Investigating Protein-Protein Interactions Between Grapevine Leafroll-Associated Virus 3 and Vitis vinifera.

Grapevine leafroll disease (GLD) is a globally important disease that affects the metabolic composition and biomass of grapes, leading to a reduction in grape yield and quality of wine produced. Grapevine leafroll-associated virus 3 (GLRaV-3) is the main causal agent for GLD. This study aimed to identify protein-protein interactions between GLRaV-3 and its host. A yeast two-hybrid (Y2H) library was constructed from Vitis vinifera mRNA and screened against GLRaV-3 open reading frames encoding structural proteins and those potentially involved in systemic spread and silencing of host defense mechanisms. Five interacting protein pairs were identified, three of which were demonstrated in planta. The minor coat protein of GLRaV-3 was shown to interact with 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase 02, a protein involved in primary carbohydrate metabolism and the biosynthesis of aromatic amino acids. Interactions were also identified between GLRaV-3 p20A and an 18.1-kDa class I small heat shock protein, as well as MAP3K epsilon protein kinase 1. Both proteins are involved in the response of plants to various stressors, including pathogen infections. Two additional proteins, chlorophyll a-b binding protein CP26 and a SMAX1-LIKE 6 protein, were identified as interacting with p20A in yeast but these interactions could not be demonstrated in planta. The findings of this study advance our understanding of the functions of GLRaV-3-encoded proteins and how the interaction between these proteins and those of V. vinifera could lead to GLD.

First report of Tomato spotted wilt orthotospovirus infecting agapanthus (Agapanthus praecox) in South Africa.

Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.

Utilisation of a mitochondrial intergenic region for species differentiation of fruit flies (Diptera: Tephritidae) in South Africa.

BACKGROUND: Fruit flies (Diptera: Tephritidae) comprise species of agricultural and economic importance. Five such fruit fly species are known to affect commercial fruit production and export in South Africa: Ceratitis capitata, Ceratitis cosyra, Ceratitis rosa, Ceratitis quilicii, and Bactrocera dorsalis. Management practices for these pests include monitoring, application of pest control products, post-harvest disinfestation measures and inspection of consignments both prior to shipment and at ports of entry. In activities relating to monitoring and inspection, accurate identification of these pests to species level is required. While morphological keys for adult stages of these fruit fly species have been well developed, morphological keys for earlier life stages remain problematic. In instances where closely related species cannot be reliably distinguished morphologically, there is a need for molecular tools to assist in identifying these five fruit fly species during surveillance practices, where sequencing-based approaches would be beneficial. RESULTS: Two complete mitochondrial genomes were assembled for each fruit fly species investigated using high throughput sequencing data generated in this study. A single primer set was designed to amplify a region between tRNAile and tRNAmet. The amplicon consists of a partial segment of tRNAile, intergenic region I (tRNAile - tRNAgln), the complete sequence of tRNAgln, intergenic region II (tRNAgln - tRNAmet), and a partial segment of tRNAmet. PCR amplicons were generated for 20 specimens of each species, five of which were colony adult males, five colony larvae, and 10 wild, trap-collected specimens. Upon analysis of the amplicon, intergenic region I was identified as the most informative region, allowing for unambiguous identification of the five fruit fly species. The similarity in intergenic region II was too high between C. rosa and C. quilicii for accurate differentiation of these species. CONCLUSION: The identity of all five fruit flies investigated in this study can be determined through sequence analysis of the mitochondrial intergenic regions. Within the target amplicon, intergenic region I (tRNAile - tRNAgln) shows interspecific variation sufficient for species differentiation based on multiple sequence alignment. The variation in the length of intergenic region I is proposed as a potential tool for accurately identifying these five fruit flies in South Africa.

A Review of the 'Candidatus Liberibacter africanus' Citrus Pathosystem in Africa.

It has been nearly 100 years since citrus growers in two distinct regions in the northern provinces of South Africa noticed unusual symptoms in their citrus trees, causing significant crop losses. They had no idea that these symptoms would later become part of an almost global pandemic of a disease called greening or huanglongbing (HLB). The rapid spread of the disease indicated that it might be caused by a transmissible pathogen, but it took >50 years to identify the causative agent as 'Candidatus Liberibacter africanus'. Recently, the disease appeared in more African countries, spreading by both infected planting material and Trioza erytreae. To date, five 'Ca. L. africanus' subspecies have been identified in various rutaceous species, with 'Ca. L. africanus subsp. clausenae' the only subspecies for which a biovar was detected in citrus. Efforts to detect and differentiate HLB-causing Liberibacter species are ongoing, and recent developments are discussed here. This review focuses on aspects of the African form of HLB, including its specific bacterial species and subspecies, its main insect vector, its geographic distribution, and current management strategies.

First report of the plum marbling disease associated agent, plum viroid I, in apricots (Prunus armeniaca) in South Africa.

Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.

Distribution and Genetic Diversity of Coguvirus eburi in South African Citrus and the Development of a Real-Time RT-PCR Assay for Citrus-Infecting Coguviruses.

Citrus virus A (CiVA), a novel negative-sense single-stranded RNA virus assigned to the species Coguvirus eburi in the genus Coguvirus, was detected in South Africa with the use of high-throughput sequencing after its initial discovery in Italy. CiVA is closely related to citrus concave gum-associated virus (CCGaV), recently assigned to the species Citrus coguvirus. Disease association with CiVA is, however, incomplete. CiVA was detected in grapefruit (C. paradisi Macf.), sweet orange [C. sinensis (L.) Osb.], and clementine (C. reticulata Blanco) in South Africa, and a survey to determine the distribution, symptom association, and genetic diversity was conducted in three provinces and seven citrus production regions. The virus was detected in 'Delta' Valencia trees in six citrus production regions, and a fruit rind symptom was often observed on CiVA-positive trees. Additionally, grapefruit showing symptoms of citrus impietratura disease were positive for CiVA. This virus was primarily detected in older orchards that were established prior to the application of shoot tip grafting for virus elimination in the South African Citrus Improvement Scheme. The three viral-encoded genes of CiVA isolates from each cultivar and region were sequenced to investigate sequence diversity. Genetic differences were detected between the Delta Valencia, grapefruit, and clementine samples, with greater sequence variation observed with the nucleocapsid protein (NP) compared with the RNA-dependent RNA polymerase (RdRp) and the movement protein (MP). A real-time detection assay, targeting the RdRp, was developed to simultaneously detect citrus-infecting coguviruses, CiVA and CCGaV, using a dual priming reverse primer to improve PCR specificity.

Monitoring Benzimidazole Resistance in Phyllosticta citricarpa Using a Molecular Assay Targeting Mutations in Codons 198 and 200 of the ß-Tubulin Gene.

Citrus black spot (CBS), caused by Phyllosticta citricarpa, is an economically important disease, which is effectively controlled by repeated fungicide applications to protect fruit from infection. Systemic fungicides such as benzimidazoles are widely used for controlling CBS in South Africa, but the molecular mechanisms of benzimidazole resistance in P. citricarpa had not been investigated. Analysis of the nucleotide sequence of the ß-tubulin gene in P. citricarpa revealed mutations inducing three amino acid replacements in benzimidazole-resistant isolates when compared with those of sensitive strains. Amino acid replacements in benzimidazole-resistant isolates included the change of glutamic acid to either alanine or lysine at codon 198 of the ß-tubulin gene and the change from phenylalanine to tyrosine at codon 200. All three mutations were previously implicated in benzimidazole resistance in several fungal pathogens. A PCR assay was designed to amplify a portion of the ß-tubulin gene, which is subsequently sequenced to identify benzimidazole resistance in P. citricarpa. This PCR and sequence assay was found to be a more rapid and reliable method for detecting resistance compared with the fungicide-amended plate tests and is valuable for monitoring the occurrence of benzimidazole-resistant P. citricarpa and for assessment of the need for alternative CBS management practices.

Towards the validation of high-throughput sequencing (HTS) for routine plant virus diagnostics: measurement of variation linked to HTS detection of citrus viruses and viroids.

BACKGROUND: High-throughput sequencing (HTS) has been applied successfully for virus and viroid discovery in many agricultural crops leading to the current drive to apply this technology in routine pathogen detection. The validation of HTS-based pathogen detection is therefore paramount. METHODS: Plant infections were established by graft inoculating a suite of viruses and viroids from established sources for further study. Four plants (one healthy plant and three infected) were sampled in triplicate and total RNA was extracted using two different methods (CTAB extraction protocol and the Zymo Research Quick-RNA Plant Miniprep Kit) and sent for Illumina HTS. One replicate sample of each plant for each RNA extraction method was also sent for HTS on an Ion Torrent platform. The data were evaluated for biological and technical variation focussing on RNA extraction method, platform used and bioinformatic analysis. RESULTS: The study evaluated the influence of different HTS protocols on the sensitivity, specificity and repeatability of HTS as a detection tool. Both extraction methods and sequencing platforms resulted in significant differences between the data sets. Using a de novo assembly approach, complemented with read mapping, the Illumina data allowed a greater proportion of the expected pathogen scaffolds to be inferred, and an accurate virome profile was constructed. The complete virome profile was also constructed using the Ion Torrent data but analyses showed that more sequencing depth is required to be comparative to the Illumina protocol and produce consistent results. The CTAB extraction protocol lowered the proportion of viroid sequences recovered with HTS, and the Zymo Research kit resulted in more variation in the read counts obtained per pathogen sequence. The expression profiles of reference genes were also investigated to assess the suitability of these genes as internal controls to allow for the comparison between samples across different protocols. CONCLUSIONS: This study highlights the need to measure the level of variation that can arise from the different variables of an HTS protocol, from sample preparation to data analysis. HTS is more comprehensive than any assay previously used, but with the necessary validations and standard operating procedures, the implementation of HTS as part of routine pathogen screening practices is possible.

Complete genome sequence of a grapevine Roditis leaf discoloration-associated virus (GRLDaV) variant from South Africa.

High-throughput sequencing (HTS) was used to construct the virome profile of an old grapevine-leafroll-diseased grapevine (Vitis vinifera). De novo assembly of HTS data showed a complex infection, including a virus sequence with similarity to viruses of the genus Badnavirus, family Caulimoviridae. The complete genome sequence of this virus consists of 7090 nucleotides and has four open reading frames (ORFs). Genome organisation and phylogenetic analysis identify this virus as a divergent variant of grapevine Roditis leaf discoloration-associated virus (GRLDaV) with 90% nucleotide sequence identity to isolate w4 (NC_027131). This is the first genome sequence of a South African variant of GRLDaV.

Genomic characterisation of a newly identified badnavirus infecting ivy (Hedera helix).

High-throughput sequencing (HTS) was used to investigate ringspots on ivy (Hedera helix) leaves. De novo assembly of HTS data generated from a total RNA extract from these leaves yielded a contig with sequence similarity to viruses of the genus Badnavirus, family Caulimoviridae. The complete genome sequence of this virus consists of 8,885 nucleotides and has three open reading frames (ORFs). Genome organisation and phylogenetic analysis identifies this newly identified virus as a new member of the genus Badnavirus for which we propose the name "ivy ringspot-associated virus" (IRSaV).

A Plum Marbling Conundrum: Identification of a New Viroid Associated with Marbling and Corky Flesh in Japanese Plums.

Over the past 2 decades, fruit symptoms resembling a marbling pattern on the fruit skin or corking of the fruit flesh were observed on Japanese plums in South Africa, resulting in unmarketable fruit. The ability of high-throughput sequencing (HTS) to detect known and unknown pathogens was exploited by assaying affected and unaffected fruit tree accessions to identify the potential aetiological agent of marbling and/or corky flesh disease. In this study, it is shown that the disease is associated with a previously undescribed small RNA with typical viroid structural features. The potential viroid was the only pathological agent consistently detected in all symptomatic trees by HTS, and the association with the symptoms was confirmed in field surveys over two seasons. To date, this RNA was not detectable by RT-PCR in seedlings raised from seeds collected from infected trees. Although the autonomous replication of this viroid-like RNA was not proven, it was shown to be transmissible by grafting and associated with a range of symptoms that include marbling on the fruit skin, corky flesh, reduced fruit size, irregular shape, and uneven fruit surface depending on the cultivar. Moreover, the circular RNA genome, consisting of 317 nucleotides, strongly supports that this viroid-like RNA is most likely a viroid for which the name plum viroid I (PVd-I) is proposed. The primary structure of this viroid showed a less than 90% nucleotide sequence identity to viroids of the genus Apscaviroid, with which it has close phylogenetic relationships and shares conserved structural motifs.

Citrus Tristeza Virus Isolates of the Same Genotype Differ in Stem Pitting Severity in Grapefruit.

Two isolates of the T68 genotype of citrus tristeza virus (CTV) were derived from a common source, GFMS12, by single aphid transmission. These isolates, named GFMS12-8 and GFMS12-1.3, induced stem pitting with differing severity in 'Duncan' grapefruit (Citrus × paradisi [Macfad.]). Full-genome sequencing of these isolates showed only minor nucleotide sequence differences totaling 45 polymorphisms. Numerous nucleotide changes, in relatively close proximity, were detected in the p33 open reading frame (ORF) and the leader protease domains of ORF1a. This is the first report of full-genome characterization of CTV isolates of a single genotype, derived from the same source, but showing differences in pathogenicity. The results demonstrate the development of intragenotype heterogeneity known to occur with single-stranded RNA viruses. Identification of genetic variability between isolates showing different pathogenicity will enable interrogation of specific genome regions for potential stem pitting determinants.

First report of 'Candidatus Liberibacter africanus' associated with African Greening of Citrus in Angola.

Huanglongbing (HLB, Asian Citrus Greening), the most devastating disease of citrus has not been detected in southern Africa (Gottwald, 2010). HLB is associated with 'Candidatus Liberibacter asiaticus' (CLas), a phloem-limited bacterium vectored by Diaphorina citri Kuwayama (Hemiptera: Liviidae), the Asian Citrus Psyllid (ACP). African Citrus Greening, associated with 'Candidatus Liberibacter africanus' (CLaf) and its vector the African Citrus Triozid, Trioza erytreae (Del Guercio) (Hemiptera: Triozidae), are endemic to Africa, although not previously reported from Angola. African Greening is less severe than HLB, largely due to heat sensitivity of CLaf and its vector. Introduction of HLB into southern Africa would be devastating to citrus production in commercial and informal sectors. Concern was raised that CLas or ACP might hae inadvertently been introduced into Angola. In July 2019, a survey was conducted in two citrus nurseries in Luanda and Caxito and in different orchards on 7 farms surrounding Calulo and Quibala. Yellow sticky traps for insects were placed at the various localities and collected after c. 3 weeks. Breeding signs of T. erytreae (pit galls) were observed on citrus in some locations, but no insect vectors were detected on traps. Trees were inspected for signs and symptoms of citrus pests and diseases, particularly those that resemble HLB (foliar blotchy mottle, shoot chlorosis, vein yellowing and corking, lopsided fruit with aborted seeds and colour inversion) and its vectors (pit galls on leaves or waxy exudates). Leaves and shoots with suspect symptoms were sampled for laboratory analysis (43 samples). DNA was extracted from petiole and midrib tissue of leaves using a modified CTAB extraction protocol of Doyle and Doyle (1990). Real-time PCR was done using universal Liberibacter primers of Roberts et al. (2015), CLaf specific primers of Li et al. (2006) and CLas specific primers of Bao et al. (2019). All real-time PCR protocols indicated the presence of CLaf in 6 samples (Tab. S1). CLas or other citrus Liberibacter species were not detected. The presence of CLaf in sample 37 was confirmed by constructing a library (NEXTFLEX® DNA Sequencing Kit, PerkinElmer) with extracted DNA and performing high-throughput sequencing on an Ion Torrent™ S5™ platform (Central Analytical Facility, Stellenbosch University). To improve the quality of the reads, all 233,617,700 obtained reads were trimmed from the 3' end to a maximum length of 240 nt using Trimmomatic (Bolger et al. 2014). The high quality reads were mapped to the Citrus sinensis reference genome (NC_023046.1) using Bowtie 2.3.4 (Langmead and Salzberg 2012) to subtract all the reads that had high identity to the host plant (number of mismatches allowed in the seed was set to 1). The 14,691,369 unmapped reads (6.2% of original data) were mapped to the CLaf reference genome NZ_CP004021.1 using CLC Genomics Workbench 10.1.1 (Qiagen) (Length fraction = 0.8; Similarity fraction = 0.9). A CLaf consensus genome was generated that spanned 99.7% of the reference genome and the 163001 mapped reads had a 22.9 mean read coverage. The consensus sequence was 99.7% identical to NZ_CP004021.1 and was submitted to Genbank as accession: CP054879. The positive CLaf detections were from trees with typical HLB or African Citrus Greening symptoms, viz. lopsided fruit with green stylar ends, aborted seed and stained columella at base of fruit button; yellow shoots with leaves showing symptoms of blotchy mottle and vein yellowing and corking (Fig. S1) in a commercial citrus farm outside Calulo and included 2 'Ponkan' mandarin (C. reticulata), 2 Valencia and 1 'Navelina' tree (C. sinensis), and a citrus nursery in Luanda (1 lime tree; C. aurantifolia) (Tab. S1). This first report of CLaf in Angola highlights the need to prevent spread by removing infected trees and managing the insect vector, as well as the need for further surveys to determine the occurrence of African Greening and its vectors in other provinces and to confirm the absence of exotic citrus pests and diseases. References Bao, M. et al. 2020. Plant Dis. 104:527 Bolger, A. M. et al. 2014. Bioinformatics. 30:2114-2120. Doyle, J.J. and Doyle, J.L. 1990. Focus 12:13 Gottwald, T.R. 2010. Annu. Rev. Phytopathol. 48:119 Langmead, B. and Salzberg, S. 2012. Nature Methods. 9:357-359. Li, W. et al. 2006. Jnl. Microbiol. Methods 66:104 Roberts, R. et al. 2015. Int. J. Syst. Evol. Micr. 65:723.

Differential expression of miRNAs and associated gene targets in grapevine leafroll-associated virus 3-infected plants.

MicroRNAs (miRNAs) are a class of endogenous small non-coding RNAs (sRNA) that play an essential role in the regulation of target mRNAs expressed during plant development and in response to stress. MicroRNA expression profiling has helped to identify miRNAs that regulate a range of processes, including the plant's defence response to pathogens. In this study, differential miRNA expression in own-rooted Vitis vinifera cv. Cabernet Sauvignon plants infected with grapevine leafroll-associated virus 3 was investigated with microarrays and next-generation sequencing (NGS) of sRNA and mRNA. These high-throughput approaches identified several differentially expressed miRNAs. Four miRNAs, identified by both approaches, were validated by stemloop RT-PCRs. Three of the predicted targets of the differentially expressed miRNAs were also differentially expressed in the transcriptome data of infected plants, and were validated by RT-qPCR. Identification of these miRNAs and their targets can lead to a better understanding of host-pathogen interactions involved in grapevine leafroll disease and the identification of possible targets for virus resistance.

Harbin: a quantitation PCR analysis tool.

OBJECTIVES: To enable analysis and comparisons of different relative quantitation experiments, a web-browser application called Harbin was created that uses a quantile-based scoring system for the comparison of samples at different time points and between experiments. RESULTS: Harbin uses the standard curve method for relative quantitation to calculate concentration ratios (CRs). To evaluate if different datasets can be combined the Harbin quantile bootstrap test is proposed. This test is more sensitive in detecting distributional differences between data sets than the Kolmogorov-Smirnov test. The utility of the test is demonstrated in a comparison of three grapevine leafroll associated virus 3 (GLRaV-3) RT-qPCR data sets. CONCLUSIONS: The quantile-based scoring system of CRs will enable the monitoring of virus titre or gene expression over different time points and be useful in other genomic applications where the combining of data sets are required.

Next-generation sequencing for virus detection: covering all the bases.

BACKGROUND: The use of next-generation sequencing has become an established method for virus detection. Efficient study design for accurate detection relies on the optimal amount of data representing a significant portion of a virus genome. FINDINGS: In this study, genome coverage at different sequencing depths was determined for a number of viruses, viroids, hosts and sequencing library types, using both read-mapping and de novo assembly-based approaches. The results highlighted the strength of ribo-depleted RNA and sRNA in obtaining saturated genome coverage with the least amount of data, while even though the poly(A)-selected RNA yielded virus-derived reads, it was insufficient to cover the complete genome of a non-polyadenylated virus. The ribo-depleted RNA data also outperformed the sRNA data in terms of the percentage of coverage that could be obtained particularly with the de novo assembled contigs. CONCLUSION: Our results suggest the use of ribo-depleted RNA in a de novo assembly-based approach for the detection of single-stranded RNA viruses. Furthermore, we suggest that sequencing one million reads will provide sufficient genome coverage specifically for closterovirus detection.

Validation of High-Throughput Sequencing (HTS) for Routine Detection of Citrus Viruses and Viroids.

The management of plant diseases relies on the accurate identification of pathogens that requires a robust and validated tool in terms of specificity, sensitivity, repeatability, and reproducibility. High-throughput sequencing (HTS) has become the method of choice for virus detection when either a complete viral status of a plant is required in a single assay or if an unknown viral agent is expected. To ensure that the most accurate diagnosis is made from an HTS data analysis, a standardized protocol per pathosystem is required. This chapter presents a detailed protocol for the detection of viruses and viroids infecting citrus using HTS. The protocol describes all the steps from sample processing, nucleic acid extraction, and bioinformatic analyses validated to be an efficient method for detection in this pathosystem. The protocol also includes a section on citrus tristeza virus (CTV) genotype differentiation using HTS data.

Identification of Interactions between Proteins Encoded by Grapevine Leafroll-Associated Virus 3.

The roles of proteins encoded by members of the genus Ampelovirus, family Closteroviridae are largely inferred by sequence homology or analogy to similarly located ORFs in related viruses. This study employed yeast two-hybrid and bimolecular fluorescence complementation assays to investigate interactions between proteins of grapevine leafroll-associated virus 3 (GLRaV-3). The p5 movement protein, HSP70 homolog, coat protein, and p20B of GLRaV-3 were all found to self-interact, however, the mechanism by which p5 interacts remains unknown due to the absence of a cysteine residue crucial for the dimerisation of the closterovirus homolog of this protein. Although HSP70h forms part of the virion head of closteroviruses, in GLRaV-3, it interacts with the coat protein that makes up the body of the virion. Silencing suppressor p20B has been shown to interact with HSP70h, as well as the major coat protein and the minor coat protein. The results of this study suggest that the virion assembly of a member of the genus Ampelovirus occurs in a similar but not identical manner to those of other genera in the family Closteroviridae. Identification of interactions of p20B with virus structural proteins provides an avenue for future research to explore the mechanisms behind the suppression of host silencing and suggests possible involvement in other aspects of the viral replication cycle.

The metabolic recovery of marathon runners: an untargeted 1H-NMR metabolomics perspective.

Introduction: Extreme endurance events may result in numerous adverse metabolic, immunologic, and physiological perturbations that may diminish athletic performance and adversely affect the overall health status of an athlete, especially in the absence of sufficient recovery. A comprehensive understanding of the post-marathon recovering metabolome, may aid in the identification of new biomarkers associated with marathon-induced stress, recovery, and adaptation, which can facilitate the development of improved training and recovery programs and personalized monitoring of athletic health/recovery/performance. Nevertheless, an untargeted, multi-disciplinary elucidation of the complex underlying biochemical mechanisms involved in recovery after such an endurance event is yet to be demonstrated. Methods: This investigation employed an untargeted proton nuclear magnetic resonance metabolomics approach to characterize the post-marathon recovering metabolome by systematically comparing the pre-, immediately post, 24, and 48 h post-marathon serum metabolite profiles of 15 athletes. Results and Discussion: A total of 26 metabolites were identified to fluctuate significantly among post-marathon and recovery time points and were mainly attributed to the recovery of adenosine triphosphate, redox balance and glycogen stores, amino acid oxidation, changes to gut microbiota, and energy drink consumption during the post-marathon recovery phase. Additionally, metabolites associated with delayed-onset muscle soreness were observed; however, the mechanisms underlying this commonly reported phenomenon remain to be elucidated. Although complete metabolic recovery of the energy-producing pathways and fuel substrate stores was attained within the 48 h recovery period, several metabolites remained perturbed throughout the 48 h recovery period and/or fluctuated again following their initial recovery to pre-marathon-related levels.

Detection of single nucleotide polymorphisms in virus genomes assembled from high-throughput sequencing data: large-scale performance testing of sequence analysis strategies.

Recent developments in high-throughput sequencing (HTS) technologies and bioinformatics have drastically changed research in virology, especially for virus discovery. Indeed, proper monitoring of the viral population requires information on the different isolates circulating in the studied area. For this purpose, HTS has greatly facilitated the sequencing of new genomes of detected viruses and their comparison. However, bioinformatics analyses allowing reconstruction of genome sequences and detection of single nucleotide polymorphisms (SNPs) can potentially create bias and has not been widely addressed so far. Therefore, more knowledge is required on the limitations of predicting SNPs based on HTS-generated sequence samples. To address this issue, we compared the ability of 14 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 21 variants of pepino mosaic virus (PepMV) in three samples through large-scale performance testing (PT) using three artificially designed datasets. To evaluate the impact of bioinformatics analyses, they were divided into three key steps: reads pre-processing, virus-isolate identification, and variant calling. Each step was evaluated independently through an original, PT design including discussion and validation between participants at each step. Overall, this work underlines key parameters influencing SNPs detection and proposes recommendations for reliable variant calling for plant viruses. The identification of the closest reference, mapping parameters and manual validation of the detection were recognized as the most impactful analysis steps for the success of the SNPs detections. Strategies to improve the prediction of SNPs are also discussed.