Unexpected Diversity of Pseudomonads Associated with Bacterial Leaf Spot of Cucurbits in the Southeastern United States.

Bacterial leaf spot of cucurbits (BLS) is an emerging disease in the southeastern United States that is capable of causing widespread outbreaks under conducive conditions. Historically attributed solely to the bacterium Pseudomonas syringae pv. lachrymans, recent studies have identified additional P. syringae pathovars as causal agents of the disease. To further investigate the identity and diversity of P. syringae strains associated with BLS in the southeastern United States, 47 bacterial isolates were recovered from symptomatic cucurbits from Florida, Alabama, and Georgia. Strains were characterized using the LOPAT testing scheme, fluorescence, and pathogenicity to watermelon and squash seedlings. Thirty-eight fluorescent isolates underwent whole-genome sequencing and were further characterized with 16S rRNA, four gene multilocus sequence analysis (MLSA) phylogeny, and average nucleotide identity analysis. Thirty-four isolates were identified as members of the P. syringae species complex, including P. syringae sensu stricto (12), P. alliivorans (12), P. capsici (nine), and P. viridiflava (one). An additional four isolates were found to belong to the Pseudomonas genus outside of the syringae species complex, though they did not share 95% or greater average nucleotide identity to any validly published species and are believed to belong to three novel Pseudomonas species. These results reveal an unpredicted level of diversity of Pseudomonas strains associated with BLS in the region and show the benefits of whole-genome sequencing for strain identification. Identification of P. capsici, which is capable of causing disease at higher temperatures than P. syringae, as a causal agent of BLS may also affect management strategies in the future.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

Transgenic Expression of EFR and Bs2 Genes for Field Management of Bacterial Wilt and Bacterial Spot of Tomato.

Field trials were conducted at two locations in Florida to evaluate transgenic tomato expressing the ELONGATION FACTOR TU RECEPTOR (EFR) gene from Arabidopsis thaliana, the Bs2 gene from pepper, or both Bs2 and EFR (Bs2/EFR) for managing bacterial wilt caused by Ralstonia solanacearum and bacterial spot caused by Xanthomonas perforans. Expression of EFR or Bs2/EFR in the susceptible genotype Fla. 8000 significantly reduced bacterial wilt incidence (50 to 100%) and increased total yield (57 to 114%) relative to lines expressing only Bs2 or the nontransformed Fla. 8000 control, although the marketable yield was not significantly affected. Following harvest, surviving symptomatic and nonsymptomatic plants were assessed for colonization by R. solanacearum. There were no significant differences in the population at the lower stem. Interestingly, in the middle stem, no bacteria could be recovered from EFR or Bs2/EFR lines but viable bacterial populations were recovered from Bs2 and nontransformed control lines at 102 to 105 CFU/g of stem tissue. In growth-chamber experiments, the EFR transgenic tomato lines were found to be effective against seven different R. solanacearum strains isolated from the southeastern United States, indicating utility across the southeastern United States. In all of the bacterial spot trials, EFR and Bs2/EFR lines had significantly reduced disease severity (22 to 98%) compared with the Fla. 8000 control. The marketable and total yield of Bs2/EFR were significantly higher (43 to 170%) than Fla. 8000 control in three of four field trials. These results demonstrate for the first time the potential of using the EFR gene for field management of bacterial wilt and bacterial spot diseases of tomato.

Phylogenetic and phenotypic characterization of Fusarium oxysporum f. sp. niveum isolates from Florida-grown watermelon.

Fusarium wilt of watermelon (Citrullus lanatus) caused by Fusarium oxysporum f. sp. niveum (Fon), has become an increasing concern of farmers in the southeastern USA, especially in Florida. Management of this disease, most often through the use of resistant cultivars and crop rotation, requires an accurate understanding of an area's pathogen population structure and phenotypic characteristics. This study improved the understanding of the state's pathogen population by completing multilocus sequence analysis (MLSA) of two housekeeping genes (BT and TEF) and two loci (ITS and IGS), aggressiveness and race-determining bioassays on 72 isolates collected between 2011 and 2015 from major watermelon production areas in North, Central, and South Florida. Multilocus sequence analysis (MLSA) failed to group race 3 isolates into a single large clade; moreover, clade membership was not apparently correlated with aggressiveness (which varied both within and between clades), and only slightly with sampling location. The failure of multilocus sequence analysis using four highly conserved housekeeping genes and loci to clearly group and delineate known Fon races provides justification for future whole genome sequencing efforts whose more robust genomic comparisons will provide higher resolution of intra-species genetic distinctions. Consequently, these results suggest that identification of Fon isolates by race determination alone may fail to detect economically important phenotypic characteristics such as aggressiveness leading to inaccurate risk assessment.

Distribution, Phenology, and Overwintering Survival of Asian Citrus Psyllid (Hemiptera: Liviidae), in Urban and Grove Habitats in North Florida.

Cold hardy citrus is an emerging industry in north Florida. However, it is under the threat of Candidatus Liberibacter asiaticus (CLas), the agent of the citrus disease huanglongbing. Distribution and phenology of the Asian citrus psyllid, Diaphorina citri (Kuwayama), the vector of CLas, was investigated over a 2-year sampling period in north Florida. Diaphorina citri was only found in backyard and ornamental citrus along the Gulf of Mexico, and was not observed in cultivated citrus groves during the 2 years (2017-2018) of the survey. Diaphorina citri population peaks occurred approximately 2 mo later than in central Florida with major population peaks occurring in July. The number of D. citri adults was significantly higher on CLas infected than uninfected citrus trees, whereas more nymphs were found on uninfected trees. Most D. citri were negative for CLas except in Franklin county where both infected trees and psyllids were found. We were able to find adult D. citri during all winter months, despite temperatures as low as -5.5°C. During two consecutive winters, we conducted experiments to determine D. citri cold hardiness by caging D. citri under ambient conditions in mid-November and assessing survivors in the following spring. In 2018, approximately 21%, of D. citri adults survived overwintering whereas 16% survived in 2019 despite lower temperature in 2018 than in 2019. As we are at the earliest stage of HLB infestation, management of D. citri and CLas in north Florida should focus on removal of CLas-infected trees to reduce the reservoir of pathogen.

Considerations for using bacteriophages for plant disease control.

The use of bacteriophages as an effective phage therapy strategy faces significant challenges for controlling plant diseases in the phyllosphere. A number of factors must be taken into account when considering phage therapy for bacterial plant pathogens. Given that effective mitigation requires high populations of phage be present in close proximity to the pathogen at critical times in the disease cycle, the single biggest impediment that affects the efficacy of bacteriophages is their inability to persist on plant surfaces over time due to environmental factors. Inactivation by UV light is the biggest factor reducing bacteriophage persistence on plant surfaces. Therefore, designing strategies that minimize this effect are critical. For instance, application timing can be altered: instead of morning or afternoon application, phages can be applied late in the day to minimize the adverse effects of UV and extend the time high populations of phage persist on leaf surfaces. Protective formulations have been identified which prolong phage viability on the leaf surface; however, UV inactivation continues to be the major limiting factor in developing more effective bacteriophage treatments for bacterial plant pathogens. Other strategies, which have been developed to potentially increase persistence of phages on leaf surfaces, rely on establishing non-pathogenic or attenuated bacterial strains in the phyllosphere that are sensitive to the phage(s) specific to the target bacterium. We have also learned that selecting the correct phages for disease control is critical. This requires careful monitoring of bacterial strains in the field to minimize development of bacterial strains with resistance to the deployed bacteriophages. We also have data that indicate that selecting the phages based on in vivo assays may also be important when developing use for field application. Although bacteriophages have potential in biological control for plant disease control, there are major obstacles, which must be considered.

Soil-based systemic delivery and phyllosphere in vivo propagation of bacteriophages: Two possible strategies for improving bacteriophage persistence for plant disease control.

Soil-based root applications and attenuated bacterial strains were evaluated as means to enhance bacteriophage persistence on plants for bacterial disease control. In addition, the systemic nature of phage applied to tomato roots was also evaluated. Several experiments were conducted applying either single phages or phage mixtures specific for Ralstonia solanacearum, Xanthomonas perforans or X. euvesicatoria to soil surrounding tomato plants and measuring the persistence and translocation of the phages over time. In general, all phages persisted in the roots of treated plants and were detected in stems and leaves; although phage level varied and persistence in stems and leaves was at a much lower level compared with persistence in roots. Bacterial wilt control was typically best if the phage or phage mixtures were applied to the soil surrounding tomatoes at the time of inoculation, less effective if applied 3 days before inoculation, and ineffective if applied 3 days after inoculation. The use of an attenuated X. perforans strain was also evaluated to improve the persistence of phage populations on tomato leaf surfaces. In greenhouse and field experiments, foliar applications of an attenuated mutant X. perforans 91-118:∆OPGH strain prior to phage applications significantly improved phage persistence on tomato foliage compared with untreated tomato foliage. Both the soil-based bacteriophage delivery and the use of attenuated bacterial strains improved bacteriophage persistence on respective root and foliar tissues, with evidence of translocation with soil-based bacteriophage applications. Both strategies could lead to improved control of bacterial pathogens on plants.