Adipocyte-Specific Hnrnpa1 Knockout Aggravates Obesity-Induced Metabolic Dysfunction via Upregulation of CCL2.

Heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) is involved in lipid and glucose metabolism via mRNA processing. However, whether and how HNRNPA1 alters adipocyte function in obesity remain obscure. Here, we found that the obese state downregulated HNRNPA1 expression in white adipose tissue (WAT). The depletion of adipocyte HNRNPA1 promoted markedly increased macrophage infiltration and expression of proinflammatory and fibrosis genes in WAT of obese mice, eventually leading to exacerbated insulin sensitivity, glucose tolerance, and hepatic steatosis. Mechanistically, HNRNPA1 interacted with Ccl2 and regulated its mRNA stability. Intraperitoneal injection of CCL2-CCR2 signaling antagonist improved adipose tissue inflammation and systemic glucose homeostasis. Furthermore, HNRNPA1 expression in human WAT was negatively correlated with BMI, fat percentage, and subcutaneous fat area. Among individuals with 1-year metabolic surgery follow-up, HNRNPA1 expression was positively related to percentage of total weight loss. These findings identify adipocyte HNRNPA1 as a link between adipose tissue inflammation and systemic metabolic homeostasis, which might be a promising therapeutic target for obesity-related disorders.

The microRNA-195-5p/hnRNP A1 axis contributes to the progression of hepatocellular carcinoma by regulating the migration of cancer cells.

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

m6A-modification of cyclin D1 and c-myc IRESs in glioblastoma controls ITAF activity and resistance to mTOR inhibition.

A major mechanism conferring resistance to mTOR inhibitors is activation of a salvage pathway stimulating internal ribosome entry site (IRES)-mediated mRNA translation, driving the synthesis of proteins promoting resistance of glioblastoma (GBM). Previously, we found this pathway is stimulated by the requisite IRES-trans-acting factor (ITAF) hnRNP A1, which itself is subject to phosphorylation and methylation events regulating cyclin D1 and c-myc IRES activity. Here we describe the requirement for m6A-modification of IRES RNAs for efficient translation and resistance to mTOR inhibition. DRACH-motifs within these IRES RNAs upon m6A modification resulted in enhanced IRES activity via increased hnRNP A1-binding following mTOR inhibitor exposure. Inhibitor exposure stimulated the expression of m6A-methylosome components resulting in increased activity in GBM. Silencing of METTL3-14 complexes reduced IRES activity upon inhibitor exposure and sensitized resistant GBM lines. YTHDF3 associates with m6A-modified cyclin D1 or c-myc IRESs, regulating IRES activity, and mTOR inhibitor sensitivity in vitro and in xenograft experiments. YTHDF3 interacted directly with hnRNP A1 and together stimulated hnRNP A1-dependent nucleic acid strand annealing activity. These data demonstrate that m6A-methylation of IRES RNAs regulate GBM responses to this class of inhibitors.

Serum/glucose starvation strikingly reduces heterogeneous nuclear ribonucleoprotein A1 protein and its target, cyclin D1.

Our investigation to explore cellular alterations related to undernutrition in cancer cells revealed that the protein level of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1) is drastically decreased by serum/glucose starvation. Its loss was reversible, serum/glucose starvation-specific and universal throughout cell types and species. The hnRNP A1 mRNA level and hnRNP A1 mRNA/protein stability were not altered under this condition. CCND1 mRNA, which we newly identified as the binding target of hnRNP A1, was decreased by serum/glucose starvation. Under similar conditions, CCND1 protein was reduced in vitro and in vivo, whereas hnRNP A1 mRNA level and CCND1 mRNA level revealed no correlation in most clinical samples. Functional analyses revealed that CCND1 mRNA stability is certainly dependent on hnRNP A1 protein level and that RNA recognition motif-1 (RRM1) in hnRNP A1 plays a central role in maintaining CCND1 mRNA stability and subsequent protein expression. The injection of RRM1-deleted hnRNP A1-expressing cancer cells in the mouse xenograft model did not form any tumours, and that of hnRNP A1-expressing cancer cells retained CCND1 expression at the lesion adjacent to necrosis with a slight increase in tumour volume. Furthermore, RRM1 deletion caused growth suppression with the induction of apoptosis and autophagy, whereas CCND1 restoration completely recovered it. Our results indicate that serum/glucose starvation triggers entire hnRNP A1 protein loss, and its loss may play a role in CCND1 mRNA destabilization and CCND1-mediated cellular event inhibition, i.e. growth promotion, apoptosis induction and autophagosome formation.

ß-Hydroxybutyrate alleviates cartilage senescence through hnRNP A1-mediated up-regulation of PTEN.

Senescence chondrocytes play an important role in Osteoarthritis (OA) progression. However, alleviating OA progression through senescent chondrocyte intervention still faces great challenges. ß-Hydroxybutyrate (BHB) exhibits anti-senescence effects in a variety of age-related dis-eases, but its role in osteoarthritis remains poorly understood. To explore the molecular mechanisms, gene sequencing was used to identify critical genes and potential cellular signaling pathways and male SD rats were used to generate an osteoarthritis model. Results showed that BHB attenuated the senescence of Osteoarthritis chondrocytes (OA-Chos) and alleviated OA progression. Gene ontology (GO) enrichment analysis revealed significant changes in cell cycle genes, with PTEN being the most significant differentially expressed gene. BHB up-regulated the expression of PTEN in OA-Chos, thereby alleviating chondrocyte senescence. Furthermore, BHB facilitated the expression of PTEN by binding to hnRNP A1 and inhibiting the phosphorylation of Akt. This study provided evidence that BHB mitigated chondrocyte senescence and delayed OA, and could thus be used as a novel therapeutic approach for osteoarthritis treatment.

A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.

Overexpression of c-Myc-dependent heterogeneous nuclear ribonucleoprotein A1 promotes proliferation and inhibits apoptosis in NOTCH1-mutated chronic lymphocytic leukemia cells.

BACKGROUND: NOTCH1 mutation is an essential molecular biologic aberration in chronic lymphocytic leukemia (CLL). CLL patients with NOTCH1 mutation have shown an unfavorable survival and a poor response to chemoimmunotherapy. This study aims to present the mechanisms of adverse prognosis caused by NOTCH1 mutation from the perspective of the splicing factor heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1). METHODS: The microarray data in Gene Expression Omnibus datasets were analyzed by bioinformatics and the function of hnRNPA1 was checked by testing the proliferation and apoptosis of CLL-like cell lines. Afterward, quantitative reverse transcription-polymerase chain reaction and Western blotting were applied to explore the relationship among NOTCH1, c-Myc, and hnRNPA1. RESULTS: RNA splicing was found to play a vital part in NOTCH1-mutated CLL cells; hence, hnRNPA1 was selected as the focus of this study. Higher expression of hnRNPA1 validated in primary NOTCH1-mutated CLL samples could promote proliferation and inhibit apoptosis in CLL. The expression of hnRNPA1 increased when NOTCH1 signaling was activated by transfection with NOTCH1 intracellular domain (NICD)-overexpressed adenovirus vector and declined after NOTCH1 signaling was inhibited by NOTCH1-shRNA. Higher expression of c-Myc was observed in NICD-overexpressed cells and hnRNPA1 expression was downregulated after applying c-Myc inhibitor 10058-F4. Moreover, in NICD-overexpressed cells, hnRNPA1 expression decreased through c-Myc inhibition. CONCLUSION: Overexpression of c-Myc-dependent hnRNPA1 could promote proliferation and inhibit apoptosis in NOTCH1-mutated CLL cells, which might partly account for the poor prognosis of patients with NOTCH1 mutation.

A novel missense HNRNPA1 variant in the PY-NLS domain in a patient with late-onset distal myopathy.

Pathogenic HNRNPA1 variants underlying myopathy have been reported only in the prion-like domain of the heterogenous nuclear ribonucleoproteins A1, while two variants in the nuclear localization (PY-NLS) domain were described in ALS. Here we report a 61-year-old man who presented with 1-year history of bilateral foot drop without Paget disease or dementia. Examination revealed severe asymmetric distal weakness, predominantly affecting tibialis anterior and toe extensors. Creatine kinase was 1,013 U/L (normal <308). Alkaline phosphatase was normal. EMG demonstrated small polyphasic motor unit potentials and fibrillation potentials. Muscle biopsy showed numerous fibers containing rimmed vacuoles and occasional fibers harboring congophilic inclusions, or p62/TDP-43/hnRNPA1-immunoreacted aggregates. Next generation sequencing identified a novel heterozygous (c.959A>T, p. Asn320Ile) variant in HNRNPA1, affecting a highly conserved amino acid in PY-NLS domain. Muscle MRI showed abnormalities, consistent with HNRNPA1-myopathy. This patient expands the phenotypic spectrum of hnRNPA1-opathy due to a PY-NLS domain variant to include isolated distal myopathy.

hnRNP A1 and hnRNP C associate with miR-17 and miR-18 in thyroid cancer cells.

Heterogeneous nuclear ribonucleoproteins (hnRNPs) are essential players in the regulation of gene expression. The majority of the twenty different hnRNP proteins act through the modulation of pre-mRNA splicing. Most have been shown to regulate the expression of critical genes for the progression of tumorigenic processes and were also observed to be overexpressed in several types of cancer. Moreover, these proteins were described as essential components for the maturation of some microRNAs (miRNAs). In the human genome, over 70% of miRNAs are transcribed from introns; therefore, we hypothesized that regulatory proteins involved with splicing could be important for their maturation. Increased expression of the miR-17-92 cluster has already been shown to be related to the development of many cancers, such as thyroid, lung, and lymphoma. In this article, we show that overexpression of hnRNP A1 and hnRNP C in BCPAP thyroid cancer cells directly affects the expression of miR-17-92 miRNAs. Both proteins associate with the 5'-end of this cluster, strongly precipitate miRNAs miR-17 and miR-18a and upregulate the expression of miR-92a. Upon overexpression of these hnRNPs, BCPAP cells also show increased proliferation, migration, and invasion rates, suggesting upregulation of these proteins and miRNAs is related to an enhanced tumorigenic phenotype.

Tetracaine hydrochloride induces cell cycle arrest in melanoma by downregulating hnRNPA1.

Recent evidence suggests potential benefits of applying local anesthetics in cancer patients. Specifically, tetracaine has a potent antitumor effect in diverse cancers, including neuroblastoma, breast cancer, and melanoma; however, the underlying molecular mechanisms remain unclear. Here, we reported that tetracaine hydrochloride inhibited the growth of melanoma cells and arrested melanoma cells in the G0/G1 phase. Tetracaine hydrochloride treatment resulted in translocation of hnRNPA1 from the nucleoplasm to the nuclear envelope and reduced the protein stability of hnRNPA1 possibly by disrupting the dynamic balance of ubiquitination and neddylation. Elevated hnRNPA1 upregulated cyclin D1 to promote cell cycle in melanoma. The hnRNPA1 overexpression attenuated the effect of tetracaine hydrochloride on melanoma cell growth suppression and cell cycle arrest. Furthermore, melanoma homograft experiments demonstrated that tetracaine hydrochloride suppressed melanoma growth, while hnRNPA1 overexpression alleviated tetracaine's antitumor effect on melanoma. Taken together, our findings suggest that tetracaine hydrochloride exerts a potent antitumor effect on melanoma both in vitro and in vivo, and the effect involves cell cycle arrest induction via downregulation of hnRNPA1.

Protein Phosphatase 2A-Dependent Mitotic hnRNPA1 Dephosphorylation and TERRA Formation Facilitate Telomere Capping.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1), telomeric repeat-containing RNA (TERRA), and protection of telomeres 1 (POT1) have been reported to orchestrate to displace replication protein A (RPA) from telomeric overhangs, ensuring orderly telomere replication and capping. Our previous studies further demonstrated that DNA-dependent protein kinase catalytic subunit (DNA-PKcs)-dependent hnRNPA1 phosphorylation plays a crucial role in the promotion of hnRNPA1 binding to telomeric overhangs and RPA displacement during G2-M phases. However, it is unclear that how the subsequent exchange between hnRNPA1 and POT1 is orchestrated. Here we report that the protein phosphatase 2A (PP2A) depends on its scaffold subunit, which is called PPP2R1A, to interact with and dephosphorylate hnRNPA1 in the late M phase. Furthermore, PP2A-mediated hnRNPA1 dephosphorylation and TERRA accumulation act in concert to promote the hnRNPA1-to-POT1 switch on telomeric single-stranded DNA. Consequently, defective PPP2R1A results in ataxia telangiectasia and Rad3-related (ATR)-mediated DNA damage response at telomeres as well as induction of fragile telomeres. Combined inhibition of ATR and PP2A induces entry into a catastrophic mitosis and leads to synthetic lethality of tumor cells. In addition, PPP2R1A levels correlate with clinical stages and prognosis of multiple types of cancers. Taken together, our results indicate that PP2A is critical for telomere maintenance. IMPLICATIONS: This study demonstrates that the PP2A-dependent hnRNPA1 dephosphorylation and TERRA accumulation facilitates the formation of the protective capping structure of newly replicated telomeres, thus exerting essential oncogenic role in tumorigenesis.

Identification of an mRNA isoform switch for HNRNPA1 in breast cancers.

Roles of HNRNPA1 are beginning to emerge in cancers; however, mechanisms causing deregulation of HNRNPA1 function remain elusive. Here, we describe an isoform switch between the 3'-UTR isoforms of HNRNPA1 in breast cancers. We show that the dominantly expressed isoform in mammary tissue has a short half-life. In breast cancers, this isoform is downregulated in favor of a stable isoform. The stable isoform is expressed more in breast cancers, and more HNRNPA1 protein is synthesized from this isoform. High HNRNPA1 protein levels correlate with poor survival in patients. In support of this, silencing of HNRNPA1 causes a reversal in neoplastic phenotypes, including proliferation, clonogenic potential, migration, and invasion. In addition, silencing of HNRNPA1 results in the downregulation of microRNAs that map to intragenic regions. Among these miRNAs, miR-21 is known for its transcriptional upregulation in breast and numerous other cancers. Altogether, the cancer-specific isoform switch we describe here for HNRNPA1 emphasizes the need to study gene expression at the isoform level in cancers to identify novel cases of oncogene activation.

hnRNPA1 enhances FOXP3 stability to promote the differentiation and functions of regulatory T cells.

Regulatory T cells (Tregs) are indispensable for the maintenance of immunological self-tolerance and homeostasis. Heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) is required for optimal Treg induction. Here, we reveal that human-induced Tregs (iTregs) lacking hnRNPA1 show reduced expression of the transcription factor FOXP3, increased ubiquitination level of FOXP3, and impaired suppressive abilities. Human naïve CD4 T cells with hnRNPA1 knockdown show a decreased Treg differentiation ratio. hnRNPA1 could interact with FOXP3 as well as with the E3 ligase Stub1. The phosphorylation at hnRNPA1 S199 could increase both interactions. The overexpression of FOXP3 in Tregs containing shhnRNPA1 could not recover the phenotype caused by hnRNPA1 knockdown. Therefore, there might be multiple essential pathways regulated by hnRNPA1 in Tregs. In conclusion, we present a new role of hnRNPA1 in promoting Treg function, indicating it as a promising target for tumor therapies.

Irisin ameliorates endoplasmic reticulum stress and liver fibrosis through inhibiting PERK-mediated destabilization of HNRNPA1 in hepatic stellate cells.

Liver fibrosis is a common consequence of chronic liver diseases involved with the activation of hepatic stellate cells (HSCs) and endoplasmic reticulum (ER) stress. Irisin is a small polypeptide hormone that shows beneficial effects on metabolic disorders. The current study aimed to investigate the biological function of irisin on hepatic fibrosis. A mouse model of carbon tetrachloride (CCl4)-induced hepatic fibrosis was established. CCl4-treated mice showed elevated serum levels of AST and ALT, increased collagen accumulation, induced ER stress, and upregulated expressions of pro-fibrotic proteins in the liver compared to the controls. The administration of irisin, however, ameliorated CCl4-induced hepatic fibrosis in both cultured HSCs and mice. PKR-like ER kinase (PERK) is a key component of the ER stress-associated signaling pathway. We found that irisin treatment improved the stability of heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) via regulating the phosphorylation of PERK in mouse livers and isolated HSCs. Also, the knockdown of HNRNPA1 eliminated the hepatoprotective effects of irisin on hepatic fibrosis and ER stress. In summary, this study showed that irisin alleviated ER stress and hepatic fibrosis by inhibiting PERK-mediated HNRNPA1 destabilization, suggesting that irisin may represent a promising therapeutic strategy for patients with liver fibrosis.

HNRNPA1-mediated exosomal sorting of miR-483-5p out of renal tubular epithelial cells promotes the progression of diabetic nephropathy-induced renal interstitial fibrosis.

Diabetic nephropathy (DN) is a serious complication in type 1 and type 2 diabetes, and renal interstitial fibrosis plays a key role in DN progression. Here, we aimed to probe into the role and potential mechanism of miR-483-5p in DN-induced renal interstitial fibrosis. In this study, we corroborated that miR-483-5p expression was lessened in type 1 and type 2 diabetic mice kidney tissues and high glucose (HG)-stimulated tubular epithelial cells (TECs), and raised in the exosomes derived from renal tissues in type 1 and type 2 diabetic mice. miR-483-5p restrained the expressions of fibrosis-related genes in vitro and renal interstitial fibrosis in vivo. Mechanistically, miR-483-5p bound both TIMP2 and MAPK1, and TIMP2 and MAPK1 were bound up with the regulation of miR-483-5p on renal TECs under HG conditions. Importantly, HNRNPA1-mediated exosomal sorting transported cellular miR-483-5p out of TECs into the urine. Our results expounded that HNRNPA1-mediated exosomal sorting transported cellular miR-483-5p out of TECs into the urine, thus lessening the restraint of cellular miR-483-5p on MAPK1 and TIMP2 mRNAs, and ultimately boosting extracellular matrix deposition and the progression of DN-induced renal interstitial fibrosis.

Profiling PRMT methylome reveals roles of hnRNPA1 arginine methylation in RNA splicing and cell growth.

Numerous substrates have been identified for Type I and II arginine methyltransferases (PRMTs). However, the full substrate spectrum of the only type III PRMT, PRMT7, and its connection to type I and II PRMT substrates remains unknown. Here, we use mass spectrometry to reveal features of PRMT7-regulated methylation. We find that PRMT7 predominantly methylates a glycine and arginine motif; multiple PRMT7-regulated arginine methylation sites are close to phosphorylations sites; methylation sites and proximal sequences are vulnerable to cancer mutations; and methylation is enriched in proteins associated with spliceosome and RNA-related pathways. We show that PRMT4/5/7-mediated arginine methylation regulates hnRNPA1 binding to RNA and several alternative splicing events. In breast, colorectal and prostate cancer cells, PRMT4/5/7 are upregulated and associated with high levels of hnRNPA1 arginine methylation and aberrant alternative splicing. Pharmacological inhibition of PRMT4/5/7 suppresses cancer cell growth and their co-inhibition shows synergistic effects, suggesting them as targets for cancer therapy.

ESCO2 promotes lung adenocarcinoma progression by regulating hnRNPA1 acetylation.

BACKGROUND: Emerging evidence indicates that metabolism reprogramming and abnormal acetylation modification play an important role in lung adenocarcinoma (LUAD) progression, although the mechanism is largely unknown. METHODS: Here, we used three public databases (Oncomine, Gene Expression Omnibus [GEO], The Cancer Genome Atlas [TCGA]) to analyze ESCO2 (establishment of cohesion 1 homolog 2) expression in LUAD. The biological function of ESCO2 was studiedusing cell proliferation, colony formation, cell migration, and invasion assays in vitro, and mouse xenograft models in vivo. ESCO2 interacting proteins were searched using gene set enrichment analysis (GSEA) and mass spectrometry. Pyruvate kinase M1/2 (PKM) mRNA splicing assay was performed using RT-PCR together with restriction digestion. LUAD cell metabolism was studied using glucose uptake assays and lactate production. ESCO2 expression was significantly upregulated in LUAD tissues, and higher ESCO2 expression indicated worse prognosis for patients with LUAD. RESULTS: We found that ESCO2 promoted LUAD cell proliferation and metastasis metabolic reprogramming in vitro and in vivo. Mechanistically, ESCO2 increased hnRNPA1 (heterogeneous nuclear ribonucleoprotein A1) binding to the intronic sequences flanking exon 9 (EI9) of PKM mRNA by inhibiting hnRNPA1 nuclear translocation, eventually inhibiting PKM1 isoform formation and inducing PKM2 isoform formation. CONCLUSIONS: Our findings confirm that ESCO2 is a key factor in promoting LUAD malignant progression and suggest that it is a new target for treating LUAD.

SAM68 promotes tumorigenesis in lung adenocarcinoma by regulating metabolic conversion via PKM alternative splicing.

Background: A metabolic "switch" from oxidative phosphorylation to glycolysis provides tumor cells with energy and biosynthetic substrates, thereby promoting tumorigenesis and malignant progression. However, the mechanisms controlling this metabolic switch in tumors is not entirely clear. Methods: Clinical specimens were used to determine the effect of SAM68 on lung adenocarcinoma (LUAD) tumorigenesis and metastasis, and mouse models and molecular biology assays were performed to elucidate the function and underlying mechanisms in vitro and in vivo. Results:SAM68 mRNA levels were higher in LUAD tissue than in normal lung tissue, indicating that SAM68 expression is upregulated in LUAD. Patients with LUAD with SAM68high (n = 257) had a higher frequency of tumor recurrence (p = 0.025) and recurrence-free survival (p = 0.013) than did those with SAM68low (n = 257). Patients with SAM68high mRNA levels (n = 257) were at a higher risk for cancer-related death (p = 0.006), and had shorter overall survival (p = 0.044) than did those with SAM68low. SAM68 promotes tumorigenesis and metastasis of LUAD cells in vitro and in vivo by regulating the cancer metabolic switch. SAM68 drives cancer metabolism by mediating alternative splicing of pyruvate kinase (PKM) pre-mRNAs, and promoting the formation of PKM2. Mechanistically, SAM68 increased the binding of the splicing repressor hnRNP A1 to exon 9 of PKM, thereby enhancing PKM2 isoform formation and PKM2-dependent aerobic glycolysis and tumorigenesis. Conclusions: SAM68 promotes LUAD cell tumorigenesis and cancer metabolic programming via binding of the 351-443 aa region of SAM68 to the RGG motif of hnRNP A1, driving hnRNP A1-dependent PKM splicing, contributing to increased oncogene PKM2 isoform formation and inhibition of PKM1 isoform formation. SAM68 is therefore a promising therapeutic target for the treatment of LUAD.

RBMX suppresses tumorigenicity and progression of bladder cancer by interacting with the hnRNP A1 protein to regulate PKM alternative splicing.

The prognosis for patients with metastatic bladder cancer (BCa) is poor, and it is not improved by current treatments. RNA-binding motif protein X-linked (RBMX) are involved in the regulation of the malignant progression of various tumors. However, the role of RBMX in BCa tumorigenicity and progression remains unclear. In this study, we found that RBMX was significantly downregulated in BCa tissues, especially in muscle-invasive BCa tissues. RBMX expression was negatively correlated with tumor stage, histological grade and poor patient prognosis. Functional assays demonstrated that RBMX inhibited BCa cell proliferation, colony formation, migration, and invasion in vitro and suppressed tumor growth and metastasis in vivo. Mechanistic investigations revealed that hnRNP A1 was an RBMX-binding protein. RBMX competitively inhibited the combination of the RGG motif in hnRNP A1 and the sequences flanking PKM exon 9, leading to the formation of lower PKM2 and higher PKM1 levels, which attenuated the tumorigenicity and progression of BCa. Moreover, RBMX inhibited aerobic glycolysis through hnRNP A1-dependent PKM alternative splicing and counteracted the PKM2 overexpression-induced aggressive phenotype of the BCa cells. In conclusion, our findings indicate that RBMX suppresses BCa tumorigenicity and progression via an hnRNP A1-mediated PKM alternative splicing mechanism. RBMX may serve as a novel prognostic biomarker for clinical intervention in BCa.