S309-CAR-NK cells bind the Omicron variants in vitro and reduce SARS-CoV-2 viral loads in humanized ACE2-NSG mice.

Recent progress on chimeric antigen receptor (CAR)-NK cells has shown promising results in treating CD19-positive lymphoid tumors with minimal toxicities [including graft versus host disease (GvHD) and cytokine release syndrome (CRS) in clinical trials. Nevertheless, the use of CAR-NK cells in combating viral infections has not yet been fully explored. Previous studies have shown that CAR-NK cells expressing S309 single-chain fragment variable (scFv), hereinafter S309-CAR-NK cells, can bind to SARS-CoV-2 wildtype pseudotyped virus (PV) and effectively kill cells expressing wild-type spike protein in vitro. In this study, we further demonstrate that the S309-CAR-NK cells can bind to different SARS-CoV-2 variants, including the B.1.617.2 (Delta), B.1.621 (Mu), and B.1.1.529 (Omicron) variants in vitro. We also show that S309-CAR-NK cells reduce virus loads in the NOD/SCID gamma (NSG) mice expressing the human angiotensin-converting enzyme 2 (hACE2) receptor challenged with SARS-CoV-2 wild-type (strain USA/WA1/2020). Our study demonstrates the potential use of S309-CAR-NK cells for inhibiting infection by SARS-CoV-2 and for the potential treatment of COVID-19 patients unresponsive to otherwise currently available therapeutics. IMPORTANCE: Chimeric antigen receptor (CAR)-NK cells can be "off-the-shelf" products that treat various diseases, including cancer, infections, and autoimmune diseases. In this study, we engineered natural killer (NK) cells to express S309 single-chain fragment variable (scFv), to target the Spike protein of SARS-CoV-2, hereinafter S309-CAR-NK cells. Our study shows that S309-CAR-NK cells are effective against different SARS-CoV-2 variants, including the B.1.617.2 (Delta), B.1.621 (Mu), and B.1.1.529 (Omicron) variants. The S309-CAR-NK cells can (i) directly bind to SARS-CoV-2 pseudotyped virus (PV), (ii) competitively bind to SARS-CoV-2 PV with 293T cells expressing the human angiotensin-converting enzyme 2 (hACE2) receptor (293T-hACE2 cells), (iii) specifically target and lyse A549 cells expressing the spike protein, and (iv) significantly reduce the viral loads of SARS-CoV-2 wild-type (strain USA/WA1/2020) in the lungs of NOD/SCID gamma (NSG) mice expressing hACE2 (hACE2-NSG mice). Altogether, the current study demonstrates the potential use of S309-CAR-NK immunotherapy as an alternative treatment for COVID-19 patients.

Modulating the Primary and Secondary Coordination Spheres of Single Ni(II) Sites in Metal-Organic Frameworks for Boosting Photocatalysis.

Though the coordination environment of single metal sites has been recognized to be of great importance in promoting catalysis, the influence of simultaneous precise modulation of primary and secondary coordination spheres on catalysis remains largely unknown. Herein, a series of single Ni(II) sites with altered primary and secondary coordination spheres have been installed onto metal-organic frameworks (MOFs) with UiO-67 skeleton, affording UiO-Ni-X-Y (X = S, O; Y = H, Cl, CF3) with X and Y on the primary and secondary coordination spheres, respectively. Upon deposition with CdS nanoparticles, the resulting composites present high photocatalytic H2 production rates, in which the optimized CdS/UiO-Ni-S-CF3 exhibits an excellent activity of 13.44 mmol g-1, ∼500 folds of the pristine catalyst (29.6 µmol g-1 for CdS/UiO), in 8 h, highlighting the key role of microenvironment modulation around Ni sites. Charge kinetic analysis and theoretical calculation results demonstrate that the charge transfer dynamics and reaction energy barrier are closely correlated with their coordination spheres. This work manifests the advantages of MOFs in the fabrication of structurally precise catalysts and the elucidation of particular influences of microenvironment modulation around single metal sites on the catalytic performance.

Electrochemical Synthesis of Urea: Co-Reduction of Nitrite and Carbon Dioxide on Binuclear Cobalt Phthalocyanine.

Exploration of molecular catalysts with the atomic-level tunability of molecular structures offers promising avenues for developing high-performance catalysts for the electrochemical co-reduction reaction of carbon dioxide (CO2) and nitrite (NO2 -) into value-added urea. In this work, a binuclear cobalt phthalocyanine (biCoPc) catalyst is prepared through chemical synthesis and applied as a C─N coupling catalyst toward urea. Achieving a remarkable Faradaic efficiency of 47.4% for urea production at -0.5 V versus reversible hydrogen electrode (RHE), this biCoPc outperforms many known molecular catalysts in this specific application. Its unique planar macromolecular structure and the increased valence state of cobalt promote the adsorption of nitrogenous and carbonaceous species, a critical factor in facilitating the multi-electron C─N coupling. Combining highly sensitive in situ attenuated total reflection surface-enhanced infrared absorption spectroscopy (ATR-SEIRAS) with density functional theory (DFT) calculations, the linear adsorbed CO (COL) and bridge adsorbed CO (COB) is captured on biCoPc catalyst during the co-reduction reaction. COB, a pivotal intermediate in the co-reduction from CO2 and nitrite to urea, is evidenced to be labile and may be attacked by nitrite, promoting urea production. This work demonstrates the importance of designing molecular catalysts for efficient co-reduction of CO2 and nitrite to urea.

HIV-TAT dysregulates microglial lipid metabolism through SREBP2/miR-124 axis: Implication of lipid droplet accumulation microglia in NeuroHIV.

Chronic HIV infection can dysregulate lipid/cholesterol metabolism in the peripheral system, contributing to the higher incidences of diabetes and atherosclerosis in HIV (+) individuals. Recently, accumulating evidence indicate that HIV proteins can also dysregulate lipid/cholesterol metabolism in the brain and such dysregulation could be linked with the pathogenesis of HIV-associated neurological disorders (HAND)/NeuroHIV. To further characterize the association between lipid/cholesterol metabolism and HAND, we employed HIV-inducible transactivator of transcription (iTAT) and control mice to compare their brain lipid profiles. Our results reveal that HIV-iTAT mice possess dysregulated lipid profiles and have increased numbers of lipid droplets (LDs) accumulation microglia (LDAM) in the brains. HIV protein TAT can upregulate LDs formation through enhancing the lipid/cholesterol synthesis in vitro. Mechanistically, HIV-TAT increases the expression of sterol regulatory element-binding protein 2 (SREBP2) through microRNA-124 downregulation. Cholesterol synthesis inhibition can block HIV-TAT-mediated NLRP3 inflammasome activation and microglial activation in vitro as well as mitigate aging-related behavioral impairment and memory deficiency in HIV-iTAT mice. Taken together, our results indicate an inherent role of lipid metabolism and LDAM in the pathogenesis of NeuroHIV (immunometabolism). These findings suggest that LDAM reversal through modulating lipid/cholesterol metabolism could be a novel therapeutic target for ameliorating NeuroHIV symptoms in chronic HIV (+) individuals.

Design, synthesis and biological evaluation of tanshinone IIA derivatives as NLRP3 inflammasome inhibitors.

Natural product structures have long provided valuable pharmacophores and even candidates for drug discovery. Tanshinone scaffold showed moderately inhibitory activity in NLRP3 inflammasome/IL-1ß pathway. Herein, we designed a series of derivatives on different regions of Tanshinone IIA (TNA) scaffold. The biological evaluation identified compound T10, a scaffold hybrid of TNA and salicylic acid, as a potent NLRP3 inflammasome inhibitor. Mechanistically, T10 inhibits the production of ROS and prevents NLRP3 inflammasome-dependent IL-1ß production. In addition, treatment with T10 significantly attenuated inflammatory response in DSS-induced peritonitis. Our work describes a potential tanshinone-based derivative, which needs to be further structurally optimized as NLRP3 inflammasome inhibitors for treating inflammatory disorders.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Discovery of a selective NLRP3-targeting compound with therapeutic activity in MSU-induced peritonitis and DSS-induced acute intestinal inflammation.

The aberrant activation of the nucleotide-binding oligomerization domain-like receptor family pyrin domain containing 3 (NLRP3) inflammasome is known to contribute to the pathogenesis of various human inflammation-related diseases. However, to date, no small-molecule NLRP3 inhibitor has been used in clinical settings. In this study, we have identified SB-222200 as a novel direct NLRP3 inhibitor through the use of drug affinity responsive target stability assay, cellular thermal shift assay, and surface plasmon resonance analysis. SB-222200 effectively inhibits the activation of the NLRP3 inflammasome in macrophages, while having no impact on the activation of NLRC4 or AIM2 inflammasome. Furthermore, SB-222200 directly binds to the NLRP3 protein, inhibiting NLRP3 inflammasome assembly by blocking the NEK7 - NLRP3 interaction and NLRP3 oligomerization. Importantly, treatment with SB-222200 demonstrates alleviation of NLRP3-dependent inflammatory diseases in mouse models, such as monosodium urate crystal-induced peritonitis and dextran sulfate sodium-induced acute intestinal inflammation. Therefore, SB-222200 holds promise as a lead compound for the development of NLRP3 inhibitors to combat NLRP3-driven disease and serves as a versatile tool for pharmacologically investigating NLRP3 biology.

PaCO2 is nonlinearly associated with NIV failure in patients with hypoxemic respiratory failure.

OBJECTIVE: To explore the association between PaCO2 and noninvasive ventilation (NIV) failure in patients with hypoxemic respiratory failure. METHODS: A retrospective study was performed in a respiratory ICU of a teaching hospital. Patients admitted to ICU between 2011 and 2019 were screened. We enrolled the patients with hypoxemic respiratory failure. However, patients who used NIV due to acute-on-chronic respiratory failure or heart failure were excluded. Data before the use of NIV were collected. Requirement of intubation was defined as NIV failure. RESULTS: A total of 1029 patients were enrolled in final analysis. The rate of NIV failure was 45% (461/1029). A nonlinear relationship between PaCO2 and NIV failure was found by restricted cubic splines (p = 0.03). The inflection point was 32 mmHg. The rate of NIV failure was 42% (224/535) in patients with PaCO2 >32 mmHg. However, it increased to 48% (237/494) in those with PaCO2 ≤ 32 mmHg. The crude and adjusted hazard ratio (HR) for NIV failure was 1.36 (95%CI:1.13-1.64) and 1.23(1.01-1.49), respectively, if the patients with PaCO2 >32 mmHg were set as reference. In patients with PaCO2 ≤ 32 mmHg, one unit increment of PaCO2 was associated with 5% reduction of NIV failure. However, it did not associate with NIV failure in patients with PaCO2 >32 mmHg. CONCLUSIONS: PaCO2 and NIV failure was nonlinear relationship. The inflection point was 32 mmHg. Below the inflection point, lower PaCO2 was associated with higher NIV failure. However, it did not associate with NIV failure above this point.

Two-year survival after scheduled extubation in patients with pneumonia or ARDS: a prospective observational study.

PURPOSE: To report two-year survival after scheduled extubation in patients with pneumonia or acute respiratory distress syndrome (ARDS). METHODS: This was a prospective observational study performed in a respiratory ICU of a teaching hospital. Pneumonia or ARDS patients who successfully completed a spontaneous breathing trial were enrolled. Data were collected before extubation. Patients were followed up to two years by phone every 3 months. RESULTS: A total of 230 patients were enrolled in final analysis. One-, 3-, 6-, 12-, and 24-month survival was 77.4%, 63.8%, 61.3%, 57.8%, and 47.8%, respectively. Cox regression shows that Charlson comorbidity index (hazard ratio: 1.20, 95% confidence interval: 1.10-1.32), APACHE II score before extubation (1.11, 1.05-1.17), cough peak flow before extubation (0.993, 0.986-0.999), and extubation failure (3.96, 2.51-6.24) were associated with two-year mortality. To predict death within two years, the area under the curve of receiver operating characteristic was 0.79 tested by Charlson comorbidity index, 0.75 tested by APACHE II score, and 0.75 tested by cough peak flow. Two-year survival was 31% and 77% in patients with Charlson comorbidity index ≥ 1 and < 1, 28% and 62% in patients with APACHE II score ≥ 12 and < 12, and 64% and 17% in patients with cough peak flow > 58 and ≤ 58 L/min, respectively. CONCLUSIONS: Comorbidity, disease severity, weak cough and extubation failure were associated with increased two-year mortality in pneumonia or ARDS patients who experienced scheduled extubation. It provides objective information to caregivers to improve decision-making process during hospitalization and post discharge.

Palliative primary tumor resection may not offer survival benefits for patients with unresectable metastatic colorectal neuroendocrine neoplasms, one multicenter retrospective cohort study.

BACKGROUND: The efficacy of palliative primary tumor resection (PTR) in improving prognosis for patients with unresectable metastatic colorectal neuroendocrine neoplasms (NENs) has not been fully explored. METHODS: We performed one retrospective cohort study and recruited 68 patients with unresectable metastatic colorectal NENs from two Chinese medical centers between 2000 and 2022. All patients were assigned to PTR group and no PTR group. The clinicopathological manifestation data were carefully collected, and the survival outcomes were compared between the two groups using Kaplan-Meier methods. Propensity score matching (PSM) was conducted to minimize confounding bias. Univariate and multivariate Cox proportional hazards regression analyses were performed to identify prognostic factors. RESULTS: A total of 32 patients received PTR, and the other 36 patients did not. The median progression-free survival (PFS) and overall survival (OS) times were 4 and 22 months in the whole cohort, respectively. For patients who received no PTR, the median OS was 16 months, and the 1-year OS rate and 3-year OS rate were 56.4% and 39.6%, respectively. For patients who received PTR, the median OS was 24 months, and the 1-year OS rate and 3-year OS rate were 67.9% and 34.1%, respectively. However, the Kaplan-Meier survival curves and log-rank test demonstrated no significant survival difference between the two groups (P = 0.963). Moreover, palliative PTR was also not confirmed as a prognostic factor in subsequent univariable and multivariable Cox proportional hazards regression analyses in both the original and matched cohorts. Only histological differentiation was identified as an independent prognostic factor affecting PFS [hazard ratio (HR) = 1.86, 95% confidence interval (CI): 1.02-3.41, P = 0.043] and OS [HR = 3.70, 95% CI: 1.09-12.48, P = 0.035] in the original cohort. CONCLUSIONS: Palliative PTR may not offer survival benefits for patients with unresectable metastatic colorectal NENs.

Advances on T cell immunity in bone remodeling and bone regeneration. / Tç»†èƒžå ç–«åœ¨éª¨é‡å»ºå’Œéª¨å†ç”Ÿä¸­çš„ç ”ç©¶è¿›å±•.

Bone remodeling and bone regeneration are essential for preserving skeletal integrity and maintaining mineral homeostasis. T cells, as key members of adaptive immunity, play a pivotal role in bone remodeling and bone regeneration by producing a range of cytokines and growth factors. In the physiological state, T cells are involved in the maintenance of bone homeostasis through interactions with mesenchymal stem cells, osteoblasts, and osteoclasts. In pathological states, T cells participate in the pathological process of different types of osteoporosis through interaction with estrogen, glucocorticoids, and parathyroid hormone. During fracture healing for post-injury repair, T cells play different roles during the inflammatory hematoma phase, the bone callus formation phase and the bone remodeling phase. Targeting T cells thus emerges as a potential strategy for regulating bone homeostasis. This article reviews the research progress on related mechanisms of T cells immunity involved in bone remodeling and bone regeneration, with a view to providing a scientific basis for targeting T cells to regulate bone remodeling and bone regeneration.

Postsynthetic Modification of the Nonanuclear Node in a Zirconium Metal-Organic Framework for Photocatalytic Oxidation of Hydrocarbons.

Heterogeneous catalysis plays an indispensable role in chemical production and energy conversion. Incorporation of transition metals into metal oxides and zeolites is a common strategy to fine-tune the activity and selectivity of the resulting solid catalysts, as either the active center or promotor. Studying the underlying mechanism is however challenging. Decorating the metal-oxo clusters with transition metals in metal-organic frameworks (MOFs) via postsynthetic modification offers a rational approach to construct well-defined structural models for better understanding of the reaction mechanism. Therefore, it is important to expand the materials scope beyond the currently widely studied zirconium MOFs consisting of Zr6 nodes. In this work, we report the design and synthesis of a new (4,12)-connected Zr-MOF with ith topology that consists of rare Zr9 nodes. FeIII was further incorporated onto the Zr9 nodes of the framework, and the resulting MOF material exhibits significantly enhanced activity and selectivity toward the photocatalytic oxidation of toluene. This work demonstrates a delicate ligand design strategy to control the nuclearity of Zr-oxo clusters, which further dictates the number and binding sites of transition metals and the overall photocatalytic activity toward C-H activation. Our work paves the way for future exploration of the structure-activity study of catalysts using MOFs as the model system.

Pathogenic Interleukin-10 Receptor Alpha Variants in Humans - Balancing Natural Selection and Clinical Implications.

Balancing natural selection is a process by which genetic variants arise in populations that are beneficial to heterozygous carriers, but pathogenic when homozygous. We systematically investigated the prevalence, structural, and functional consequences of pathogenic IL10RA variants that are associated with monogenic inflammatory bowel disease. We identify 36 non-synonymous and non-sense variants in the IL10RA gene. Since the majority of these IL10RA variants have not been functionally characterized, we performed a systematic screening of their impact on STAT3 phosphorylation upon IL-10 stimulation. Based on the geographic accumulation of confirmed pathogenic IL10RA variants in East Asia and in Northeast China, the distribution of infectious disorders worldwide, and the functional evidence of IL-10 signaling in the pathogenesis, we identify Schistosoma japonicum infection as plausible selection pressure driving variation in IL10RA. Consistent with this is a partially augmented IL-10 response in peripheral blood mononuclear cells from heterozygous variant carriers. A parasite-driven heterozygote advantage through reduced IL-10 signaling has implications for health care utilization in regions with high allele frequencies and potentially indicates pathogen eradication strategies that target IL-10 signaling.

The N-terminal subunit of vitellogenin in planthopper eggs and saliva acts as a reliable elicitor that induces defenses in rice.

Vitellogenins (Vgs) are critical for the development and fecundity of insects. As such, these essential proteins can be used by plants to reliably sense the presence of insects. We addressed this with a combination of molecular and chemical analyses, genetic transformation, bioactivity tests, and insect performance assays. The small N-terminal subunit of Vgs of the planthopper Nilaparvata lugens (NlVgN) was found to trigger strong defense responses in rice when it enters the plants during feeding or oviposition by the insect. The defenses induced by NlVgN not only decreased the hatching rate of N. lugens eggs, but also induced volatile emissions in plants, which rendered them attractive to a common egg parasitoid. VgN of other planthoppers triggered the same defenses in rice. We further show that VgN deposited during planthopper feeding compared with during oviposition induces a somewhat different response, probably to target the appropriate developmental stage of the insect. We also confirm that NlVgN is essential for planthopper growth, development, and fecundity. This study demonstrates that VgN in planthopper eggs and saliva acts as a reliable and unavoidable elicitor of plant defenses. Its importance for insect performance precludes evolutionary adaptions to prevent detection by rice plants.

Cytosolic DNA sensor activation inhibits HIV infection of macrophages.

Cytosolic recognition of microbial DNA in macrophages results in the activation of the interferon (IFN)-dependent antiviral innate immunity. Here, we examined whether activating DNA sensors in peripheral blood monocyte-derived macrophages (MDMs) can inhibit human immunodeficiency virus (HIV). We observed that the stimulation of MDMs with poly(dA:dT) or poly(dG:dC) (synthetic ligands for the DNA sensors) inhibited HIV infection and replication. MDMs treated with poly(dA:dT) or poly(dG:dC) expressed higher levels of both type I and type III IFNs than untreated cells. Activation of the DNA sensors in MDMs also induced the expression of the multiple intracellular anti-HIV factors, including IFN-stimulated genes (ISGs: ISG15, ISG56, Viperin, OAS2, GBP5, MxB, and Tetherin) and the HIV restriction microRNAs (miR-29c, miR-138, miR-146a, miR-155, miR-198, and miR-223). In addition, the DNA sensor activation of MDM upregulated the expression of the CC chemokines (RANTES, MIP-1α, MIP-1ß), the ligands for HIV entry coreceptor CCR5. These observations indicate that the cytosolic DNA sensors have a protective role in the macrophage intracellular immunity against HIV and that targeting the DNA sensors has therapeutic potential for immune activation-based anti-HIV treatment.

Activation of Toll-like receptor 3 inhibits HIV infection of human iPSC-derived microglia.

As a key immune cell in the brain, microglia are essential for protecting the central nervous system (CNS) from viral infections, including HIV. Microglia possess functional Toll-like receptor 3 (TLR3), a key viral sensor for activating interferon (IFN) signaling pathway-mediated antiviral immunity. We, therefore, studied the effect of poly (I:C), a synthetic ligand of TLR3, on the activation of the intracellular innate immunity against HIV in human iPSC-derived microglia (iMg). We found that poly (I:C) treatment of iMg effectively inhibits HIV infection/replication at both mRNA and protein levels. Investigations of the mechanisms revealed that TLR3 activation of iMg by poly (I:C) induced the expression of both type I and type III IFNs. Compared with untreated cells, the poly (I:C)-treated iMg expressed significantly higher levels of IFN-stimulated genes (ISGs) with known anti-HIV activities (ISG15, MxB, Viperin, MxA, and OAS-1). In addition, TLR3 activation elicited the expression of the HIV entry coreceptor CCR5 ligands (CC chemokines) in iMg. Furthermore, the transcriptional profile analysis showed that poly (I:C)-treated cells had the upregulated IFN signaling genes (ISG15, ISG20, IFITM1, IFITM2, IFITM3, IFITM10, APOBEC3A, OAS-2, MxA, and MxB) and the increased CC chemokine signaling genes (CCL1, CCL2, CCL3, CCL4, and CCL15). These observations indicate that TLR3 is a potential therapy target for activating the intracellular innate immunity against HIV infection/replication in human microglial cells. Therefore, further studies with animal models and clinical specimens are necessary to determine the role of TLR3 activation-driven antiviral response in the control and elimination of HIV in infected host cells.

Farnesoid X receptor agonist attenuates subchondral bone osteoclast fusion and osteochondral pathologies of osteoarthritis via suppressing JNK1/2/NFATc1 pathway.

Osteoarthritis (OA) is a prevalent degenerative disease of the joint, featured by articular cartilage destruction and subchondral bone marrow lesions. Articular cartilage and subchondral bone constitute an osteochondral unit that guarantees joint homeostasis. During OA initiation, activated osteoclasts in subchondral bone ultimately result in impaired capacities of the subchondral bone in response to mechanical stress, followed by the degradation of overlying articular cartilage. Thus, targeting osteoclasts could be a potential therapeutic option for treating OA. Here, we observed that farnesoid X receptor (FXR) expression and osteoclast fusion and activity in subchondral bone were concomitantly changed during early-stage OA in the OA mouse model established by anterior cruciate ligament transection (ACLT). Then, we explored the therapeutic effects of FXR agonist GW4064 on the osteochondral pathologies in ACLT mice. We showed that GW4064 obviously ameliorated subchondral bone deterioration, associated with reduction in tartrate-resistant acid phosphatase (TRAP) positive multinuclear osteoclast number, as well as articular cartilage degradation, which were blocked by the treatment with FXR antagonist Guggulsterone. Mechanistically, GW4064 impeded osteoclastogenesis through inhibiting subchondral bone osteoclast fusion via suppressing c-Jun N-terminal kinase (JNK) 1/2/nuclear factor of activated T-cells 1 (NFATc1) pathway. Taken together, our results present evidence for the protective effects of GW4064 against OA by blunting osteoclast-mediated aberrant subchondral bone loss and subsequent cartilage deterioration. Therefore, GW4064 demonstrates the potential as an alternative therapeutic option against OA for further drug development.

Enhanced energy transfer efficiency upon confining rhodamine B into zeolitic imidazolate frameworks.

Enhancing the utilization of absorbed light is essential for enhancing the efficiency of solar energy conversion via artificial photosynthesis. In this work, we report the successful incorporation of Rhodamine B (RhB) into the pore of ZIF-8 (ZIF = zeolitic imidazolate framework) and the efficient energy transfer process from RhB to Co-doped ZIF-8. Using transient absorption spectroscopy, we show that energy transfer only occurs from RhB (donor) to Co center (acceptor) when RhB is confined into the ZIF-8 structure, which is in stark contrast to the system based on the physical mixture of RhB with Co-doped ZIF-8, where negligible energy transfer was observed. In addition, energy transfer efficiency increases with the concentration of Co and reaches a plateau when the molar ratio of Co to RhB reaches 32. These results suggest that RhB confined in the ZIF-8 structure is essential for energy transfer to occur, and energy transfer efficiency can be controlled by tuning the concentration of acceptors.

The metabolite profiling of YR-1702 injection in human plasma, urine and feces by HPLC-Q-TOF-MS/MS.

YR-1702, a hybrid µ/κ/δ receptor agonist, is modified from the traditional opioid analgesic dezocine. It had shown both excellent analgesic effect and lower addiction in phase I clinical trial in China, however, the metabolic pathway of YR-1702 in humans remains unelucidated.The goals of this study are to characterise the metabolism of YR-1702 in human liver microsomes (HLMs) and patients with chronic non-cancer pain by high performance liquid chromatography-coupled with quadrupole-time-of-flight mass spectrometry (HPLC-Q-TOF-MS/MS).The results showed that a total of twelve metabolites were identified in HLMs, in which 7, 6 and 5 metabolites were also found in human plasma, urine and feces, respectively. And the major metabolic pathways include mono-hydroxylation, di-hydroxylation, dehydrogenation and glucuronidation. The locations of hydroxylation and dehydrogenation were identified by the signature fragments of the metabolites.The relative contents of the metabolites in human plasma were also evaluated, in which the main metabolite M1 notably accounting for more than 14% of the total drug exposure. This study would contribute to the understanding of the in vivo metabolite profile of YR-1702 injection for future use.

[Analysis of a child with Very early onset inflammatory bowel disease due to compound heterozygous variants of IL10RA and DUOX2 genes].

OBJECTIVE: To explore the genetic basis of a child with Very early onset inflammatory bowel disease (VEOIBD). METHODS: A female child who had presented at the Children's Hospital of Fudan University on May 23, 2018 due to occurrence of diarrhea and fever 6 days after birth was selected as the study subject. Clinical data of the child was collected. Family-based whole-exome sequencing (WES) was carried out. Candidate variant was verified by Sanger sequencing and PCR of the patient and her parents. RESULTS: The child had developed the symptoms 6 days after birth, with main manifestations including diarrhea, fever, failure to thrive, rectovestibular fistula and hypothyroidism. An enterostomy was performed at the age of 3.5 months due to severe intestinal adhesion and obstruction. Based on her clinical manifestations, colonoscopic finding, and results of biopsies, she was diagnosed with VEOIBD in conjunct with congenital hypothyroidism. Replacement treatment of levothyroxine was given since one month of age. Family-based WES revealed that the child has harbored compound heterozygous variants of the DUOX2 gene, namely c.2654G>T (p.R885L) and c.505C>T (p.R169W), in addition with a heterozygous c.301C>T (p.R101W) variant of the IL10RA gene. Re-analysis of the WES data revealed that the patient also had a 333 bp deletion spanning exon 1 of the IL10RA gene (Chr11: 117857034_117857366). CONCLUSION: For patients with VEOIBD, genetic testing is recommended. Presence of additional DUOX2 gene variants might have exacerbated the clinical symptoms in this patient. Above finding has facilitated genetic counseling and prenatal diagnosis for this family, and raised clinicians' awareness of this rare disease.