaluate early activation of latent viruses in polytrauma patients and consider prognostic value of viral micro-RNAs in these patients. DESIGN: This was a subset analysis from a prospectively collected multicenter trauma database. Blood samples were obtained upon admission to the trauma bay (T0), and trauma metrics and recovery data were collected. SETTING: Two civilian Level 1 Trauma Centers and one Military Treatment Facility. PATIENTS: Adult polytrauma patients with Injury Severity Scores greater than or equal to 16 and available T0 plasma samples were included in this study. Patients with ICU admission greater than 14 days, mechanical ventilation greater than 7 days, or mortality within 28 days were considered to have a complicated recovery. INTERVENTIONS: None. MEASUREMENTS AND MAIN RESULTS: Polytrauma patients (n = 180) were identified, and complicated recovery was noted in 33%. Plasma samples from T0 underwent reverse transcriptase-quantitative polymerase chain reaction analysis for Kaposi's sarcoma-associated herpesvirus micro-RNAs (miR-K12_10b and miRK-12-12) and Epstein-Barr virus-associated micro-RNA (miR-BHRF-1), as well as Luminex multiplex array analysis for established mediators of inflammation. Ninety-eight percent of polytrauma patients were found to have detectable Kaposi's sarcoma-associated herpesvirus and Epstein-Barr virus micro-RNAs at T0, whereas healthy controls demonstrated 0% and 100% detection rate for Kaposi's sarcoma-associated herpesvirus and Epstein-Barr virus, respectively. Univariate analysis revealed associations between viral micro-RNAs and polytrauma patients' age, race, and postinjury complications. Multivariate least absolute shrinkage and selection operator analysis of clinical variables and systemic biomarkers at T0 revealed that interleukin-10 was the strongest predictor of all viral micro-RNAs. Multivariate least absolute shrinkage and selection operator analysis of systemic biomarkers as predictors of complicated recovery at T0 demonstrated that miR-BHRF-1, miR-K12-12, monocyte chemoattractant protein-1, and hepatocyte growth factor were independent predictors of complicated recovery with a model complicated recovery prediction area under the curve of 0.81. CONCLUSIONS: Viral micro-RNAs were detected within hours of injury and correlated with poor outcomes in polytrauma patients. Our findings suggest that transcription of viral micro-RNAs occurs early in the response to trauma and may be associated with the biological processes involved in polytrauma-induced complicated recovery.
Assuntos
MicroRNAs/análise , Traumatismo Múltiplo/imunologia , Traumatismo Múltiplo/virologia , RNA Viral/análise , Adulto , Feminino , Herpesvirus Humano 4/genética , Herpesvirus Humano 4/isolamento & purificação , Herpesvirus Humano 8/genética , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , MicroRNAs/sangue , MicroRNAs/genética , Pessoa de Meia-Idade , RNA Viral/sangue , RNA Viral/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa/métodos , Reação em Cadeia da Polimerase Via Transcriptase Reversa/estatística & dados numéricosRESUMO
Kaposi sarcoma (KS) herpesvirus (KSHV), also known as human herpesvirus 8, is the causal agent of KS but is also pathogenetically related to several lymphoproliferative disorders, including primary effusion lymphoma (PEL)/extracavitary (EC) PEL, KSHV-associated multicentric Castleman disease (MCD), KSHV+ diffuse large B-cell lymphoma, and germinotropic lymphoproliferative disorder. These different KSHV-associated diseases may co-occur and may have overlapping features. KSHV, similar to Epstein-Barr virus (EBV), is a lymphotropic gammaherpesvirus that is preferentially present in abnormal lymphoid proliferations occurring in immunecompromised individuals. Notably, both KSHV and EBV can infect and transform the same B cell, which is frequently seen in KSHV+ EBV+ PEL/EC-PEL. The mechanisms by which KSHV leads to lymphoproliferative disorders is thought to be related to the expression of a few transforming viral genes that can affect cellular proliferation and survival. There are critical differences between KSHV-MCD and PEL/EC-PEL, the 2 most common KSHV-associated lymphoid proliferations, including viral associations, patterns of viral gene expression, and cellular differentiation stage reflected by the phenotype and genotype of the infected abnormal B cells. Advances in treatment have improved outcomes, but mortality rates remain high. Our deepening understanding of KSHV biology, clinical features of KSHV-associated diseases, and newer clinical interventions should lead to improved and increasingly targeted therapeutic interventions.
Assuntos
Infecções por Vírus Epstein-Barr/complicações , Doenças Hematológicas/patologia , Herpesvirus Humano 4/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Transtornos Linfoproliferativos/patologia , Sarcoma de Kaposi/complicações , Infecções por Vírus Epstein-Barr/virologia , Doenças Hematológicas/epidemiologia , Doenças Hematológicas/virologia , Humanos , Transtornos Linfoproliferativos/epidemiologia , Transtornos Linfoproliferativos/virologia , Sarcoma de Kaposi/virologiaRESUMO
ABSTRACT: Pulmonary Kaposi sarcoma (pKS) caused by Human herpesvirus 8 (HHV-8) is a devastating form of KS in patients with advanced acquired immunodeficiency syndrome (AIDS) and is associated with increased morbidity and mortality. Blood T cells play a central role in the response of HIV-1 and HHV-8. However, little information is available on T cells in the alveolar space of HIV-1-associated pKS patients.Therefore, we examined CD8+ and CD4+ T cells in the alveolar space in comparison with the blood of patients with pKS. We recruited 26 HIV-1 positive patients with KS, including 15 patients with pKS. Bronchoalveolar lavage (BAL) cells and blood mononuclear cells were analyzed for T cell memory phenotypes, surface markers associated with exhaustion, and intracellular cytokine staining (ICS) using flow cytometry. HIV-1 and HHV-8 viral loads were measured in plasma by quantitative PCR.BAL T cells showed reduced inflammatory capacities and significantly diminished polyfunctionality compared to blood T cells from patients with pKS. This was not accompanied by increased expression of exhaustion markers, such as TIM-3 and PD-1.More importantly, we found a negative correlation between the production of MIP1-ß and TNF-α in T cells in BAL and blood, indicating compartmentalised immune responses to pKS and accentuated chronic HIV-1/HHV-8 pathogenesis via T cells in the lungs of people with pKS.
Assuntos
Infecções Oportunistas Relacionadas com a AIDS/virologia , Líquido da Lavagem Broncoalveolar/virologia , Soropositividade para HIV/complicações , Herpesvirus Humano 8/imunologia , Neoplasias Pulmonares/virologia , Sarcoma de Kaposi/virologia , Linfócitos T Reguladores/imunologia , Antígenos Virais/imunologia , Linfócitos T CD4-Positivos/imunologia , Linfócitos T CD8-Positivos/imunologia , HIV-1/patogenicidade , Infecções por Herpesviridae/complicações , Infecções por Herpesviridae/virologia , Herpesvirus Humano 8/genética , Herpesvirus Humano 8/isolamento & purificação , Humanos , Reação em Cadeia da PolimeraseRESUMO
RATIONAL: Multicentric Castleman disease (MCD) is a nonclonal lymphoproliferative disorder that is rarely reported from Southeast Asian countries. Here, we report a case of human herpesvirus 8 (HHV-8)-associated MCD in a patient with advanced human immunodeficiency virus (HIV) infection who presented with prolonged intermittent fever, urticarial rash, hepatosplenomegaly, and generalized lymphadenopathy. PATIENT CONCERNS: A 34-year-old man with advanced HIV infection who was in good compliance with his antiretroviral treatment regimen presented with intermittent fever, weight loss, marked hepatosplenomegaly, and generalized lymphadenopathy. Recurrent symptoms of high-grade fever, abdominal discomfort, pancytopenia, and high C-reactive protein level occurred for 16âmonths. DIAGNOSES: Histopathological findings of left inguinal lymph node revealed diffuse effacement of lymph node architecture with coexpression of HHV-8 latency-associated nuclear antigen 1 from immunohistochemical staining. The HHV-8 viral load was 335,391âcopies/mL. INTERVENTIONS: The patient was treated initially with one dose of intravenous rituximab (375âmg/m2) followed by subcutaneous rituximab (1400âmg) weekly for 5âweeks. OUTCOMES: The patient's recurrent systemic symptoms subsided dramatically, and he has now been in remission for almost two years. LESSONS: HHV8-associated MCD remains a diagnostic challenge in advanced HIV disease and should be suspected in those with recurrent flares of systemic inflammatory symptoms. Lymph node histopathology is essential for diagnosis and for excluding clonal malignancy. HHV-8 viral load is also useful for diagnosis and for monitoring disease activity.
Assuntos
Hiperplasia do Linfonodo Gigante/diagnóstico , Infecções por HIV/complicações , Herpesvirus Humano 8/isolamento & purificação , Linfadenopatia , Adulto , Antígenos Virais , Hiperplasia do Linfonodo Gigante/tratamento farmacológico , Infecções por HIV/tratamento farmacológico , Herpesvirus Humano 8/imunologia , Humanos , Linfadenopatia/etiologia , Masculino , Rituximab/uso terapêutico , Esplenomegalia , Resultado do TratamentoRESUMO
BACKGROUND: For a patient presenting with fever, multiple lymphadenopathy and splenomegaly, pathogen infection should be preferentially considered, followed by lymphoid malignancies. When traditional laboratory and pathological detection cannot find the pathogenic microorganism, metagenomic sequencing (MGS) which targets the person's genome for exceptional genetic disorders may detect a rare pathogen. CASE PRESENTATION: Here, we introduced the diagnostic clue of a case of multicentric Castleman disease (MCD) with hemophagocytic syndrome which was elicited from the detection of human herpesvirus-8 in the blood of a HIV-1 infected person by MGS technology during pathogen inspection. This case highlights the need to increase the awareness of MCD among clinicians and pathologists. CONCLUSIONS: MGS technology may play a pivotal role in providing diagnostic clues during pathogen inspection, especially when pathogens are not detectable by conventional methods.
Assuntos
Hiperplasia do Linfonodo Gigante/patologia , Infecções por Herpesviridae/complicações , Herpesvirus Humano 8/isolamento & purificação , Linfo-Histiocitose Hemofagocítica/patologia , Hiperplasia do Linfonodo Gigante/etiologia , Hiperplasia do Linfonodo Gigante/virologia , Infecções por Herpesviridae/virologia , Humanos , Linfo-Histiocitose Hemofagocítica/etiologia , Linfo-Histiocitose Hemofagocítica/virologia , Masculino , Pessoa de Meia-Idade , PrognósticoRESUMO
Human herpesvirus 8 (HHV8) is endemic in Africa, although studies of this infection are rare in Congo. We evaluated seroprevalence and HHV-8 diversity among people living with HIV. We included 353 patients receiving highly active antiretroviral therapy. Antibodies against HHV-8 latency-associated nuclear antigen were detected by indirect immunofluorescence. In HHV-8 positive patients, we performed HHV-8 quantification in blood and saliva by real-time PCR and typing by Sanger sequencing of K1 open reading frame. HHV-8 seroprevalence was 19%, being male (odd ratio [OR] = 1.741, [95% Confidence interval {CI}, 0.97-3.07]; p = 0.0581) and having multiple sex partners before HIV diagnosis (OR = 1.682, [CI 95%, 0.97-2.92]; p = 0.0629) tended to be associated with HHV-8 seropositivity. Of the 64 HHV-8 seropositive patients, HHV-8 DNA was detected in 10 (16%) in saliva, 6 (9%) in whole-blood and in 2 (3%) in both whole-blood and saliva. Three out of 6 HHV-8 strains were subtypes A5, 2 subtype B1 and 1 subtype C. HHV-8 seroprevalence was relatively low with more frequent carriage in men, associated with asymptomatic oral excretion and a predominance of subtype A5. These data tend to support the hypothesis of horizontal transmission in people living with HIV in Brazzaville.
Assuntos
Anticorpos Antivirais/sangue , Infecções por HIV/complicações , HIV/isolamento & purificação , Infecções por Herpesviridae/epidemiologia , Herpesvirus Humano 8/classificação , Saliva/virologia , Adulto , África/epidemiologia , Estudos Transversais , Feminino , Seguimentos , Infecções por HIV/virologia , Infecções por Herpesviridae/sangue , Infecções por Herpesviridae/virologia , Herpesvirus Humano 8/imunologia , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Pessoa de Meia-Idade , Filogenia , Prognóstico , Estudos Prospectivos , Estudos SoroepidemiológicosAssuntos
COVID-19/complicações , Síndrome da Liberação de Citocina/terapia , Infecções por Herpesviridae/terapia , Transplante de Fígado/efeitos adversos , Rituximab/uso terapêutico , Aloenxertos/virologia , COVID-19/diagnóstico , COVID-19/imunologia , COVID-19/terapia , Carcinoma Hepatocelular/cirurgia , Terapia Combinada/métodos , Síndrome da Liberação de Citocina/diagnóstico , Síndrome da Liberação de Citocina/imunologia , Infecções por Herpesviridae/complicações , Infecções por Herpesviridae/diagnóstico , Infecções por Herpesviridae/transmissão , Herpesvirus Humano 8/isolamento & purificação , Humanos , Fígado/virologia , Neoplasias Hepáticas/cirurgia , Masculino , Pessoa de Meia-Idade , Diálise Renal , SARS-CoV-2/isolamento & purificação , Resultado do TratamentoRESUMO
BACKGROUND: Classic Kaposi sarcoma (CKS) is a vascular sarcoma associated with human herpesvirus 8 (HHV-8), which is known to be more common in Mediterranean elderly men and is characterized by indolent clinical behavior. Xinjiang province in China is considered an endemic region for Kaposi's sarcoma-associated herpesvirus (KSHV), with higher incidence among adults of Kazak and Uyghur ethnicities. Cases of CKS are rarely reported in inland China. Here, we followed a case of CKS for 7 years in a patient of Miao ethnic background in southwestern China. CASE PRESENTATION: A 63-year-old Miao (southwestern China) man was initially diagnosed with CKS in 2010, having a history of limb lesions for 37 years, with left eyelid and binaural lesions for 9 years. He did not have sexual contact with men and was human immunodeficiency virus (HIV)-negative. Due to his lumbago and fever, spinal tuberculosis in the lumbar vertebra was highly suspected after computed tomography (CT) scan. However, diagnostic antituberculosis treatment for 4 weeks failed. The patient was followed up in 2016, when the rash was recovering as the systemic symptoms improved. A new CT was performed, which showed a partial response despite the absence of any medical treatment. The open reading frame (ORF)-K1 of KSHV from skin tissue of the foot was amplified and sequenced, and K1 belonged to subtype A. This genotype is consistent with the typical subtype present in Xinjiang. CONCLUSIONS: We describe spontaneous partial regression of CKS in a patient of Miao ethnicity in inland China. Our sample may represent an unknown, novel genotype. Surveillance and regulating the immune state may represent a valuable approach for this rare disease.
Assuntos
Herpesvirus Humano 8/genética , Herpesvirus Humano 8/isolamento & purificação , Sarcoma de Kaposi/patologia , Neoplasias Cutâneas/patologia , Adulto , Idoso , China , Etnicidade , Genoma Viral , Genótipo , Herpesvirus Humano 8/classificação , Humanos , Masculino , Proteínas de Membrana , Pessoa de Meia-Idade , Sarcoma de Kaposi/virologia , Neoplasias Cutâneas/virologia , Proteínas do Envelope Viral/classificação , Proteínas do Envelope Viral/genéticaRESUMO
BACKGROUND AND AIM: Multicentric Castleman's disease (MCD) is a rare lymphoproliferative disorder manifesting as multiple lymphadenopathy, multiorgan involvement, and inflammatory symptoms. This study aims at highlighting some unique features of MCD in Indian patients. MATERIALS AND METHODS: These 17 patients from review of 78 cases of Castleman's disease (CD) diagnosed. Besides routine tissue sections were stained for Human Herpes Virus 8 latency associated nuclear antigen (HHV8-LANA) by immunohistochemistry (IHC) and Epstein Barr virus latent membrane protein (EBV-LMP) or Epstein Barr Virus by in situ hybridization (EBER-ISH). RESULT: The cases included Plasma cell variant (11 cases), mixed MCD (4 cases) and two concurrent MCD with large B cell lymphoma in HIV positive patients. Median age of disease onset was 47 years and female predominance was seen. Out of 15 MCD uncomplicated by lymphoma, 5 had POEMS (Polyneuropathy, organomegaly, endocrinopathy, myeloma protein, skin changes) and one also had TAFRO (Thrombocytopenia, anasarca, fever, marrow reticulin fibrosis, organomegaly, normal or slightly elevated immunoglobulin) syndrome. Out of 10 MCD without lymphoma, 2 cases showed few EBV positive large cells, both have features of POEMS. All 17 MCD cases were negative for HHV8-LANA IHC. Two HIV patients with MCD had large cell lymphoma, intrasinusoidal pattern, of which one was EBV positive. Though four relapses were seen, none died from disease. One of the two patients complicated by lymphoma died from disease. CONCLUSION: Indian patients with MCD show female preponderance and are negative for HHV8 but show EBV positive cells. This makes a case for role of EBV in etiopathogenesis of MCD in India.
Assuntos
Hiperplasia do Linfonodo Gigante/diagnóstico , Hiperplasia do Linfonodo Gigante/virologia , Herpesvirus Humano 4/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Adulto , Hiperplasia do Linfonodo Gigante/patologia , Infecções por Vírus Epstein-Barr/complicações , Feminino , Humanos , Índia , Masculino , Pessoa de Meia-Idade , Síndrome POEMS/complicações , Síndrome POEMS/patologia , Plasmócitos/patologia , Estudos Retrospectivos , Centros de Atenção Terciária , Adulto JovemRESUMO
BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
Assuntos
Transfusão de Sangue , DNA Viral/sangue , Herpesvirus Humano 6/genética , Herpesvirus Humano 7/genética , Herpesvirus Humano 8/genética , Reação em Cadeia da Polimerase Multiplex/métodos , DNA Viral/genética , Feminino , Herpesvirus Humano 6/isolamento & purificação , Herpesvirus Humano 7/isolamento & purificação , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Reação em Cadeia da Polimerase Multiplex/normas , Estudos Prospectivos , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Carga Viral/métodos , Carga Viral/normasRESUMO
Coexistence of multicentric Castleman disease and Kaposi sarcoma is rare and might be missed without an experienced pathologists' interpretation. A 46-year-old man had been diagnosed with HIV infection and treated with combination antiretroviral therapy of dolutegravir/abacavir/lamivudine (Triumeq) for one year. The latest viral load was 49 copies/mL and CD4 T-cell count was 192 cells/uL. He was admitted due to fever off and on, splenomegaly, general lymphadenopathy, and severe thrombocytopenia for two months. Biopsy of a purplish skin lesion and gastric tissue showed Kaposi sarcoma. The pathology of inguinal lymph nodes revealed coexistence of Kaposi sarcoma and multicentric Castleman disease. The plasma Kaposi sarcoma herpesvirus viral load was 365,000 copies/mL. During hospitalization, progressive pancytopenia and spiking fever persisted, and he died of multi-organ failure before completion of chemotherapeutic treatments with rituximab plus liposomal doxorubicin.
Assuntos
Hiperplasia do Linfonodo Gigante/complicações , Infecções por HIV/complicações , Herpesvirus Humano 8/isolamento & purificação , Sarcoma de Kaposi/complicações , Hiperplasia do Linfonodo Gigante/tratamento farmacológico , Hiperplasia do Linfonodo Gigante/virologia , Evolução Fatal , Febre/etiologia , Infecções por HIV/tratamento farmacológico , Humanos , Linfonodos/patologia , Linfadenopatia/diagnóstico por imagem , Masculino , Pessoa de Meia-Idade , Rituximab/uso terapêutico , Sarcoma de Kaposi/tratamento farmacológico , Tomografia Computadorizada por Raios XRESUMO
Human herpesvirus 8 (HHV-8) seroprevalence varies geographically and between subpopulations. High seroprevalence rates have been ascribed to men who have sex with men (MSM), African migrants, and HIV-infected individuals. The objective of this study was to determine the seroprevalence of HHV-8 in an Irish population, including specific risk groups. A cross-sectional study of 200 blood donors and 200 genitourinary medicine (GUM) and infectious diseases (ID) clinic patients was performed, with testing for Immunoglobulin G (IgG) antibodies to HHV-8 lytic antigens using a commercial indirect fluorescence assay (Scimedx Corp.). Verification was performed at the Centers for Disease Control and Prevention (CDC). All 200 blood donor samples were negative for HHV-8 IgG antibodies. 21% of GUM and ID patients were positive for HHV-8 IgG antibodies. One hundred of these patients were MSM, 35% of whom were HHV-8 seropositive (46% of HIV-positive MSM and 24% of HIV-negative MSM). Of 100 heterosexual patients, only 7% were HHV-8 seropositive. The absence of seropositivity in 200 Irish blood donors may suggest that Ireland has a low overall population HHV-8 seroprevalence. The proportion of HHV-8 seropositivity in the MSM population was significantly higher than in the heterosexual population and most marked in HIV-positive MSM.
Assuntos
Doadores de Sangue/estatística & dados numéricos , Infecções por Herpesviridae/epidemiologia , Herpesvirus Humano 8/imunologia , Heterossexualidade/estatística & dados numéricos , Homossexualidade Masculina/estatística & dados numéricos , Adulto , Idoso , Anticorpos Antivirais/sangue , Anticorpos Antivirais/imunologia , Fatores de Transcrição de Zíper de Leucina Básica/imunologia , Doenças Transmissíveis/sangue , Doenças Transmissíveis/epidemiologia , Estudos Transversais , Feminino , Soropositividade para HIV/sangue , Soropositividade para HIV/epidemiologia , Infecções por Herpesviridae/sangue , Herpesvirus Humano 8/isolamento & purificação , Humanos , Irlanda/epidemiologia , Masculino , Pessoa de Meia-Idade , Proteínas Repressoras/imunologia , Estudos Soroepidemiológicos , Proteínas Virais/imunologia , Adulto JovemRESUMO
Intra-host tumor virus variants may influence the pathogenesis and treatment responses of some virally-associated cancers. However, the intra-host variability of Kaposi sarcoma-associated herpesvirus (KSHV), the etiologic agent of Kaposi sarcoma (KS), has to date been explored with sequencing technologies that possibly introduce more errors than that which occurs in the viral population, and these studies have only studied variable regions. Here, full-length KSHV genomes in tumors and/or oral swabs from 9 Ugandan adults with HIV-associated KS were characterized. Furthermore, we used deep, short-read sequencing using duplex unique molecular identifiers (dUMI)-random double-stranded oligonucleotides that barcode individual DNA molecules before library amplification. This allowed suppression of PCR and sequencing errors to ~10-9/base as well as afforded accurate determination of KSHV genome numbers sequenced in each sample. KSHV genomes were assembled de novo, and rearrangements observed were confirmed by PCR and Sanger sequencing. 131-kb KSHV genome sequences, excluding major repeat regions, were successfully obtained from 23 clinical specimens, averaging 2.3x104 reads/base. Strikingly, KSHV genomes were virtually identical within individuals at the point mutational level. The intra-host heterogeneity that was observed was confined to tumor-associated KSHV mutations and genome rearrangements, all impacting protein-coding sequences. Although it is unclear whether these changes were important to tumorigenesis or occurred as a result of genomic instability in tumors, similar changes were observed across individuals. These included inactivation of the K8.1 gene in tumors of 3 individuals and retention of a region around the first major internal repeat (IR1) in all instances of genomic deletions and rearrangements. Notably, the same breakpoint junctions were found in distinct tumors within single individuals, suggesting metastatic spread of rearranged KSHV genomes. These findings define KSHV intra-host heterogeneity in vivo with greater precision than has been possible in the past and suggest the possibility that aberrant KSHV genomes may contribute to aspects of KS tumorigenesis. Furthermore, study of KSHV with use of dUMI provides a proof of concept for utilizing this technique for detailed study of other virus populations in vivo.
Assuntos
DNA Viral/análise , Genoma Viral , Herpesvirus Humano 8/genética , Especificidade de Hospedeiro , Sarcoma de Kaposi/virologia , Adulto , Estudos de Coortes , DNA Viral/genética , Feminino , Genômica , Herpesvirus Humano 8/classificação , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Pessoa de Meia-Idade , Polimorfismo Genético , Sarcoma de Kaposi/epidemiologia , Uganda/epidemiologiaRESUMO
Human herpesvirus 8 (HHV-8) is the etiological agent of all forms of Kaposi's sarcoma (KS). K1 gene studies have identified five major molecular genotypes with geographical clustering. This study described the epidemiology of HHV-8 and its molecular diversity in Gabon among Bantu and Pygmy adult rural populations and KS patients. Plasma antibodies against latency-associated nuclear antigens (LANA) were searched by indirect immunofluorescence. Buffy coat DNA samples were subjected to polymerase chain reaction (PCR) to obtain a K1 gene fragment. We studied 1020 persons; 91% were Bantus and 9% Pygmies. HHV-8 seroprevalence was 48.3% and 36.5% at the 1:40 and 1:160 dilution thresholds, respectively, although the seroprevalence of HHV-8 is probably higher in Gabon. These seroprevalences did not differ by sex, age, ethnicity or province. The detection rate of HHV-8 K1 sequence was 2.6% by PCR. Most of the 31 HHV-8 strains belonged to the B genotype (24), while the remaining clustered within the A5 subgroup (6) and one belonged to the F genotype. Additionally, we reviewed the K1 molecular diversity of published HHV-8 strains in Africa. This study demonstrated a high seroprevalence of HHV-8 in rural adult populations in Gabon and the presence of genetically diverse strains with B, A and also F genotypes.
Assuntos
Herpesvirus Humano 8/genética , Sarcoma de Kaposi/epidemiologia , Sarcoma de Kaposi/virologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Anticorpos Antivirais/sangue , Antígenos Virais/imunologia , DNA Viral/genética , Feminino , Gabão/epidemiologia , Variação Genética , Genótipo , Herpesvirus Humano 8/classificação , Herpesvirus Humano 8/imunologia , Herpesvirus Humano 8/isolamento & purificação , Humanos , Masculino , Pessoa de Meia-Idade , Proteínas Nucleares/imunologia , Filogenia , População Rural , Estudos Soroepidemiológicos , Proteínas Virais/genética , Adulto JovemAssuntos
Linfoma Folicular/diagnóstico , Linfoma de Efusão Primária/diagnóstico , Idoso de 80 Anos ou mais , Feminino , Infecções por HIV/complicações , Infecções por Herpesviridae/complicações , Herpesvirus Humano 8/isolamento & purificação , Humanos , Linfoma Folicular/virologia , Linfoma de Efusão Primária/virologiaRESUMO
AIMS: This study assesses the diversity and abundance of Human Herpesviruses (HHVs) in the influent of an urban wastewater treatment plant using shotgun sequencing, metagenomic analysis and qPCR. METHODS AND RESULTS: Influent wastewater samples were collected from the three interceptors that serve the City of Detroit and Wayne, Macomb and Oakland counties between November 2017 to February 2018. The samples were subjected to a series of processes to concentrate viruses which were further sequenced and amplified using qPCR. All nine types of HHV were detected in wastewater. Human Herpesvirus 8 (HHV-8), known as Kaposi's sarcoma herpesvirus, which is only prevalent in 5-10% of USA population, was found to be the most abundant followed by HHV-3 or Varicella-zoster virus. CONCLUSIONS: The high abundance of HHV-8 in the Detroit metropolitan area may be attributed to the HIV-AIDS outbreak that was ongoing in Detroit during the sampling period. SIGNIFICANCE AND IMPACT OF THE STUDY: The approach described in this paper can be used to establish a baseline of viruses secreted by the community as a whole. Sudden changes in the baseline would identify changes in community health and immunity.