Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 24
Filter
Add more filters

Country/Region as subject
Publication year range
1.
J Fish Biol ; 105(1): 239-253, 2024 Jul.
Article in English | MEDLINE | ID: mdl-38712539

ABSTRACT

The hemicultrine fishes are a group of small-sized cyprinids, widely distributed but endemic to East Asian rivers and lakes. Till now, the taxonomic boundaries and relationships within this group remain poorly explored. In the present study, we study the phylogeny of this group, providing suggestions for classification of the hemicultrine group. Using two mitochondrial and three nuclear genes, and samples representing all genera, our results showed that the group consists of seven major lineages, of which four (Hemiculterella, Hainania, Pseudolaubuca, and Anabarilius) were monophyletic and three (Hemiculter, Toxabramis, and Pseudohemiculter) were not. Based on the phylogenetic tree, we redefined the genera. We revive the genus Siniichthys, which has three species, Siniichthys bleekeri, Siniichthys lucidus, and S. varpachovskii, that were previously treated as members of the genus Hemiculter but showed distant relationships to the genus Hemiculter in our phylogenetic tree. With the new results, a diagnostic key for clades of the hemicultrine group is provided. Furthermore, we provide more detailed information on diagnostic features of the recently described species Hemiculter yungaoi (Vasil'eva et al., 2022). This work will facilitate future systematic studies, pave the way for evolutionary studies, and provide valuable information for the urgent conservation of hemicultrine fishes.


Subject(s)
Cyprinidae , Phylogeny , Animals , Cell Nucleus/genetics , Cyprinidae/genetics , Cyprinidae/classification , Cyprinidae/anatomy & histology
2.
Wei Sheng Yan Jiu ; 53(3): 465-471, 2024 May.
Article in Zh | MEDLINE | ID: mdl-38839589

ABSTRACT

OBJECTIVE: Optimization of the extraction process of total flavonoids from Morus nigra Linn. based on response surface design, to compare the differences in total flavonoid content of Morus nigra Linn. from different origins in Xinjiang and its relationship with antioxidant activity. METHODS: A one-way test was used to investigate the effects of ethanol volume fraction, material-liquid ratio, ultrasonic power and ultrasonic time on total flavonoid content analysis of Morus nigra Linn. , Box-Behnken response surface design optimisation was used to derive the optimal extraction process parameters. Meanwhile, the in vitro antioxidant activity of Morus nigra Linn. was evaluated by antioxidant activity indexes such as hydroxyl radical scavenging capacity and ferric ion reducing capacity. RESULTS: The optimal extraction condition was 45% ethanol by volume, 1∶20 g/mL material-liquid ratio, 300W ultrasound power and 60 min ultrasound time. The total flavonoid content of Morus nigra Linn. s from six origins was detected and the result showed that Kuche >Kashgar >Kuche Wuqia Town>Hetian >Ying jisha >Yutian, in which the total flavonoid content of mulberry in Kucha city was(27.159±0.091)mg/g. The difference in the total flavonoid content of Morus nigra Linn. s in different origicns was statistically significant(P<0.05). In vitro antioxidant activity analysis showed that the antioxidant activity of mulberry from Kuche and Hetian was stronger, and the hydroxyl radical scavenging capacity, ferric ion reducing capacity, and total antioxidant capacity of mulberry from various origins were statistically significant(P<0.05). The correlation analysis showed that the total flavonoid content of Morus nigra Linn. was correlated with the antioxidant capacity to improve the scavenging of hydroxyl radicals. CONCLUSION: The ultrasonic-assisted method of extracting total flavonoids from Morus nigra Linn. is simple, and the model constructed has a high degree of fit, which can better compare the total flavonoids content of Morus nigra Linn. from different origins in Xinjiang.


Subject(s)
Antioxidants , Flavonoids , Morus , Morus/chemistry , Flavonoids/analysis , Antioxidants/analysis , China
3.
Int J Mol Sci ; 24(23)2023 Nov 21.
Article in English | MEDLINE | ID: mdl-38068885

ABSTRACT

Carotenoids are important pigments in pepper fruits. The colors of each pepper are mainly determined by the composition and content of carotenoid. The 'ZY' variety, which has yellow fruit, is a natural mutant derived from a branch mutant of 'ZR' with different colors. ZY and ZR exhibit obvious differences in fruit color, but no other obvious differences in other traits. To investigate the main reasons for the formation of different colored pepper fruits, transcriptome and metabolome analyses were performed in three developmental stages (S1-S3) in two cultivars. The results revealed that these structural genes (PSY1, CRTISO, CCD1, CYP97C1, VDE1, CCS, NCED1 and NCED2) related to carotenoid biosynthesis were expressed differentially in the two cultivars. Capsanthin and capsorubin mainly accumulated in ZR and were almost non-existent in ZY. S2 is the fruit color-changing stage; this may be a critical period for the development of different color formation of ZY and ZR. A combination of transcriptome and metabolome analyses indicated that CCS, NCED2, AAO4, VDE1 and CYP97C1 genes were key to the differences in the total carotenoid content. These new insights into pepper fruit coloration may help to improve fruit breeding strategies.


Subject(s)
Carotenoids , Plant Breeding , Carotenoids/metabolism , Gene Expression Profiling , Fruit/metabolism , Transcriptome , Metabolome , Gene Expression Regulation, Plant
4.
J Clin Lab Anal ; 36(7): e24534, 2022 Jul.
Article in English | MEDLINE | ID: mdl-35657146

ABSTRACT

BACKGROUND: The Coronavirus Disease 2019 (COVID-19) is caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which has now become a global pandemic owing to its high transmissibility. The SARS-CoV-2 nucleocapsid protein tests are playing an important role in screening and diagnosing patients with COVID-19, and studies about the utility of SARS-CoV-2 nucleocapsid protein tests are increasing now. METHODS: In this review, all the relevant original studies were assessed by searching in electronic databases including Scopus, Pubmed, Embase, and Web of Science. "SARS-CoV-2", "COVID-19", "nucleocapsid protein", and "antigen detection" were used as keywords. RESULTS: In this review, we summarized the utility of SARS-CoV-2 nucleocapsid protein in laboratory diagnosis. Among the representative researches, this review analyzed, the sensitivity of SARS-CoV-2 nucleocapsid protein detection varies from 13% to 87.9%, while the specificity could almost reach 100% in most studies. As a matter of fact, the sensitivity is around 50% and could be higher or lower due to the influential factors. CONCLUSION: It is well suggested that SARS-CoV-2 nucleocapsid protein is a convenient method with a short turnaround time of about half an hour, and the presence of N antigen is positively related to viral transmissibility, indicating that SARS-CoV-2 N protein immunoassays contribute to finding out those infected people rapidly and segregating them from the uninfected people.


Subject(s)
COVID-19 , SARS-CoV-2 , Antibodies, Viral , COVID-19/diagnosis , COVID-19 Testing , Clinical Laboratory Techniques/methods , Humans , Nucleocapsid , Sensitivity and Specificity
5.
J Med Virol ; 92(7): 833-840, 2020 07.
Article in English | MEDLINE | ID: mdl-32243607

ABSTRACT

In December 2019, coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), emerged in Wuhan, China, and has spread globally. However, the transmission route of SARS-CoV-2 has not been fully understood. In this study, we aimed to investigate SARS-CoV-2 shedding in the excreta of COVID-19 patients. Electronical medical records, including demographics, clinical characteristics, laboratory and radiological findings of enrolled patients were extracted and analyzed. Pharyngeal swab, stool, and urine specimens were collected and tested for SARS-CoV-2 RNA by real-time reverse transcription polymerase chain reaction. Viral shedding at multiple time points in specimens was recorded, and its correlation analyzed with clinical manifestations and the severity of illness. A total of 42 laboratory-confirmed patients were enrolled, 8 (19.05%) of whom had gastrointestinal symptoms. A total of 28 (66.67%) patients tested positive for SARS-CoV-2 RNA in stool specimens, and this was not associated with the presence of gastrointestinal symptoms and the severity of illness. Among them, 18 (64.29%) patients remained positive for viral RNA in the feces after the pharyngeal swabs turned negative. The duration of viral shedding from the feces after negative conversion in pharyngeal swabs was 7 (6-10) days, regardless of COVID-19 severity. The demographics, clinical characteristics, laboratory and radiologic findings did not differ between patients who tested positive and negative for SARS-CoV-2 RNA in the feces. Viral RNA was not detectable in urine specimens from 10 patients. Our results demonstrated the presence of SARS-CoV-2 RNA in the feces of COVID-19 patients and suggested the possibility of SARS-CoV-2 transmission via the fecal-oral route.


Subject(s)
Betacoronavirus/pathogenicity , Coronavirus Infections/epidemiology , Coronavirus Infections/transmission , Disease Outbreaks , Pneumonia, Viral/epidemiology , Pneumonia, Viral/transmission , RNA, Viral/isolation & purification , Virus Shedding , Adult , COVID-19 , China/epidemiology , Coronavirus Infections/diagnosis , Electronic Health Records , Feces/virology , Female , Humans , Male , Middle Aged , Pandemics , Pharynx/virology , Pneumonia, Viral/diagnosis , RNA, Viral/genetics , Retrospective Studies , SARS-CoV-2 , Severity of Illness Index
6.
Bioorg Med Chem Lett ; 30(23): 127510, 2020 12 01.
Article in English | MEDLINE | ID: mdl-32898693

ABSTRACT

Here, we report the discovery of a new class of NPBWR1 antagonists identified from a fragment-based screen. Compound 1 (cAMP IC50 = 250 µM; LE = 0.29) emerged as an initial hit. Further optimization of 1 by SAR-by-catalogue and chemical modification produced 21a (cAMP IC50 = 30 nM; LE = 0.39) with a 6700-fold increase in potency from fragment 1. Somewhat surprisingly, Schild analysis of compound 21a suggested that in vitro inhibition of NPW-mediated effects on upon cAMP accumulation were saturable, and that compound 21a dose-dependently increased [125I]-hNPW23 dissociation rate constants from NPBWR1 in kinetic binding studies. Collectively, these data are inconsistent with a classic surmountable, orthosteric mechanism of inhibition. The benzimidazole inhibitors reported herein may therefore represent a mechanistically differentiated class of compounds with which to form a better appreciation of the pharmacology and physiological roles of this central neuropeptide system.


Subject(s)
Benzimidazoles/pharmacology , Receptors, G-Protein-Coupled/antagonists & inhibitors , Receptors, Neuropeptide/antagonists & inhibitors , Animals , Benzimidazoles/chemical synthesis , CHO Cells , Cricetulus , Drug Discovery , Humans , Molecular Structure , Structure-Activity Relationship
7.
Cochrane Database Syst Rev ; 9: CD012367, 2019 09 18.
Article in English | MEDLINE | ID: mdl-31532563

ABSTRACT

BACKGROUND: In children, functional daytime urinary incontinence is the term used to describe any leakage of urine while awake that is not the result of a known underlying neurological or congenital anatomic cause (such as conditions or injuries that affect the nerves that control the bladder or problems with the way the urinary system is formed). It can result in practical difficulties for both the child and their family and can have detrimental effects on a child's well-being, education and social engagement. OBJECTIVES: To assess the effects of conservative interventions for treating functional daytime urinary incontinence in children. SEARCH METHODS: We searched the Cochrane Incontinence Specialised Register, which contains studies identified from CENTRAL, MEDLINE, MEDLINE In-Process, MEDLINE Epub Ahead of Print, CINAHL, ClinicalTrials.gov, WHO ICTRP and handsearching of journals and conference proceedings (searched 11 September 2018). We also searched Chinese language bibliographic databases: Chinese Biomedical Literature Database (CBM), China National Knowledge Infrastructure (CNKI), and Wanfang. No language restrictions were imposed. SELECTION CRITERIA: We included randomised controlled trials (RCTs), quasi-randomised, multi-arm studies, cross-over studies and cluster-randomised studies that included children aged between 5 and 18 years with functional daytime urinary incontinence. DATA COLLECTION AND ANALYSIS: Two review authors independently screened records and determined the eligibility of studies for inclusion according to predefined criteria. Where data from the study were not provided, we contacted the study authors to request further information. Two review authors assessed risk of bias and processed included study data as described in the Cochrane Handbook for Systematic Reviews of Interventions. Where meta-analysis was possible, we applied random-effects meta-analysis using the Mantel-Haenszel method for dichotomous outcomes. MAIN RESULTS: The review included 27 RCTs involving 1803 children. Of these, six were multi-arm and one was also a cross-over study. Most studies were small, with numbers randomised ranging from 16 to 202. A total of 19 studies were at high risk of bias for at least one domain. Few studies reported data suitable for pooling due to heterogeneity in interventions, outcomes and measurements.Individual conservative interventions (lifestyle, behavioural or physical) versus no treatmentTranscutaneous electrical nerve stimulation (TENS) versus sham (placebo) TENS. More children receiving active TENS may achieve continence (risk ratio (RR) 4.89, 95% confidence interval (CI) 1.68 to 14.21; 3 studies; n = 93; low-certainty evidence).One individual conservative intervention versus another individual or combined conservative interventionPelvic floor muscle training (PFMT) with urotherapy versus urotherapy alone. We are uncertain whether more children receiving PFMT with urotherapy achieve continence (RR 2.36, 95% CI 0.65 to 8.53, 95% CI 25 to 100; 3 studies; n = 91; very low-certainty evidence).Voiding education with uroflowmetry feedback and urotherapy versus urotherapy alone. Slightly more children receiving voiding education with uroflow feedback and urotherapy may achieve continence (RR 1.13, 95% CI 0.87 to 1.45; 3 studies; n = 151; low-certainty evidence).Urotherapy with timer watch versus urotherapy alone. We are uncertain whether urotherapy plus timer watch increases the number of children achieving continence compared to urotherapy alone (RR 1.42, 95% CI 1.12 to 1.80; 1 study; n = 58; very low-certainty evidence).Combined conservative interventions versus other combined conservative interventionsTENS and standard urotherapy versus PFMT with electromyographic biofeedback and standard urotherapy. We are uncertain whether there is any evidence of a difference between treatment groups in the proportions of children achieving continence (RR 1.11, 95% CI 0.73 to 1.68; 1 study; n = 78; very low-certainty evidence).PFMT with electromyography biofeedback and standard urotherapy versus PFMT without feedback but with standard urotherapy. We are uncertain whether there is any evidence of a difference between treatment groups in the proportions of children achieving continence (RR 1.05, 95% CI 0.72 to 1.52; 1 study; n = 41; very low-certainty evidence).Individual conservative interventions versus non-conservative interventions (pharmacological or invasive, combined or not with any conservative interventions)PFMT versus anticholinergics. We are uncertain whether more children receiving PFMT than anticholinergics achieve continence (RR 1.92, 95% CI 1.17 to 3.15; equivalent to an increase from 33 to 64 per 100 children; 2 studies; n = 86; very low-certainty evidence).TENS versus anticholinergics. We are uncertain whether there was any evidence of a difference between treatment groups in the proportions of children achieving continence (RR 0.81, 95% CI 0.05 to 12.50; 2 studies; n = 72; very low-certainty evidence).Combined conservative interventions versus non-conservative interventions (pharmacological or invasive, combined or not with any conservative interventions)Voiding education with uroflowmetry feedback versus anticholinergics. We are uncertain whether there was any evidence of a difference between treatment groups in the proportion of children achieving continence (RR 1.02, 95% CI 0.58 to 1.78; 1 study; n = 64; very low-certainty evidence). AUTHORS' CONCLUSIONS: The review found little reliable evidence that can help affected children, their carers and the clinicians working with them to make evidence-based treatment decisions. In this scenario, the clinical experience of individual clinicians and the support of carers may be the most valuable resources. More well-designed research, with well-defined interventions and consistent outcome measurement, is needed.


Subject(s)
Biofeedback, Psychology , Diurnal Enuresis/therapy , Quality of Life , Urinary Incontinence/therapy , Adolescent , Child , Child, Preschool , Electric Stimulation Therapy/methods , Exercise Therapy/methods , Humans , Randomized Controlled Trials as Topic , Urinary Incontinence, Stress/therapy
9.
Behav Sci (Basel) ; 14(7)2024 Jul 12.
Article in English | MEDLINE | ID: mdl-39062416

ABSTRACT

Live video-streamed teaching platforms are widely used in language teaching. However, how students perceive these platforms has scarcely been investigated. By adopting the Technology Acceptance Model (TAM), this study investigated Chinese secondary school students' perceptions of the platforms (i.e., Tencent meeting, Tencent classroom and Dingtalk) being adopted in English as a foreign language (EFL) class. Gender and age differences were also investigated. Data were collected from 602 students; the results showed the following: (1) The acceptance level of all the participants was high for the five variables in TAM, i.e., perceived ease of use (PEU), perceived usefulness (PU), attitude (ATT), computer self-efficacy (CSE) and behavioral intention to use (BI), but with significant individual differences. There existed no gender differences, while age differences existed between junior high school students and those from senior high school. (2) The five variables were correlated with each other significantly. In addition, CSE, PEU, PU and ATT can predict BI in parallel. (3) The relationship between CSE and BI was mediated by PEU, PU and ATT. Also, PU had the strongest mediating effect, with PEU and ATT exerting slightly lower effects. The theoretical and practical implications are discussed at the end.

10.
Genome Biol Evol ; 16(7)2024 Jul 03.
Article in English | MEDLINE | ID: mdl-38918882

ABSTRACT

The European sprat is a small plankton-feeding clupeid present in the northeastern Atlantic Ocean, in the Mediterranean Sea, and in the brackish Baltic Sea and Black Sea. This species is the target of a major fishery and, therefore, an accurate characterization of its genetic population structure is crucial to delineate proper stock assessments that aid ensuring the fishery's sustainability. Here, we present (i) a draft genome assembly, (ii) pooled whole genome sequencing of 19 population samples covering most of the species' distribution range, and (iii) the design and test of a single nucleotide polymorphism (SNP)-chip resource and use this to validate the population structure inferred from pooled sequencing. These approaches revealed, using the populations sampled here, three major groups of European sprat: Oceanic, Coastal, and Brackish with limited differentiation within groups even over wide geographical stretches. Genetic structure is largely driven by six large putative inversions that differentiate Oceanic and Brackish sprats, while Coastal populations display intermediate frequencies of haplotypes at each locus. Interestingly, populations from the Baltic and the Black Seas share similar frequencies of haplotypes at these putative inversions despite their distant geographic location. The closely related clupeids European sprat and Atlantic herring both show genetic adaptation to the brackish Baltic Sea, providing an opportunity to explore the extent of genetic parallelism. This analysis revealed limited parallelism because out of 125 independent loci detected in the Atlantic herring, three showed sharp signals of selection that overlapped between the two species and contained single genes such as PRLRA, which encodes the receptor for prolactin, a freshwater-adapting hormone in euryhaline species, and THRB, a receptor for thyroid hormones, important both for metabolic regulation and the development of red cone photoreceptors.


Subject(s)
Fishes , Polymorphism, Single Nucleotide , Animals , Fishes/genetics , Atlantic Ocean , Adaptation, Physiological/genetics , Saline Waters
11.
J Vis Exp ; (194)2023 04 14.
Article in English | MEDLINE | ID: mdl-37125807

ABSTRACT

Tongue diagnosis is an essential technique of traditional Chinese medicine (TCM) diagnosis, and the need for objectifying tongue images through image processing technology is growing. The present study provides an overview of the progress made in tongue objectification over the past decade and compares segmentation models. Various deep learning models are constructed to verify and compare algorithms using real tongue image sets. The strengths and weaknesses of each model are analyzed. The findings indicate that the U-Net algorithm outperforms other models regarding precision accuracy (PA), recall, and mean intersection over union (MIoU) metrics. However, despite the significant progress in tongue image acquisition and processing, a uniform standard for objectifying tongue diagnosis has yet to be established. To facilitate the widespread application of tongue images captured using mobile devices in tongue diagnosis objectification, further research could address the challenges posed by tongue images captured in complex environments.


Subject(s)
Algorithms , Tongue , Medicine, Chinese Traditional/methods , Image Processing, Computer-Assisted/methods , Data Analysis
12.
Ann Transl Med ; 10(10): 603, 2022 May.
Article in English | MEDLINE | ID: mdl-35722368

ABSTRACT

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

13.
Front Med (Lausanne) ; 8: 676560, 2021.
Article in English | MEDLINE | ID: mdl-34336884

ABSTRACT

Objectives: COVID-19 emerged and rapidly spread throughout the world. Testing strategies focussing on patients with COVID-19 require assays that are high-throughput, low-risk of infection, and with small sample volumes. Antigen surveillance can be used to identify exposure to pathogens and measure acute infections. Methods: A total of 914 serum samples, collected from 309 currently infected COVID-19 patients, 48 recovered ones, and 410 non-COVID-19 patients, were used to measure N protein antigen levels by a chemilumineseent immunoassay. Diagnostic performances were analyzed in different periods after onset. Results: There was a high level of N protein antigen in COVID-19 patients (0.56 COI), comparing to the recovered patients (0.12 COI) and controls (0.19 COI). In receiver-operating characteristic curve analysis, the area under the curve of serum N protein antigen was 0.911 in the first week after onset. In this period, Sensitivity and specificity of serologic N protein antigen testing was 76.27 and 98.78%. Diagnosis performance of specific antibodies became better from the third week after onset. Subgroup analysis suggested that severe patients had higher levels of antigens than mild patients. Conclusions: High level of serum antigen suggested early infection and serious illness. Serum N protein antigen testing by chemiluminescence immunoassay is considered as a viable assay used to improve diagnostic sensitivity for current patients.

14.
Phys Med Biol ; 66(11)2021 05 28.
Article in English | MEDLINE | ID: mdl-33910173

ABSTRACT

Three-dimensional (3D) vessel segmentation can provide full spatial information about an anatomic structure to help physicians gain increased understanding of vascular structures, which plays an utmost role in many medical image-processing and analysis applications. The purpose of this paper aims to develop a 3D vessel-segmentation method that can improve segmentation accuracy in 3D ultrasound (US) images. We propose a 3D tensor-based active contour model method for accurate 3D vessel segmentation. With our method, the contrast-independent multiscale bottom-hat tensor representation and local-global information are captured. This strategy ensures the effective extraction of the boundaries of vessels from inhomogeneous and homogeneous regions without being affected by the noise and low-contrast of the 3D US images. Experimental results in clinical 3D US and public 3D Multiphoton Microscopy datasets are used for quantitative and qualitative comparison with several state-of-the-art vessel segmentation methods. Clinical experiments demonstrate that our method can achieve a smoother and more accurate boundary of the vessel object than competing methods. The mean SE, SP and ACC of the proposed method are: 0.7768 ± 0.0597, 0.9978 ± 0.0013 and 0.9971 ± 0.0015 respectively. Experiments on the public dataset show that our method can segment complex vessels in different medical images with noise and low- contrast.


Subject(s)
Algorithms , Image Processing, Computer-Assisted , Imaging, Three-Dimensional , Ultrasonography , Ultrasonography, Doppler
15.
Comput Methods Programs Biomed ; 211: 106421, 2021 Nov.
Article in English | MEDLINE | ID: mdl-34583228

ABSTRACT

BACKGROUND AND OBJECTIVE: During the 3D reconstruction of ultrasound volume from 2D B-scan ultrasound images, holes are usually found in the reconstructed 3D volumes due to the fast scans. This condition will affect the positioning and judgment of the doctor to the lesion. Hence, in this study, we propose to fill the holes by using a novel content loss indexed 3D partial convolution network for 3D freehand ultrasound volume reconstruction. The network can synthesize novel ultrasound volume structures and reconstruct ultrasound volume with missing regions with variable sizes and at arbitrary locations. METHODS: First, the 3D partial convolution is introduced into the convolutional layer, which is masked and renormalized to be conditioned on only valid voxels. Then, the mask in the next layer is automatically updated as a part of the forward pass. To better preserve texture and structure details of the reconstruction results, we couple the adversarial loss of the least squares generative adversarial network (LSGAN) with the innovative content loss, which consists of the context loss, the feature-matching loss and the total variation loss. Thereafter, we introduce a novel spectral-normalized LSGAN by adding spectral normalization (SN) to the generator and discriminator of the LSGAN. The proposed method is simple in formulation, and is stable in training. RESULTS: Experiments on public and in-vivo ultrasound datasets and comparisons with popular algorithms demonstrate that the proposed approach can generate high-quality hole-filling results with preserved perceptual image details. CONCLUSIONS: Considering the high quality of the hole-filling results, the proposed method can effectively fill the missing regions in the reconstructed 3D ultrasound volume from 2D ultrasound image sequences.


Subject(s)
Algorithms , Image Processing, Computer-Assisted , Ultrasonography
16.
J Infect ; 80(5): e14-e17, 2020 05.
Article in English | MEDLINE | ID: mdl-32171867

ABSTRACT

OBJECTIVES: Previous studies on the pneumonia outbreak caused by the 2019 novel coronavirus disease (COVID-19) were based on information from the general population. However, limited data was available for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) reactivation. This study aimed to evaluate the clinical characteristics of the SARS-CoV-2 reactivation. METHODS: Clinical records, laboratory results, and chest CT scans were retrospectively reviewed for 55 patients with laboratory-confirmed COVID-19 pneumonia (i.e., with throat swab samples that were positive for SARS-CoV-2) who were admitted to Zhongnan Hospital of Wuhan University, Wuhan, China, from Jan. 8 to Feb. 10, 2020. RESULTS: All 55 patients had a history of epidemiological exposure to COVID-19, and 5 (9%) patients who discharged from hospital presented with SARS-CoV-2 reactivation. Among the 5 reactivated patients, other symptoms were also observed, including fever, cough, sore throat, and fatigue. One of the 5 patients had progressive lymphopenia (from 1.3 to 0.56 × 109 cells per L) and progressive neutrophilia (from 4.5 to 18.28 × 109 cells per L). All 5 reactivated patients presented normal aminotransferase levels. Throat swab samples from the 5 reactivated patients were tested for SARS-CoV-2, indicating all positive for the virus. CONCLUSIONS: Findings from this small group of cases suggested that there was currently evidence for reactivation of SARS-CoV-2 and there might be no specific clinical characteristics to distinguish them.


Subject(s)
Coronavirus Infections/diagnostic imaging , Coronavirus Infections/pathology , Pneumonia, Viral/diagnostic imaging , Pneumonia, Viral/pathology , Tomography, X-Ray Computed , Adult , Betacoronavirus/isolation & purification , COVID-19 , China , Coronavirus Infections/blood , Female , Humans , Male , Pandemics , Pharynx/virology , Pneumonia, Viral/blood , Recurrence , Retrospective Studies , SARS-CoV-2 , Transaminases/blood
17.
Clin Transl Med ; 10(1): 161-168, 2020 Jan.
Article in English | MEDLINE | ID: mdl-32508038

ABSTRACT

BACKGROUND: The clinical presentation of SARS-CoV-2-infected pneumonia (COVID-19) resembles that of other etiologies of community-acquired pneumonia (CAP). We aimed to identify clinical laboratory features to distinguish COVID-19 from CAP. METHODS: We compared the hematological and biochemical features of 84 patients with COVID-19 at hospital admission and 221 patients with CAP. Parameters independently predictive of COVID-19 were calculated by multivariate logistic regression. The receiver operating characteristic (ROC) curves were generated and the area under the ROC curve (AUC) was measured to evaluate the discriminative ability. RESULTS: Most hematological and biochemical indexes of patients with COVID-19 were significantly different from patients with CAP. Nine laboratory parameters were identified to be predictive of a diagnosis of COVID-19. The AUCs demonstrated good discriminatory ability for red cell distribution width (RDW) with an AUC of 0.87 and hemoglobin with an AUC of 0.81. Red blood cell, albumin, eosinophil, hematocrit, alkaline phosphatase, and mean platelet volume had fair discriminatory ability. Combinations of any two parameters performed better than did the RDW alone. CONCLUSIONS: Routine laboratory examinations may be helpful for the diagnosis of COVID-19. Application of laboratory tests may help to optimize the use of isolation rooms for patients when they present with unexplained febrile respiratory illnesses.

18.
Cancer Manag Res ; 10: 3033-3046, 2018.
Article in English | MEDLINE | ID: mdl-30214298

ABSTRACT

Epigenetic alteration of P16INK4a is conventionally thought to induce the initiation of carcinoma. However, the role of P16INK4a methylation in ovarian cancer still remains controversial. Therefore, we performed a meta-analysis to further elucidate the relationship between P16INK4a promoter methylation and ovarian cancer. A total of 24 studies, including 20 on risk, 10 on clinicopathological features, and 3 on prognosis, were included in our meta-analysis. Our results indicated that the frequency of P16INK4a methylation in cancer tissues was significantly higher than normal tissues and low malignant potential tumor tissues (odds ratio [OR] =5.01, 95% CI=1.55-16.14; OR =1.88, 95% CI=1.10-3.19, respectively), but similar to benign tissues (OR =1.18, 95% CI=0.52-2.65). Furthermore, P16INK4a promoter methylation was not strongly correlated with age, clinical stage, tumor differentiation, or histological subtype in patients with ovarian cancer. Additionally, survival analysis showed that patients with P16INK4a promoter methylation had a shorter progression-free survival in univariate and multivariate Cox regression models (hazard ratio =1.68, 95% CI=1.26-2.24; hazard ratio =1.55, 95% CI=1.15-2.08; respectively). In The Cancer Genome Atlas datasets, the methylation levels of seven out of nine CpG sites were significantly increased in the ovarian tumor tissues compared with the normal tissues. In conclusion, the present meta-analysis suggests that P16INK4a promoter methylation may be useful in distinguishing malignant cancer from healthy ovarian tissues, and it may be a potential predictive marker for prognosis in patients with ovarian cancer.

19.
Oncotarget ; 8(35): 59527-59538, 2017 Aug 29.
Article in English | MEDLINE | ID: mdl-28938656

ABSTRACT

There are inconsistent conclusions in the association between circulating tumor cells (CTCs) and urothelial cancer (UC). We performed a meta-analysis to assess the prognostic and diagnostic value of CTCs in UC. We search Medline, Embase and Web of science for relevant studies. The study was set up according to the inclusion/exclusion criteria. 30 published studies with a total of 2161 urothelial cancer patients were included. Meta-analysis showed that CTC-positive was significantly associated with tumor stage (≤ II vs III, IV) (OR = 4.60, 95% CI: 2.34-9.03), histological grade (I, II vs III) (OR = 2.91, 95% CI: 1.92-4.40), metastasis (OR = 5.12, 95% CI: 3.47-7.55) and regional lymph node metastasis (OR = 2.47, 95% CI: 1.75-3.49). It was also significantly associated with poor overall survival (OS) (HR = 3.98, 95% CI: 2.20-7.21), progression/disease-free survival (PFS/DFS) (HR = 2.22, 95% CI: 1.80-2.73) and cancer-specific survival (CSS) (HR = 5.18, 95% CI: 2.21-12.13). Overall sensitivity and specificity of CTC detection assays were 0.35 (95% CI: 0.28-0.43) and 0.97 (95% CI: 0.92-0.99) respectively. In summary, our meta-analysis suggests that the presence of CTCs in the peripheral blood is an independent predictive indicator of poor outcomes for urothelial cancer patients. It can also be used as a noninvasive method for the confirmation of cancer diagnosis. More studies are required to further explore the role of this marker in clinical practice.

20.
Oncol Lett ; 13(5): 3676-3680, 2017 May.
Article in English | MEDLINE | ID: mdl-28529585

ABSTRACT

The aim of this study was to evaluate the efficacy and safety of recombinant human adenovirus-p53 (rhAd-p53) combined with neoadjuvant chemotherapy in treatment of locally advanced cervical cancer (LACC). A total of 40 patients with LACC (stage IB2 to IIIA) were randomized into 2 groups (n=20 each): PVB group (cisplatin + vincristine + bleomycin, intravenously) and combined group (rhAd-p53 gene therapy + neoadjuvant chemotherapy). Both groups underwent a course of chemotherapy; the only exception was the injection of the rhAd-p53 solution 1×1012 VP intratumorally at an interval of three days thrice in the combined group thereafter. The tumor sizes and adverse events in both groups were observed. The expression of vascular endothelial growth factor (VEGF), protein p53 and micro-vessel density (MVD) in tumor tissue was respectively determined by immunohistochemistry. The evaluation was performed three weeks after the completion of chemotherapy. The efficacy was 75% in the PVB group versus 95% efficacy in the combined group; the tumor size was reduced by 11.42±2.78 cm2 in PVB group versus the significant shrinkage of 15.25±4.00 cm2 in the combined group (P<0.05). The expression of VEGF, p53 and MVD was downregulated in both the PVB and combined groups, with significantly statistical differences versus the control. No additional adverse events were evidenced in the combined group. Therefore, intratumoral injection of rhAd-p53 combined with neoadjuvant chemotherapy has advantage over conventional chemotherapy for its high efficacy, safety and synergism in the therapy for LACC.

SELECTION OF CITATIONS
SEARCH DETAIL