Automation and standardisation of a quantitative multiplex PCR assay using PCR.Ai.

BACKGROUND: We previously undertook a prospective clinical study to evaluate PCR.Ai's (www.pcr.ai) accuracy and impact when automating the manual data-analysis and quality control steps associated with routine clinical pathogen testing using a non-quantitative multiplex quantitative real-time PCR (qPCR). In this study we demonstrated 100 % concurrence between our manual routine analysis method and PCR.Ai. This paper expands the evaluation of PCR.Ai's (www.pcr.ai) accuracy and impact using a multiplex quantitative real-time PCR (qPCR). OBJECTIVES: We evaluated the impact of PCR.Ai when used as the final interpretation/verification step for routine in-house multiplex quantitative qPCR tests for CMV, EBV and adenovirus from blood samples for a total of 1350 interpretations. STUDY DESIGN: We compared PCR.Ai to our existing manual interpretation, to determine accuracy and hands on time savings. RESULTS AND CONCLUSIONS: There was 100 % concurrence between validated CMV, EBV and adenovirus detection and quantitation by our manual routine analysis method and PCR.Ai. Furthermore, there were significant routine savings with PCR.Ai of 63 minutes/ run. Our conclusion is that for quantitative tests PCR.Ai is a highly accurate time-saving tool that reduces complexity of qPCR analysis and hence the need for specialists and hands-on time. It demonstrated capabilities to enable us to get results out more quickly with lower costs and less risk of errors.

DEVELOPMENT OF A TRIPLEX REAL-TIME PCR ASSAY TO DETECT ECHINOCOCCUS SPECIES IN CANID FECAL SAMPLES.

Echinococcosis is a zoonotic disease with great significance to public health, and appropriate detection and control strategies should be adopted to mitigate its impact. Most cases of echinococcosis are believed to be transmitted by the consumption of food and/or water contaminated with canid stool containing Echinococcus spp. eggs. Studies assessing Echinococcus multilocularis, Echinococcus granulosus sensu stricto, and Echinococcus shiquicus coinfection from contaminated water-derived, soil-derived, and food-borne samples are scarce, which may be due to the lack of optimized laboratory detection methods. The present study aimed to develop and evaluate a novel triplex TaqMan-minor groove binder probe for real-time polymerase chain reaction (rtPCR) to simultaneously detect the 3 Echinococcus spp. mentioned above from canid fecal samples in the Qinghai-Tibetan Plateau area (QTPA). The efficiency and linearity of each signal channel in the triplex rtPCR assay were within acceptable limits for the range of concentrations tested. Furthermore, the method was shown to have good repeatability (standard deviation ≤0.32 cycle threshold), and the limit of detection was estimated to be 10 copies plasmid/µl reaction. In summary, the evaluation of the present method shows that the newly developed triplex rtPCR assay is a highly specific, precise, consistent, and stable method that could be used in epidemiological investigations of echinococcosis.

Diagnostic accuracy of multiplex polymerase chain reaction on tissue biopsies in periprosthetic joint infections.

The diagnosis and treatment of periprosthetic joint infection (PJI) currently relies on cultures, which are time-consuming and often fail. Multiplex PCR assays promise reliable and prompt results, but have been heterogeneously evaluated. In this study, we analyse multiplex PCR in pathogen identification using only tissue biopsies. 42 patients after revision arthroplasty of the hip or knee were evaluated using multiplex PCR to identify microorganisms. The patients were classified according to the diagnostic criteria published by Zimmerli et al. and the results were compared to the respective microbiological cultures. PJI was detected in 15 patients and 27 revisions were aseptic. The multiplex PCR of tissue biopsies had a sensitivity of 0.3 (95% CI 0.12-0.62), a specificity of 1.0 (0.87-1.0), a positive predictive value of 1.0 (0.48-1.0) and a negative predictive value of 0.73 (0.56-0.86). The diagnostic accuracy of multiplex PCR on tissue biopsy samples is low in comparison to routine microbiological cultures. The evaluation of tissue biopsies using multiplex PCR was prone to false negative results. However, multiplex PCR assays have the advantage of rapid pathogen identification. We therefore recommend further investigation of multiplex PCR in the setting of suspected PJI with a careful choice of specimens.

Highly sensitive duplex MSI test and BAT40 germline polymorphism.

Tumors exhibiting DNA mismatch repair (MMR) deficiency and microsatellite instability (MSI) are responsive to immune checkpoint blockade. MSI is frequently diagnosed using five quasimonomorphic mononucleotide (pentaplex) markers; however, the assays have several technical limitations, including the lack of sensitivity of some of the markers. Although markers with increased sensitivity, such as CAT25 and BAT40, have been introduced, the majority of multiplex MSI tests have only been studied in Western populations and require further evaluation in an Asian cohort. This study tested the efficacy of BAT26, CAT25, and BAT40 mononucleotide MSI markers via triplex PCR on 300 samples from patients with advanced cancers from a Korean clinical population. The results were directly compared with those of a pentaplex MSI test and tumor mutation burden (TMB) status, and an additional 60 MSI-H cancers were used for further validation. Four (1.3%) out of 300 advanced tumors were MSI-high (MSI-H). In the pentaplex PCR assay, two colorectal cancers (0.7%) exhibited instability only with the BAT25 mononucleotide marker and were interpreted as MSI-low (MSI-L). In the triplex PCR assay, BAT40 was unstable in 64 cases (21%) and the results did not overlap with those of MSI-L from pentaplex. Given the high frequency of isolated BAT40 instability, we performed the same triplex PCR with DNA obtained from normal controls and found BAT40 polymorphisms in 37 cases (90%). Interestingly, the median TMB of the cases with BAT40 polymorphism was significantly higher (7.0 mt/Mb) than that of BAT40 wild-type cases (5.5 mt/Mb) (p = 0.003). The triplex PCR results from 60 additional MSI-H cancers correlated perfectly (100%) with those of pentaplex PCR, and the results were consistent for two (BAT26 and CAT25) markers. BAT40 germline polymorphism is common in the Korean population and is associated with higher TMB values. The simple duplex (BAT26 and CAT25) MSI test provided the same sensitivity and specificity as pentaplex PCR tests.

Research Note: Simultaneous detection of infectious laryngotracheitis virus, fowlpox virus, and reticuloendotheliosis virus in chicken specimens.

Infectious laryngotracheitis (ILT), fowlpox (FP), and reticuloendotheliosis are important poultry diseases caused by gallid herpesvirus 1 (ILTV), fowlpox virus (FWPV), and reticuloendotheliosis virus (REV), respectively. Coinfections with ILTV and FWPV occur naturally in chickens, and FP in its more virulent wet form is characterized by diphtheritic lesions and easily confused with ILT. Moreover, the insertion of only partial REV-LTR or a nearly full-length REV into the FWPV genome, located between the ORF 201 and ORF 203, has increased recently in wild-type field FWPV isolates. Therefore, it is critical to detect ILTV, FWPV, REV-integrated FWPV, and REV early and accurately. In this study, we successfully developed a multiplex PCR assay for the simultaneous detection of ILTV, FWPV, REV-integrated FWPV, and REV, and the detection limits was 1 × 54 copies/tube. When used to test clinical samples, the results of the multiplex PCR were in 100% agreement with singleplex PCRs and sequencing. This new multiplex PCR is a simple, rapid, sensitive, specific, and cost-effective method for detection of 4 viruses in clinical specimens.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Assessment of the direct quantitation of SARS-CoV-2 by droplet digital PCR.

Droplet digital PCR (ddPCR) is a sensitive and reproducible technology widely used for quantitation of several viruses. The aim of this study was to evaluate the 2019-nCoV CDC ddPCR Triplex Probe Assay (BioRad) performance, comparing the direct quantitation of SARS-CoV-2 on nasopharyngeal swab with the procedure applied to the extracted RNA. Moreover, two widely used swab types were compared (UTM 3 mL and ESwab 1 mL, COPAN). A total of 50 nasopharyngeal swabs (n = 25 UTM 3 mL and n = 25 ESwab 1 mL) from SARS-CoV-2 patients, collected during the pandemic at IRCCS Sacro Cuore Don Calabria Hospital (Veneto Region, North-East Italy), were used for our purpose. After heat inactivation, an aliquot of swab medium was used for the direct quantitation. Then, we compared the direct method with the quantitation performed on the RNA purified from nasopharyngeal swab by automated extraction. We observed that the direct approach achieved generally equal RNA copies compared to the extracted RNA. The results with the direct quantitation were more accurate on ESwab with a sensitivity of 93.33% [95% CI, 68.05 to 99.83] and specificity of 100.00% for both N1 and N2. On the other hand, on UTM we observed a higher rate of discordant results for N1 and N2. The human internal amplification control (RPP30) showed 100% of both sensitivity and specificity independent of swabs and approaches. In conclusion, we described a direct quantitation of SARS-CoV-2 in nasopharyngeal swab. Our approach resulted in an efficient quantitation, without automated RNA extraction and purification. However, special care needs to be taken on the potential bias due to the conservation of samples and to the heating treatment, as we used thawed and heat inactivated material. Further studies on a larger cohort of samples are warranted to evaluate the clinical value of this direct approach.

Developing an Unbiased Multiplex PCR System to Enrich the TRB Repertoire Toward Accurate Detection in Leukemia.

Accurate T cell receptor repertoire profiling has provided novel biological and clinical insights in widespread immunological settings; however, there is a lack of reference materials in the community that can be used to calibrate and optimize the various experimental systems in different laboratories. In this study, we designed and synthesized 611 T cell receptor (TCR) beta chain (TRB) templates and used them as reference materials to optimize the multiplex PCR experimental system to enrich the TRB repertoire. We assessed the stability of the optimized system by repeating the experiments in different batches and by remixing the TRB templates in different ratios. These TRB reference materials could be used as independent positive controls to assess the accuracy of the experimental system, and they can also be used as spike-in materials to calibrate the residual biases of the experimental system. We then used the optimized system to detect the minimal residual disease of T cell acute lymphoblastic leukemia and showed a higher sensitivity compared with flow cytometry. We also interrogated how chemotherapy affected the TCR repertoire of patients with B-cell acute lymphoblastic leukemia. Our result shows that high-avidity T cells, such as those targeting known pathogens, are largely selected during chemotherapy, despite the global immunosuppression. These T cells were stimulated and emerged at the time of induction treatment and further expanded during consolidation treatment, possibly to fight against infections. These data demonstrate that accurate immune repertoire information can improve our understanding of the adaptive immunity in leukemia and lead to better treatment management of the patients.

A novel ultra-sensitive method for the detection of FGFR3 mutations in urine of bladder cancer patients - Design of the Urodiag® PCR kit for surveillance of patients with non-muscle-invasive bladder cancer (NMIBC).

BACKGROUND: We have recently developed a highly accurate urine-based test, named Urodiag®, associating FGFR3 mutation and DNA methylation assays for recurrence surveillance in patients with low-, intermediate-, and high-risk NMIBC. Previously, the detection of four FGFR3 mutations (G372C, R248C, S249C and Y375C) required amplification steps and PCR products were analyzed by capillary electrophoresis (Allele Specific-PCR, AS-PCR), which was expensive and time-consuming. Here, we present the development a novel ultra-sensitive multiplex PCR assay as called "Mutated Allele Specific Oligonucleotide-PCR (MASO-PCR)", generating a cost-effective, simple, fast and clinically applicable assay for the detection of FGFR3 mutations in voided urine. METHODS: Comparative clinical performances of MASO-PCR and AS-PCR technologies were performed from 263 urine DNA samples (87 FGFR3 mutated and 176 FGFR3 wild-type). In the development of Urodiag® PCR Kit, we studied the stability and reproducibility of each all-in-one PCR master mix (single reaction mixture including all the necessary PCR components) for MASO-PCR and QM-MSPCR (Quantitative Multiplex Methylation-Specific PCR to co-amplify SEPTIN9, HS3ST2 and SLIT2 methylated genes) assays. RESULTS: Complete concordance (100%) was observed between the MASO-PCR and AS-PCR results. Each PCR master mix displayed excellent reproducibility and stability after 12 months of storage at - 20 °C, with intra-assay standard deviations lower than 0.3 Ct and coefficient of variations (CV) lower than 1%. The limit of detection (LoD) of MASO-PCR was 5% mutant detection in a 95% of wild-type background. The limit of quantification (LoQ) of QM-MSPCR was 10 pg of bisulfite-converted DNA. CONCLUSIONS: We developed and clinically validated the MASO-PCR assay, generating cost-effective, simple, fast and clinically applicable assay for the detection of FGFR3 mutations in urine. We also designed the Urodiag® PCR Kit, which includes the MASO-PCR and QM-MSPCR assays. Adapted to routine clinical laboratory (simplicity, accuracy), the kit will be a great help to urologists for recurrence surveillance in patients at low-, intermediate- and high-risk NMIBC. Reducing the number of unnecessary cystoscopies, it will have extremely beneficial effects for patients (painless) and for the healthcare systems (low cost).

Failure of multiplex meningitis/encephalitis (ME) NAT during cryptococcal meningitis in solid organ recipients.

Cryptococcal meningitis is a severe cause of central nervous system infections among immunocompromised solid organ transplant (SOT) patients. While new diagnostic methods as multiplex meningitis/encephalitis (ME) NAT (nucleic acid test) are increasingly used as a first-line tool in hospital practice, data in HIV-negative patients including SOT remain scarce. We report here false-negative results of multiplex NAT among SOT patients with proven cryptococcal meningitis.

A multiplex RT-PCR assay for the simultaneous detection of prevalent viruses infecting pepper (Capsicum annuum L.).

The aim of this work was to create an easy, fast and sensitive method for the simultaneous detection of the most frequent viruses known to infect pepper (Capsicum annuum L.) crops. A multiplex RT-PCR assay was developed that successfully achieved this aim. Using specifically designed primer pairs, the assay could simultaneously amplify the genomes of members of the two subgroups (I and II) of cucumber mosaic virus (CMV), two tobamoviruses, tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV), potato virus Y (PVY), and tomato spotted wilt virus (TSWV) in a single assay. The multiplex RT-PCR assay was found to be a sensitive diagnostic tool for the detection of the viruses from the leaves and fruits of naturally infected pepper plants. This assay would provide prompt disease status information for pepper breeders.

An Isothermal, Multiplex Amplification Assay for Detection and Genotyping of Human Papillomaviruses in Formalin-Fixed, Paraffin-Embedded Tissues.

Rapid and accurate identification of human papillomavirus (HPV) is important for both clinical management and population screening. Analytic validation of Atila AmpFire Multiplex HPV assays on formalin-fixed, paraffin-embedded (FFPE) cervix/vulva and oropharynx diagnostic tissue samples was performed. The AmpFire assay incorporates a novel isothermal multiplex amplification coupled with real-time fluorescent detection to detect and genotype 15 high-risk (HR) HPV genotypes. Limits of detection determined by plasmids cloned with HPV genotype-specific sequences were 2 copies/reaction for HPV16, HPV18, and some HR HPV genotypes, and 20 copies/reaction for the remaining HR HPV genotypes. The performance of the AmpFire assays in clinical samples was evaluated using 214 FFPE specimens. The AmpFire assay failed in one clinical specimen for an invalid rate of 0.5%. The AmpFire assay detected HPV in clinical samples with positive percent agreements of 100.0% for HPV16, 100.0% for HPV18, and 94.7% for non-16/18 HR HPV, and 100% negative percent agreements for HPV16, HPV18, and non-16/18 HR HPV. Qualitative detection agreement was obtained in the reproducibility study. In summary, the Atila AmpFire HPV assay demonstrated excellent analytic sensitivity and specificity for detection and genotyping of 15 HR HPV genotypes. Assay parameters of simple specimen processing, small sample size requirement, rapid turnaround time, and being near instrument-free render it well suited for HPV detection and genotyping in FFPE specimens.

Multiplex PCR-based titration (MPBT) assay for determination of infectious titers of the three Sabin strains of live poliovirus vaccine.

BACKGROUND: Conventional assays to titrate polioviruses usually test serial dilutions inoculated into replicate cell cultures to determine a 50% cytopathic endpoint, a process that is both time-consuming and laborious. Such a method is still used to measure potency of live Oral Poliovirus Vaccine during vaccine development and production and in some clinical trials. However, the conventional method is not suited to identify and titrate virus in the large numbers of fecal samples generated during clinical trials. Determining titers of each of the three Sabin strains co-existing in Oral Poliovirus Vaccine presents an additional challenge. RESULTS: A new assay using quantitative multiplex polymerase chain reaction as an endpoint instead of cytopathic effect was developed to overcome these limitations. In the multiplex polymerase chain reaction-based titration assay, cell cultures were infected with serial dilutions of test samples, lysed after two-day incubation, and subjected to a quantitative multiplex one-step reverse-transcriptase polymerase chain reaction. All three serotypes of poliovirus were identified in single samples and titers calculated. The multiplex polymerase chain reaction-based titration assay was reproducible, robust and sensitive. Its lower limits of titration for three Sabin strains were 1-5 cell culture 50% infectious doses per ml. We prepared different combinations of three Sabin strains and compared titers obtained with conventional and multiplex polymerase chain reaction-based titration assays. Results of the two assays correlated well and showed similar results and sensitivity. Multiplex polymerase chain reaction-based titration assay was completed in two to 3 days instead of 10 days for the conventional assay. CONCLUSIONS: The multiplex polymerase chain reaction-based titration (MPBT) is the first quantitative assay that identifies and titrates each of several different infectious viruses simultaneously in a mixture. It is suitable to identify and titrate polioviruses rapidly during the vaccine manufacturing process as a quality control test, in large clinical trials of vaccines, and for environmental surveillance of polioviruses. The MPBT assay can be automated for high-throughput implementation and applied for other viruses including those with no cytopathic effect.

A Retrospective Study about the Impact of Switching from Nested PCR to Multiplex Real-Time PCR on the Distribution of the Human Papillomavirus (HPV) Genotypes.

BACKGROUND AND OBJECTIVES: Human papillomavirus (HPV) is the most prevalent etiological agent of viral sexually-transmitted infection. This study retrospectively evaluated the impact of a switch to a real-time PCR assay in the HPV prevalence and genotypes distribution by a quasi-experimental before-and-after approach. MATERIALS AND METHODS: In total, 1742 samples collected from 1433 patients were analyzed at the UOC Microbiology and Virology of Policlinico of Bari, Italy. HPV DNA detection was performed using initially nested PCR and subsequently multiplex real-time PCR assay. RESULTS: Statistically significant difference in HPV overall prevalence after the introduction of the real-time assay was not detected (48.97% vs. 50.62%). According to different extraction-DNA amplification methods, differences were observed in the prevalence rates of HPV-45, 68, 40, 42, and 43. The lowest prevalence for HPV-45 was observed in the Magna Pure-Real Time PCR group, while HPV-68, 40, 42, and 43 were less observed in the Qiagen-Real Time PCR group. After, a multivariate logistic regression, an increase in the prevalence of HPV-42 (aOR: 4.08, 95% CI: 1.71-9.73) was associated with the multiplex real-time PCR assay. CONCLUSIONS: Although this study is a not a direct comparison between two diagnostic methods because it has a sequential structure, it serves to verify the impact of a new molecular assay on HPV distribution. Moreover, the stability of HPV prevalence over time suggests that the population composition and the behavioral variables did not likely change during the observation period. Our study proposes that the introduction of a molecular test for HPV detection may be related to changes of HPV genotypes distribution.

Novel multiplex droplet digital PCR assay for scoring PD-L1 in non-small cell lung cancer biopsy specimens.

OBJECTIVES: Immune checkpoint inhibitors have become integrated into the clinical management of non-small cell lung cancer (NSCLC). Using RTqPCR, we have previously identified a gene expression panel that detected presence of malignant cells (MMP9:TIMP3 ratio) and quantified PD-L1 transcript levels in small biopsy specimens. However, RTqPCR has diagnostic limitations as it does not generate absolute copy number and is not readily multiplexed. To address this, we have developed a multiplex droplet digital PCR (ddPCR) assay. MATERIALS AND METHODS: Biopsies obtained from NSCLC patients (n = 48 adenocarcinoma and n = 40 squamous cell carcinoma) and control lung biopsy specimens (n = 20) were analysed. Absolute MMP9, TIMP3 and PD-L1 transcript copy numbers were determined within a single assay by multiplex ddPCR using Taqman primers and the QX200 Droplet Digital PCR System. RESULTS AND CONCLUSIONS: Using our optimised triplex ddPCR assay, the MMP9:TIMP3 ratio was significantly elevated in NSCLC biopsies and using a cut-off of >0.028, was 99% (95% CI; 80.5-94.5) sensitive and 80% specific for identifying malignant biopsies. The PD-L1:TIMP3 ratio significantly associated with PD-L1 tumour cell immunohistochemistry staining (r = 0.539, p < 0.0001) and was significantly higher in biopsies with >50% PD-L1 tumour cell staining (p < 0.0001). In summary, a major advantage of our workflow is that it can accurately quantify PD-L1 tumour levels and provide sufficient nucleic acid for screening additional targetable mutations such as EGFR, ALK and ROS1 from a single small biopsy, thereby potentially avoiding the need for re-biopsy. Future studies will need to determine diagnostic ddPCR values that are predictive of clinical response to PD-1/PD-L1 immunotherapy.

Multiplex Real-Time PCR-shortTUB Assay for Detection of the Mycobacterium tuberculosis Complex in Smear-Negative Clinical Samples with Low Mycobacterial Loads.

Tuberculosis (TB) remains a major health problem worldwide. Control of TB requires rapid, accurate diagnosis of active disease. However, extrapulmonary TB is very difficult to diagnose because the clinical specimens have very low bacterial loads. Several molecular methods involving direct detection of the Mycobacterium tuberculosis complex (MTBC) have emerged in recent years. Real-time PCR amplification simultaneously combines the amplification and detection of candidate sequences by using fluorescent probes (mainly TaqMan or Molecular Beacons) in automated systems. The multiplex real-time PCR-short assay is performed using locked nucleic acid (LNA) probes (length, 8 to 9 nucleotides) in combination with CodUNG to detect multiple pathogens in clinical samples. In this study, we evaluated the performance of this novel multiplex assay for detecting the MTBC in comparison with that of the conventional culture-based method. The multiplex real-time PCR-shortTUB assay targets two genes, whiB3 (redox-responsive transcriptional regulator) and pstS1 (phosphate-specific transporter), yielding limits of detection (LOD) of 10 copies and 100 copies, respectively, and amplification efficiencies of 92% and 99.7%, respectively. A total of 94 extrapulmonary samples and pulmonary samples with low mycobacterial loads (all smear negative; 75 MTBC culture positive) were analyzed using the test, yielding an overall sensitivity of 88% and a specificity of 95%. For pleural fluid and tissues/biopsy specimens, the sensitivity was 83% and 85%, respectively. In summary, this technique could be implemented in routine clinical microbiology testing to reduce the overall turnaround time for MTBC detection and may therefore be a useful tool for the diagnosis of extrapulmonary tuberculosis and diagnosis using pulmonary samples with low mycobacterial loads.

Application of a nucleic acid-based multiplex kit to identify viral and atypical bacterial aetiology of lower respiratory tract infection in hospitalized children.

INTRODUCTION: Lower respiratory tract infections (LRTIs), particularly those acquired in hospitals, are an important cause of childhood morbidity and mortality. Understanding the aetiology and epidemiology of LRTIs is necessary for clinical management, reduction of antibiotic usage, vaccine development and prevention of nosocomial infection. AIM: In this study, we aimed to detect 13 viruses and atypical bacteria in nasopharyngeal secretion specimens from hospitalized children with LRTIs. METHODOLOGY: From January 2014 to December 2016, nasopharyngeal secretion specimens were prospectively collected from 3232 children aged between 1 and 72 months. Nucleic acid was extracted and analysed using the SureX13 respiratory pathogen multiplex kit as per the manufacturer's instructions. RESULTS: A total of 2874 (88.9 %) children tested positive for viral and/or atypical bacterial infections, and 965 (29.9 %) were co-infected with multiple pathogens. The most frequently detected respiratory tract pathogens (RTPs) were rhinovirus, respiratory syncytial virus, parainfluenza virus and adenoviruses. The rates of RTP and co-infection positivity in the toddler group were significantly higher than those in the infant and preschool groups. CONCLUSION: The SureX13 respiratory pathogen multiplex kit has the ability to effectively detect a range of RTPs in hospitalized paediatric patients with LRTIs.

Analytical Validation of a Highly Sensitive, Multiplexed Chronic Myeloid Leukemia Monitoring System Targeting BCR-ABL1 RNA.

This study describes the analytical performance of the QuantideX qPCR BCR-ABL IS Kit, the first Food and Drug Administration-cleared assay designed to monitor breakpoint cluster region-Abelson tyrosine-protein kinase 1 (BCR-ABL1) fusion transcripts isolated from peripheral blood specimens from patients with chronic myeloid leukemia. This multiplex real-time quantitative RT-PCR assay amplifies both e13a2 and e14a2 Major BCR-ABL1 transcripts and the reference target ABL1. The test results are provided in international scale (IS) values by incorporating armored RNA-based calibrators that have defined IS values tied directly to the World Health Organization BCR-ABL1 Primary Reference Materials, without the necessity of determining and maintaining conversion factors. For each batch run, the integrated interpretive software evaluates run and specimen quality control metrics (including a sufficient amount of ABL1 control transcripts to ensure a minimal limit of detection) and calculates both molecular response (MR) and %IS values for each specimen. The test has a limit of detection of MR4.7 (0.002%IS) and a linear range from MR0.3 (50%IS) to MR4.7 (0.002%IS) for both Major transcripts. Single-site and multisite precision studies demonstrated a maximum SD of 0.13 MR (30% CV within the assay range between MR0.7 and MR3.7). The performance of this BCR-ABL1 monitoring test meets all of the clinical guideline recommendations for sensitivity and IS reporting for the management of chronic myeloid leukemia patients.

Reproducibility of positive results for rare pathogens on the FilmArray GI Panel.

Though the FilmArray GI Panel has a reported aggregate specificity and reproducibility of >97% and > 99%, respectively, the reproducibility is less understood in clinical practice. We measured the reproducibility of positive results for low-prevalence pathogens. Samples with positive results for selected targets were repeated using a different FilmArray module. Overall, 331 of 373 (89%) results were reproducible. Giardia lamblia (57/57, 100%), Cryptosporidium spp. (61/63, 97%), Cyclospora cayetanensis (34/35, 97%), Plesiomonas shigelloides (17/18, 94%), and Rotavirus A (76/77, 99%) were highly reproducible, while Adenovirus F40/41 (38/54, 70%), Vibrio spp. (8/10, 80%), V. cholerae (3/8, 37.5%), and Yersinia enterocolitica (36/50, 72%) were poorly reproducible. Review of 38 patients with nonreproducible results showed that 19 (50%) had evidence of gastroenteritis and only 6 (16%) had possible infection with the organism that showed a nonreproducible result. Higher false-positive rates with certain targets on FAGP emphasize the need for diagnostic stewardship.

Multiplex STR panel for assessment of chimerism following hematopoietic stem cell transplantation (HSCT).

Short tandem repeat (STR) analysis is used in chimerism monitoring after allogeneic hematopoietic stem cell transplantation (HSCT) for patients with various hematologic malignancies. Commercial forensic STR kits often contain loci with huge differences in power of discrimination (PD) across populations, causing some loci to be less informative for chimerism analysis in certain populations. This study aimed to construct a new STR multiplex panel with highly informative loci for efficient chimerism analysis. Thirteen STR markers which exhibit high PD (> 0.9) in at least 80% of 50 populations globally were selected to form a new panel and used in STR analysis of 253 Malaysian subjects. Cumulative power of discrimination (CPD) and combined power of exclusion (CPE) were determined from 253 Malaysian individuals. Loci informativity was assessed and compared to the commercial AmpFLSTR Identifiler PCR Amplification kit in 14 donor-recipient pairs. The new panel had detected 202 unique alleles including five novel alleles from the 253 individuals with high CPD and CPE (> 0.99999999999999999 and > 0.999999997 respectively). All loci from the new panel in the donor-recipient pair analysis showed higher than 50% informativity, while five loci from the commercial kit demonstrated lower than 50% informativity. Four loci from the new panel ranked the highest informativity. A sequenced allelic ladder which consists of 202 unique alleles from the 253 subjects was also developed to ensure accurate allele designation. The new 13-loci STR panel, thus, could serve as an additional powerful, accurate, and highly informative panel for chimerism analysis for HSCT patients.