N6-methyladenosine reader hnRNPA2B1 recognizes and stabilizes NEAT1 to confer chemoresistance in gastric cancer.

BACKGROUND: Chemoresistance is a major cause of treatment failure in gastric cancer (GC). Heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) is an N6-methyladenosine (m6A)-binding protein involved in a variety of cancers. However, whether m6A modification and hnRNPA2B1 play a role in GC chemoresistance is largely unknown. In this study, we aimed to investigate the role of hnRNPA2B1 and the downstream mechanism in GC chemoresistance. METHODS: The expression of hnRNPA2B1 among public datasets were analyzed and validated by quantitative PCR (qPCR), Western blotting, immunofluorescence, and immunohistochemical staining. The biological functions of hnRNPA2B1 in GC chemoresistance were investigated both in vitro and in vivo. RNA sequencing, methylated RNA immunoprecipitation, RNA immunoprecipitation, and RNA stability assay were performed to assess the association between hnRNPA2B1 and the binding RNA. The role of hnRNPA2B1 in maintenance of GC stemness was evaluated by bioinformatic analysis, qPCR, Western blotting, immunofluorescence, and sphere formation assays. The expression patterns of hnRNPA2B1 and downstream regulators in GC specimens from patients who received adjuvant chemotherapy were analyzed by RNAscope and multiplex immunohistochemistry. RESULTS: Elevated expression of hnRNPA2B1 was found in GC cells and tissues, especially in multidrug-resistant (MDR) GC cell lines. The expression of hnRNPA2B1 was associated with poor outcomes of GC patients, especially in those who received 5-fluorouracil treatment. Silencing hnRNPA2B1 effectively sensitized GC cells to chemotherapy by inhibiting cell proliferation and inducing apoptosis both in vitro and in vivo. Mechanically, hnRNPA2B1 interacted with and stabilized long noncoding RNA NEAT1 in an m6A-dependent manner. Furthermore, hnRNPA2B1 and NEAT1 worked together to enhance the stemness properties of GC cells via Wnt/ß-catenin signaling pathway. In clinical specimens from GC patients subjected to chemotherapy, the expression levels of hnRNPA2B1, NEAT1, CD133, and CD44 were markedly elevated in non-responders compared with responders. CONCLUSION: Our findings indicated that hnRNPA2B1 interacts with and stabilizes lncRNA NEAT1, which contribute to the maintenance of stemness property via Wnt/ß-catenin pathway and exacerbate chemoresistance in GC.

Expression and effect of heterogeneous nuclear ribonucleoprotein A2/B1 in tongue squamous cell carcinoma. / æ ¸å† ä¸å‡ä¸€æ ¸ç³–æ ¸è›‹ç™½A2/B1在舌鳞状细胞癌中的表达及作用.

OBJECTIVES: Tongue squamous cell carcinoma (TSCC) is a common cancer in the oral and maxillofacial region, which seriously endangers people's life and health.Heterogeneous nuclear ribonucleoprotein A2/B1(hnRNP A2/B1) is an RNA-binding protein that regulates the expression of a variety of genes and participates in the occurrence and development of a variety of cancers. This study aims to investigate the role of hnRNP A2/B1 in TSCC progression. METHODS: The differential expression of hnRNP A2/B1 in oral squamous cell carcinoma (OSCC) and normal oral mucosa cells and tissues was analyzed based on the gene expression profiles of GSE146483 and GSE85195 in the Gene Expression Omnibus (GEO) database. The correlation between hnRNP A2/B1 expression and disease-free survival of TSCC patients was analyzed based on TSCC related chip of GSE4676. TSCC cancer and paracancerous tissue samples of 30 patients were collected in Hunan Cancer Hospital from July to December 2021. Real-time RT-PCR and Western blotting were used to verify the mRNA and protein expression of hnRNP A2/B1 in TSCC patients'samples, respectively. Human TSCC Tca-8113 cells were transfected with hnRNP A2/B1 empty vector (a sh-NC group), knockdown plasmid (a sh-hnRNP A2/B1 group), empty vector overexpression plasmid (an OE-NC group) and overexpression plasmid (an OE-hnRNP A2/B1 group), respectively. The knockdown or overexpression efficiency of hnRNP A2/B1 was detected by Western blotting. The proliferation activity of Tca-8113 cells was detected by cell counting kit-8 (CCK-8), and the apoptosis rate of Tca-8113 cells was detected by flow cytometry. RESULTS: Based on the analysis of OSCC-related chips of GSE146483 and GSE85195 in the GEO database, it was found that hnRNP A2/B1 was differentially expressed in the OSCC and normal oral mucosa cells and tissues (all P<0.01). Meanwhile, the analysis of TSCC related chip GSE4676 confirmed that the expression of hnRNP A2/B1 was negatively correlated with the disease-free survival of TSCC patients (P=0.006). The results of real-time RT-PCR and Western blotting showed that the relative expression levels of hnRNP A2/B1 mRNA and protein in TSCC tissues were significantly up-regulated compared with those in adjacent tissues (all P<0.01). The results of Western blotting showed that the expression level of hnRNP A2/B1 in Tca-8113 cells was significantly inhibited or promoted after knockdown or overexpression of hnRNP A2/B1 (all P<0.01). The results of CCK-8 and flow cytometry showed that inhibition of hnRNP A2/B1 expression in Tca-8113 cells reduced cell proliferation activity (P<0.05) and increased cell apoptic rate (P<0.01). Overexpression of hnRNP A2/B1 in Tca-8113 cells significantly increased cell proliferation (P<0.05) and decreased cell apoptosis (P<0.01). CONCLUSIONS: HnRNP A2/B1 is a key factor regulating the proliferation and apoptosis of TSCC cells. Inhibition of hnRNP A2/B1 expression can reduce the proliferation activity of TSCC cells and promote the apoptosis of TSCC cells.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

A2/B1 Promotes NRF2 mRNA Stability and Inhibits Ferroptosis and Cell Proliferation in Breast Cancer Cells.

Breast cancer is a highly harmful malignant tumor, which poses a great threat to women's body and mind, and the mortality rate ranks second among all women's diseases. The incidence rate accounts for 7-10% of various malignant tumors in the whole body, second only to uterine cancer in women, and has become the main cause of threatening women's health. Advanced breast cancer is often considered an incurable disease. The family of heterogeneous nuclear ribonucleoprotein complexes is composed of about 20 hnRNP proteins with molecular weights ranging from 32 to 120 kDa, and they are named according to their molecular weights. Among them, hnRNPA2 and hnRNPB1 are the two most important members of the hnRNP family, both derived from the same gene on chromosome 7p15. Therefore, research to understand the molecular mechanism and process of breast cancer progression has an important role in promoting the current medical research on breast cancer treatment methods. Therefore, studying the mechanism of tumorigenesis is the key to tumor prevention and treatment. Therefore, this paper proposes that A2/B1 promotes the stability of NRF2 mRNA and inhibits ferroptosis and cell proliferation in breast cancer cells. The article mainly introduces the disease diagnosis method based on artificial neural network and its neural network algorithm. In the experimental part, the activity of hnRNP A2/B1 on cancer cells is deeply studied. The results show that the absorbance of the MTT method increases continuously with the extension of the culture time, and the maximum reaches 1.2. This fully shows that its absorption capacity is very strong, especially after 24 hours, the absorption rate rises from 0.6 to 0.9, which shows that 24 hours is the best absorption time. And it can also be found that hnRNPA2/B1 has a significant inhibitory effect on breast cancer cells; it can reduce the effect on breast cancer cell cycle and apoptosis.

Serum/glucose starvation strikingly reduces heterogeneous nuclear ribonucleoprotein A1 protein and its target, cyclin D1.

Our investigation to explore cellular alterations related to undernutrition in cancer cells revealed that the protein level of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1) is drastically decreased by serum/glucose starvation. Its loss was reversible, serum/glucose starvation-specific and universal throughout cell types and species. The hnRNP A1 mRNA level and hnRNP A1 mRNA/protein stability were not altered under this condition. CCND1 mRNA, which we newly identified as the binding target of hnRNP A1, was decreased by serum/glucose starvation. Under similar conditions, CCND1 protein was reduced in vitro and in vivo, whereas hnRNP A1 mRNA level and CCND1 mRNA level revealed no correlation in most clinical samples. Functional analyses revealed that CCND1 mRNA stability is certainly dependent on hnRNP A1 protein level and that RNA recognition motif-1 (RRM1) in hnRNP A1 plays a central role in maintaining CCND1 mRNA stability and subsequent protein expression. The injection of RRM1-deleted hnRNP A1-expressing cancer cells in the mouse xenograft model did not form any tumours, and that of hnRNP A1-expressing cancer cells retained CCND1 expression at the lesion adjacent to necrosis with a slight increase in tumour volume. Furthermore, RRM1 deletion caused growth suppression with the induction of apoptosis and autophagy, whereas CCND1 restoration completely recovered it. Our results indicate that serum/glucose starvation triggers entire hnRNP A1 protein loss, and its loss may play a role in CCND1 mRNA destabilization and CCND1-mediated cellular event inhibition, i.e. growth promotion, apoptosis induction and autophagosome formation.

The c-Myc targeting hnRNPAB promotes lung adenocarcinoma cell proliferation via stabilization of CDK4 mRNA.

The c-Myc oncoprotein plays a pivotal role in tumorigenesis. The deregulated expression of c-Myc has been linked to a variety of human cancers including lung adenocarcinoma. The oncogenic function of c-Myc has been largely attributed to its intrinsic nature as a transcription factor. Here we reported the RNA binding protein hnRNPAB as a direct transcriptional target of c-Myc by performing quantitative real-time polymerase chain reaction (qRT-PCR), western blot, chromatin immunoprecipitation (ChIP), and luciferase reporter analyses. Flow cytometry, colony formation, and RNA immunoprecipitation (RIP) assays were used to investigate the role of hnRNPAB in lung adenocarcinoma cell proliferation, as well as the underlying mechanism. HnRNPAB was functionally shown to promote lung adenocarcinoma cell proliferation by accelerating G1/S cell cycle progression. Mechanistically, hnRNPAB interacted with and stabilized CDK4 mRNA, thereby increasing CDK4 expression. Moreover, hnRNPAB was able to promote G1/S cell cycle progression and cell proliferation via the regulation of CDK4. HnRNPAB was also revealed as a mediator of the promoting effect of c-Myc on cell proliferation. Together, these findings demonstrate that hnRNPAB is an important regulator of lung adenocarcinoma cell proliferation. They also add new insights into the mechanisms of how c-Myc promotes tumorigenesis.

A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.

m6A reader hnRNPA2B1 drives multiple myeloma osteolytic bone disease.

Rationale: Bone destruction is a hallmark of multiple myeloma (MM) and affects more than 80% of patients. Although previous works revealed the roles of N6-methyladenosine (m6A) reader hnRNPA2B1 in the development of tumors, whether hnRNPA2B1 regulates bone destruction in MM is still unknown. Methods: Alizarin red S staining, TRAP staining, ELISA and quantitative real-time PCR assays were used to evaluate osteogenesis and osteoclastogenesis in vitro. X ray and bone histomorphometric analysis were preformed to identify bone resorption and bone formation in vivo. Exosome isolation and characterization were demonstrated by transmission electron microscopy, dynamic light scattering, immunofluorescence and flow cytometry assays. The interactions between hnRNPA2B1 and primary microRNAs were examined using RNA pull-down and RIP assays. Coimmunoprecipitation assay was used to test the interaction between hnRNPA2B1 and DGCR8 proteins. Luciferase assay was established to assess miRNAs target genes. Results: Here we show that myeloma cells hnRNPA2B1 mediates microRNAs processing and upregulates miR-92a-2-5p and miR-373-3p expression. These two microRNAs are transported to recipient monocytes or mesenchymal stem cells (MSCs) through exosomes, leading to activation of osteoclastogenesis and suppression of osteoblastogenesis by inhibiting IRF8 or RUNX2. Furthermore, clinical studies revealed a highly positive correlation between the level of myeloma cells hnRNPA2B1 and the number of osteolytic bone lesions in myeloma patients. Conclusions: This study elucidates an important mechanism by which myeloma-induced bone lesions, suggesting that hnRNPA2B1 may be targeted to prevent myeloma-associated bone disease.

The Expression of hnRNP A2/B1 in Benign and Malignant Lung Lesions and Its Early Diagnosis Value in NSCLC.

Lung cancer in its occurrence and development of different stages exist different biological behavior changes. This paper studies the expression of heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1 in benign and malignant lung lesions and its early diagnosis value of nonsmall-cell lung cancer (NSCLC), aiming to provide reference for the early diagnosis and therapy of NSCLC. Some lung surgery specimens are selected from January 2021 to March 2022. All cases received no radiotherapy and chemotherapy before surgery, including 90 sufferers with benign lung lesions as the contrast set. hnRNP A2/B1 expressions are measured for comparison. The experimental results show that for lung cancer sufferers, the positive expression of hnRNP A2/B1 in their malignant lesion tissue is notoriously higher than that in their benign lesion tissue, and hnRNP A2/B1 is differently expressed in different differentiation and in different stages.

Emerging roles of hnRNP A2B1 in cancer and inflammation.

Heterogeneous nuclear ribonucleoproteins (hnRNPs) are a group of RNA-binding proteins with important roles in multiple aspects of nucleic acid metabolism, including the packaging of nascent transcripts, alternative splicing, transactivation of gene expression, and regulation of protein translation. As a core component of the hnRNP complex in mammalian cells, heterogeneous nuclear ribonucleoprotein A2B1 (hnRNP A2B1) participates in and coordinates various molecular events. Given its regulatory role in inflammation and cancer progression, hnRNP A2B1 has become a novel player in immune response, inflammation, and cancer development. Concomitant with these new roles, a surprising number of mechanisms deemed to regulate hnRNP A2B1 functions have been identified, including post-translational modifications, changes in subcellular localization, direct interactions with multiple DNAs, RNAs, and proteins or the formation of complexes with them, which have gradually made hnRNP A2B1 a molecular target for multiple drugs. In light of the rising interest in the intersection between cancer and inflammation, this review will focus on recent knowledge of the biological roles of hnRNP A2B1 in cancer, immune response, and inflammation.

Tumor-Promoting Actions of HNRNP A1 in HCC Are Associated with Cell Cycle, Mitochondrial Dynamics, and Necroptosis.

Hepatocellular carcinoma (HCC) is one of the most frequent malignancies in the world. Although increasing evidence supports the role of heterogeneous ribonucleoprotein particle A1 (HNRNP A1) in tumor progression, the function of HNRNP A1 in HCC remains unclear. Here, we focused on the role of HNRNP A1 in the development of HCC. In this study, we found HNRNP A1 participates in many aspects of HCC, such as progression and prognosis. Our results showed that HNRNP A1 is upregulated in human HCC tissues and cell lines. High expression of HNRNP A1 can promote the proliferation, migration, and invasion in HCC cells and accelerate tumor progression in mice. Moreover, we found that HNRNP A1 prevents the senescence process of HCC cells. Knocking down of HNRNP A1 promotes the expression of P16INK4, which arrests the cell cycle and then induces the senescence phenotype in HCC cells. Furthermore, we found that HNRNP A1 regulated necroptosis and mitochondrial dynamics. In summary, our study indicates that HNRNP A1 promotes the development of HCC, which suggests a potential therapeutic target for HCC.

HNRNPA2B1 Demonstrates Diagnostic and Prognostic Values Based on Pan-Cancer Analyses.

Some studies have suggested heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) to be a promoter in cancer development. Nonetheless, no detailed pan-cancer investigation has been reported. Thus, this study explored the possible oncogenic role of HNRNPA2B1, such as its expression levels, gene alteration, protein-protein interaction network, immune infiltration, and prognostic value in different cancer types using The Cancer Genome Atlas web platform. Many types of cancer exhibit HNRNPA2B1 overexpression, which is notably associated with poor prognosis. We also found that HNRNPA2B1 with different methylation levels causes a varied prognosis in lung adenocarcinoma (LUAD). It is noteworthy that HNRNPA2B1 levels are connected with cancer-associated fibroblasts in cancers, such as adrenocortical carcinoma, LUAD, and stomach adenocarcinoma. In addition, HNRNPA2B1 participates in the spliceosome- and cell cycle-associated pathways. Finally, HNRNPA2B1 is highly valued in the diagnosis of LUAD, lung squamous cell carcinoma, breast invasive carcinoma, esophageal carcinoma, and liver hepatocellular carcinoma. This systematic study highlighted the role of HNRNPA2B1 in pan-cancer progression.

Methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit-induced long intergenic non-protein coding RNA 1833 N6-methyladenosine methylation promotes the non-small cell lung cancer progression via regulating heterogeneous nuclear ribonucleoprotein A2/B1 expression.

Long intergenic non-protein coding RNA 1833 (LINC01833) exhibits elevated expression in the non-small cell lung cancer (NSCLC) tissues, while its molecular mechanism in NSCLC progression remains elusive. Herein, the proliferation, migration, invasion as well as apoptosis of NSCLC cells were assessed. The potential N6-methyladenosine (m6A) modification site was predicted by the m6aVar tool. RNA pulldown and m6A-specific immunoprecipitation assays were used to detect the interaction between LINC01833 and methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit (METTL3). RNA pull-down together with mass spectrometry were performed to assess the binding relationship between LINC01833 and heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) in NSCLC. Tumor xenograft mice model was established, and the tumor size and weight were measured. The results demonstrated that LINC01833 expression was elevated in NSCLC samples. Overexpression of LINC01833 promoted proliferative, migratory, and invasive abilities and inhibited HCC827 cell apoptosis. LINC01833 knockdown inhibited tumor growth in mice. LINC01833 is further demonstrated to be modulated by METTL3, which is highly expressed in NSCLC samples. In addition, RNA pulldown and m6A-specific immunoprecipitation assays indicated that LINC01833 might form a complex with HNRNPA2B1. In conclusion, m6A transferase METTL3-induced LINC01833 m6A methylation promotes NSCLC progression through modulating HNRNPA2B1 expression. Our findings indicated that LINC01833 might be a therapeutic target for NSCLC.

HNRNPA2B1 inhibited SFRP2 and activated Wnt-ß/catenin via m6A-mediated miR-106b-5p processing to aggravate stemness in lung adenocarcinoma.

Cancer stem cells (CSCs) exhibit strong self-renewal capability to contribute to tumorigenesis in lung adenocarcinoma (LUAD). N6-methyladenosine (m6A) methylation is confirmed as a key mechanism for stemness acquisition and tumor growth. Heterogeneous nuclear ribonucleoprotein A2B1 (HNRNPA2B1) is a known m6A reader and is reported to participate in LUAD progression, but its relation with stemness of LUAD cells is unknown. Thus, this study aimed to uncover the effect of HNRNPA2B1 in stemness of LUAD cells. The association of HNRNPA2B1 with LUAD prognosis was analyzed via Gene Expression Profiling Interactive Analysis (GEPIA). Sphere formation, cytometry flow analysis and western blot of stemness-related genes were performed to examine the stemness of LUAD cells. m6A modification was investigated by RNA immunoprecipitation. Results depicted that HNRNPA2B1 was upregulated in LUAD CSCs. HNRNPA2B1 knockdown repressed cell stemness, proliferation, migration, and tumor growth of LUAD. As to mechanism, HNRNPA2B1 read the m6A site on primary microRNA-106b (pri-miR-106b) to facilitate the maturing of miR-106b-5p, so that miR-106b-5p targeted secreted frizzled-related protein 2 (SFRP2), activating Wnt/ß-catenin signaling. In conclusion, HNRNPA2B1 inhibits SFRP2 and activates Wnt-ß/catenin via m6A-mediated maturing of miR-106b-5p to aggravate stemness and LUAD progression, which potentially offered HNRNPA2B1 as a potential marker in CSCs-targeted treatment for LUAD.

Interaction of lncRNA MIR100HG with hnRNPA2B1 facilitates m6A-dependent stabilization of TCF7L2 mRNA and colorectal cancer progression.

BACKGROUND: Epithelial-to-mesenchymal transition (EMT) is a process linked to metastasis and drug resistance with non-coding RNAs (ncRNAs) playing pivotal roles. We previously showed that miR-100 and miR-125b, embedded within the third intron of the ncRNA host gene MIR100HG, confer resistance to cetuximab, an anti-epidermal growth factor receptor (EGFR) monoclonal antibody, in colorectal cancer (CRC). However, whether the MIR100HG transcript itself has a role in cetuximab resistance or EMT is unknown. METHODS: The correlation between MIR100HG and EMT was analyzed by curating public CRC data repositories. The biological roles of MIR100HG in EMT, metastasis and cetuximab resistance in CRC were determined both in vitro and in vivo. The expression patterns of MIR100HG, hnRNPA2B1 and TCF7L2 in CRC specimens from patients who progressed on cetuximab and patients with metastatic disease were analyzed by RNAscope and immunohistochemical staining. RESULTS: The expression of MIR100HG was strongly correlated with EMT markers and acted as a positive regulator of EMT. MIR100HG sustained cetuximab resistance and facilitated invasion and metastasis in CRC cells both in vitro and in vivo. hnRNPA2B1 was identified as a binding partner of MIR100HG. Mechanistically, MIR100HG maintained mRNA stability of TCF7L2, a major transcriptional coactivator of the Wnt/ß-catenin signaling, by interacting with hnRNPA2B1. hnRNPA2B1 recognized the N6-methyladenosine (m6A) site of TCF7L2 mRNA in the presence of MIR100HG. TCF7L2, in turn, activated MIR100HG transcription, forming a feed forward regulatory loop. The MIR100HG/hnRNPA2B1/TCF7L2 axis was augmented in specimens from CRC patients who either developed local or distant metastasis or had disease progression that was associated with cetuximab resistance. CONCLUSIONS: MIR100HG and hnRNPA2B1 interact to control the transcriptional activity of Wnt signaling in CRC via regulation of TCF7L2 mRNA stability. Our findings identified MIR100HG as a potent EMT inducer in CRC that may contribute to cetuximab resistance and metastasis by activation of a MIR100HG/hnRNPA2B1/TCF7L2 feedback loop.

[Identification and validation of hub genes in prostate cancer progression based on weighted gene co-expression network analysis].

OBJECTIVE: To identify the key hub genes in prostate cancer metastasis based on weighted gene co-expression network analysis (WGCNA) and verify the identified genes. METHODS: Whole-genome chip data GSE6919 of prostate cancer study were analyzed using principal component analysis (PCA), and the differentially expressed genes (DEGs) were analyzed using R software. WGCNA was performed to construct a gene co-expression network for screening the key genes. TCGA database was used to explore the expressions of the DEGs and their association with the prognosis. To validate the results, we designed siRNA fragments targeting the metastasis-related gene HNRNPA2B1, and observed its effect on growth, apoptosis, clone formation, migration and invasion of prostate cancer cell lines using MTT assay, flow cytometry, clone formation assay, and Transwell assay. RESULTS: PCA analysis showed obvious clustering of significant DEGs in metastatic cancer group. The modules obtained by WGCNA analysis in metastasis group involved stem cell differentiation, amino acid metabolism and immune response. Further screening of the genes identified 3 genes related with prostate cancer occurrence (BDH1, PAK4 and EXTL3) and another 3 with prostate cancer metastasis (NKTR, CTBP2 and HNRNPA2B1), which were shown to have differential expressions in TCGA database and were correlated with the patient's overall survival. In the cell experiment, PC3 and LNCap cells transfected with the siRNA fragment targeting HNRNPA2B1 showed obvious growth inhibition with increased cell apoptosis, lowered clone formation ability, and suppressed capacities for migration and invasion. CONCLUSION: We identified 3 hub genes related with the occurrence (BDH1, PAK4 and EXTL3) and another 3 with metastasis of prostate cancer (NKTR, CTBP2 and HNRNPA2B1) using WGCNA, which provides a new approach for studying the regulatory mechanisms of prostate cancer.

SON drives oncogenic RNA splicing in glioblastoma by regulating PTBP1/PTBP2 switching and RBFOX2 activity.

While dysregulation of RNA splicing has been recognized as an emerging target for cancer therapy, the functional significance of RNA splicing and individual splicing factors in brain tumors is poorly understood. Here, we identify SON as a master regulator that activates PTBP1-mediated oncogenic splicing while suppressing RBFOX2-mediated non-oncogenic neuronal splicing in glioblastoma multiforme (GBM). SON is overexpressed in GBM patients and SON knockdown causes failure in intron removal from the PTBP1 transcript, resulting in PTBP1 downregulation and inhibition of its downstream oncogenic splicing. Furthermore, SON forms a complex with hnRNP A2B1 and antagonizes RBFOX2, which leads to skipping of RBFOX2-targeted cassette exons, including the PTBP2 neuronal exon. SON knockdown inhibits proliferation and clonogenicity of GBM cells in vitro and significantly suppresses tumor growth in orthotopic xenografts in vivo. Collectively, our study reveals that SON-mediated RNA splicing is a GBM vulnerability, implicating SON as a potential therapeutic target in brain tumors.

Characterization of the m6A-Associated Tumor Immune Microenvironment in Prostate Cancer to Aid Immunotherapy.

The aim of this study was to elucidate the correlation between m6A modification and the tumor immune microenvironment (TIME) in prostate cancer (PCa) and to identify the m6A regulation patterns suitable for immune checkpoint inhibitors (ICIs) therapy. We evaluated the m6A regulation patterns of PCa based on 24 m6A regulators and correlated these modification patterns with TIME characteristics. Three distinct m6A regulation patterns were determined in PCa. The m6A regulators cluster with the best prognosis had significantly increased METTL14 and ZC3H13 expression and was characterized by low mutation rate, tumor heterogeneity, and neoantigens. The m6A regulators cluster with a poor prognosis had markedly high KIAA1429 and HNRNPA2B1 expression and was characterized by high intratumor heterogeneity and Th2 cell infiltration, while low Th17 cell infiltration and Macrophages M1/M2. The m6Ascore was constructed to quantify the m6A modification pattern of individual PCa patients based on m6A-associated genes. We found that the low-m6Ascore group with poor prognosis had a higher immunotherapeutic response rate than the high-m6Ascore group. The low-m6Ascore group was more likely to benefit from ICIs therapy. This study was determined that immunotherapy is more effective in low-m6Ascore PCa patients with poor prognosis.

Interaction of tau with HNRNPA2B1 and N6-methyladenosine RNA mediates the progression of tauopathy.

The microtubule-associated protein tau oligomerizes, but the actions of oligomeric tau (oTau) are unknown. We have used Cry2-based optogenetics to induce tau oligomers (oTau-c). Optical induction of oTau-c elicits tau phosphorylation, aggregation, and a translational stress response that includes stress granules and reduced protein synthesis. Proteomic analysis identifies HNRNPA2B1 as a principle target of oTau-c. The association of HNRNPA2B1 with endogenous oTau was verified in neurons, animal models, and human Alzheimer brain tissues. Mechanistic studies demonstrate that HNRNPA2B1 functions as a linker, connecting oTau with N6-methyladenosine (m6A) modified RNA transcripts. Knockdown of HNRNPA2B1 prevents oTau or oTau-c from associating with m6A or from reducing protein synthesis and reduces oTau-induced neurodegeneration. Levels of m6A and the m6A-oTau-HNRNPA2B1 complex are increased up to 5-fold in the brains of Alzheimer subjects and P301S tau mice. These results reveal a complex containing oTau, HNRNPA2B1, and m6A that contributes to the integrated stress response of oTau.

Heterogeneous nuclear ribonucleoprotein A2/B1 regulates the ERK and p53/HDM2 signaling pathways to promote the survival, proliferation and migration of non­small cell lung cancer cells.

Lung cancer is the most frequent cause of cancer­associated mortality worldwide. Upregulation of heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNPA2/B1) has been reported in non­small cell lung cancer (NSCLC) cells, but its contribution to NSCLC remains poorly understood. hnRNPA2/B1 is involved in carcinogenesis by interacting with a number of proteins; however, little is known about its interaction with p53. The results of the present study revealed that hnRNPA2/B1 expression levels were upregulated in NSCLC cells under tumorsphere culture conditions and cisplatin treatment compared with those in cells under the adherent condition and dimethyl sulfoxide treatment, respectively, suggesting that hnRNPA2/B1 expression is induced under stress conditions. hnRNPA2/B1 knockdown decreased the number and size of NSCLC cell colonies in a clonogenic survival assay and led to a decreased migratory potential of NSCLC cells, suggesting that hnRNPA2/B1 may promote the survival, proliferation and migration of NSCLC cells. hnRNPA2/B1 knockdown induced G0/G1 phase arrest in NSCLC cells through cyclin E degradation and phosphorylation of cyclin­dependent kinase 2. In addition, hnRNPA2/B1 knockdown inhibited extracellular signal­regulated kinase (ERK)1/2 phosphorylation, suggesting that hnRNPA2/B1 may promote the G1/S phase transition in NSCLC cells through ERK signaling. hnRNPA2/B1 knockdown resulted in increased expression levels of p21 and p27 in NSCLC cells, as well as p53 induction and phosphorylation. Additionally, hnRNPA2/B1 knockdown inhibited human double minute 2 protein (HDM2) stability and phosphorylation, whereas overexpression of hnRNPA2 induced the opposite effects. These results suggested that hnRNPA2/B1 may promote the survival, proliferation and migration of NSCLC cells through preventing the activation of p53, which is induced by ERK­mediated HDM2 activation. The results of the present study also indicated that the components of the hnRNPA2/B1/ERK/p53/HDM2 signaling pathway may be novel potential molecular targets for the treatment of patients with NSCLC.