Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding: Spectroscopic, Solid State and In Silico Analysis.

The interaction between the series of berberine derivatives 1-5 (NAX071, NAX120, NAX075, NAX077 and NAX079) and human telomeric G-quadruplexes (G4), which are able to inhibit the Telomerase enzyme's activity in malignant cells, was investigated. The derivatives bear a pyridine moiety connected by a hydrocarbon linker of varying length (n = 1-5, with n number of aliphatic carbon atoms) to the C13 position of the parent berberine. As for the G4s, both bimolecular 5'-TAGGGTTAGGGT-3' (Tel12) and monomolecular 5'-TAGGGTTAGGGTTAGGGTTAGGG-3' (Tel23) DNA oligonucleotides were considered. Spectrophotometric titrations, melting tests, X-ray diffraction solid state analysis and in silico molecular dynamics (MD) simulations were used to describe the different systems. The results were compared in search of structure-activity relationships. The analysis pointed out the formation of 1:1 complexes between Tel12 and all ligands, whereas both 1:1 and 2:1 ligand/G4 stoichiometries were found for the adduct formed by NAX071 (n = 1). Tel12, with tetrads free from the hindrance by the loop, showed a higher affinity. The details of the different binding geometries were discussed, highlighting the importance of H-bonds given by the berberine benzodioxole group and a correlation between the strength of binding and the hydrocarbon linker length. Theoretical (MD) and experimental (X-ray) structural studies evidence the possibility for the berberine core to interact with one or both G4 strands, depending on the constraints given by the linker length, thus affecting the G4 stabilization effect.

Antimetastatic and Antitumor Activities of Orally Administered NAX014 Compound in a Murine Model of HER2-Positive Breast Cancer.

The natural isoquinoline alkaloid Berberine (BBR) has been shown to possess several therapeutic effects, including anticancer activity. Different BBR derivatives have been designed and synthesized in order to obtain new compounds with enhanced anticancer efficacy. We previously showed that intraperitoneal (IP) administration of the BBR-derived NAX014 compound was able to counteract HER-2 overexpressing mammary tumors onset and progression in transgenic mice. However, the IP administration was found to induce organ toxicity at doses higher than 2.5 mg/Kg. In this study, we evaluated the effect of intragastric (IG) administration of 20 mg/kg of NAX014 on both safety and anticancer efficacy in HER-2/neu transgenic mice. Furthermore, cancer cell dissemination and migration, tumor cell senescence and immunological changes were examined. Our results demonstrated that IG NAX014 administration delayed the onset of mammary tumors with no negative effects on health and survival. NAX014 reduced HER-2 overexpressing BC cells migration in vitro and the frequency of lung metastasis in HER-2/neu transgenic mice. A statistically significant increase of senescence-associated p16 expression was observed in tumors from NAX014-treated mice, and the induction of cell senescence was observed in HER-2 overexpressing BC cells after in vitro treatment with NAX014. Although NAX014 did not modulate the presence of tumor-infiltrating lymphocytes, the level of circulating TNF-α and VEGF was found to be reduced in NAX014-treated mice. The overall results address the NAX014 compound as potential tool for therapeutic strategies against HER-2 overexpressing breast cancer.

Enhanced Clearance of Neurotoxic Misfolded Proteins by the Natural Compound Berberine and Its Derivatives.

BACKGROUND: Accumulation of misfolded proteins is a common hallmark of several neurodegenerative disorders (NDs) which results from a failure or an impairment of the protein quality control (PQC) system. The PQC system is composed by chaperones and the degradative systems (proteasome and autophagy). Mutant proteins that misfold are potentially neurotoxic, thus strategies aimed at preventing their aggregation or at enhancing their clearance are emerging as interesting therapeutic targets for NDs. METHODS: We tested the natural alkaloid berberine (BBR) and some derivatives for their capability to enhance misfolded protein clearance in cell models of NDs, evaluating which degradative pathway mediates their action. RESULTS: We found that both BBR and its semisynthetic derivatives promote degradation of mutant androgen receptor (ARpolyQ) causative of spinal and bulbar muscular atrophy, acting mainly via proteasome and preventing ARpolyQ aggregation. Overlapping effects were observed on other misfolded proteins causative of amyotrophic lateral sclerosis, frontotemporal-lobar degeneration or Huntington disease, but with selective and specific action against each different mutant protein. CONCLUSIONS: BBR and its analogues induce the clearance of misfolded proteins responsible for NDs, representing potential therapeutic tools to counteract these fatal disorders.

Synthesis and biological evaluation of novel heteroring-annulated pyrrolino-tetrahydroberberine analogues as antioxidant agents.

Tetrahydroberberine (THB), otherwise known as canadine, is a natural alkaloid showing significant pharmacological properties and antioxidant protection against oxidative damage. Herein, we synthetized structurally complex THB analogues, namely pyrrolino-tetrahydroberberines (PTHBs) 4a-g, containing the pyrrolino[2,3-b]pyridine system, by means of the reactions of 1,2-diaza-1,3-dienes and 7,8-dihydroberberine. Aim of the study was to explore the in vitro antioxidant properties of PTHBs in comparison to THB thus to identify the most effective against free radical-induced oxidative injury, by using three different antioxidant tests: the ORAC method, the DNA nicking assay, and the DCFH-DA cellular assay. As a result, PTHB 4d emerged among the other THB analogues by exhibiting the best antioxidant properties. First, it was the only compound having an ORAC value completely comparable to that of THB, indicating the same ability to neutralize peroxyl radicals. Secondly, 4d showed an even better antioxidant capacity than THB in protecting DNA against ferrous ion-induced strand breaks. These observations were also confirmed in NCTC-2544 human keratinocytes exposed to hydrogen peroxide. Indeed, 4d protected cells against oxidation more efficiently than THB both in the short (1 and 3 h) and long (24 h) period of incubation, possibly suggesting increased cell membrane permeability and/or intracellular stability of 4d as compared to THB.

Antiangiogenic and antitumor activities of berberine derivative NAX014 compound in a transgenic murine model of HER2/neu-positive mammary carcinoma.

Berberine (BBR) is a natural isoquinoline alkaloid with proven antiangiogenic and anticancer activities. We recently demonstrated that BBR and its synthetic derivative 13-(4-chlorophenylethyl)berberine iodide, NAX014, exert antiproliferative activity against HER2-overexpressing breast cancer cells, inducing apoptosis, modulating the expression of cell cycle checkpoint molecules involved in cell senescence, and reducing both HER2 expression and phosphorylation on tumor cells. In this study, we examined the anticancer properties of BBR and NAX014 in a transgenic mouse model which spontaneously develops HER2-positive mammary tumors. Repeated intraperitoneal injections of a safety dose (2.5mg/kg) of NAX014 delayed the development of tumors, reducing both the number and size of tumor masses. In vivo sidestream dark field videomicroscopy revealed a significant lower vessel density in mammary tumors from NAX014-treated mice in comparison with the control group. Immunohistochemical evaluation using CD34 antibody confirmed the reduced vessel density in NAX014 group. Statistically significant increase of senescence associated ß-galactosidase and p16 expression, and reduced expression of heparanase were observed in tumors from NAX014-treated mice than in tumors from control animals. Finally, NAX014 treatment decreased the level of perforine and granzyme mRNA in mammary tumors. Berberine did not show any statistically significant modulation in comparison with control mice. The results of the present study indicate that NAX014 is more effective than BBR in exerting anticancer activity delaying the development of mammary tumors in mice transgenic for the HER-2/neu oncogene. The antitumor efficacy of NAX014 is mainly related to its effect on tumor vascular network and on induction of tumor cell senescence.

Recognition of human telomeric G-quadruplex DNA by berberine analogs: effect of substitution at the 9 and 13 positions of the isoquinoline moiety.

G-quadruplex forming sequences are widely distributed in human genome and serve as novel targets for regulating gene expression and chromosomal maintenance. They offer unique targets for anticancer drug development. Here, the interaction of berberine (BC) and two of its analogs bearing substitution at 9 and 13-position with human telomeric G-quadruplex DNA sequence has been investigated by biophysical techniques. Both the analogs exhibited several-fold higher binding affinity than berberine. The Scatchard binding isotherms revealed non-cooperative binding. 9-ω-amino hexyl ether analog (BC1) showed highest affinity (1.8 × 10(6) M(-1)) while the affinity of the 13-phenylpropyl analog (BC2) was 1.09 × 10(6) M(-1). Comparative fluorescence quenching and polarization anisotropy of the emission spectra gave evidence for a stronger stacking interaction of the analogs compared to berberine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberine. However, the binding of the analogs did not induce any major structural perturbation in the G-quadruplex structure, but led to higher thermal stability. Energetics of the binding indicated that the association of the analogs was exothermic and predominantly entropy driven phenomenon. Increasing the temperature resulted in weaker binding; the enthalpic contribution increased and the entropic contribution decreased. A small negative heat capacity change with significant enthalpy-entropy compensation established the involvement of multiple weak noncovalent interactions in the binding process. The 9-ω-amino hexyl ether analog stabilized the G-quadruplex structure better than the 13-phenyl alkyl analog.

Effect of new berberine derivatives on colon cancer cells.

The natural alkaloid berberine has been recently described as a promising anticancer drug. In order to improve its efficacy and bioavailability, several derivatives have been designed and synthesized and found to be even more potent than the lead compound. Among the series of berberine derivatives we have produced, five compounds were identified to be able to heavily affect the proliferation of human HCT116 and SW613-B3 colon carcinoma cell lines. Remarkably, these active compounds exhibit high fluorescence emission property and ability to induce autophagy.

Berberine, an epiphany against cancer.

Alkaloids are used in traditional medicine for the treatment of many diseases. These compounds are synthesized in plants as secondary metabolites and have multiple effects on cellular metabolism. Among plant derivatives with biological properties, the isoquinoline quaternary alkaloid berberine possesses a broad range of therapeutic uses against several diseases. In recent years, berberine has been reported to inhibit cell proliferation and to be cytotoxic towards cancer cells. Based on this evidence, many derivatives have been synthesized to improve berberine efficiency and selectivity; the results so far obtained on human cancer cell lines support the idea that they could be promising agents for cancer treatment. The main properties of berberine and derivatives will be illustrated.

Antitumor Effect of Berberine Analogs in a Canine Mammary Tumor Cell Line and in Zebrafish Reporters via Wnt/ß-Catenin and Hippo Pathways.

The heterogeneous nature of human breast cancer (HBC) can still lead to therapy inefficacy and high lethality, and new therapeutics as well as new spontaneous animal models are needed to benefit translational HBC research. Dogs are primarily investigated since they spontaneously develop tumors that share many features with human cancers. In recent years, different natural phytochemicals including berberine, a plant alkaloid, have been reported to have antiproliferative activity in vitro in human cancers and rodent animal models. In this study, we report the antiproliferative activity and mechanism of action of berberine, its active metabolite berberrubine, and eight analogs, on a canine mammary carcinoma cell line and in transgenic zebrafish models. We demonstrate both in vitro and in vivo the significant effects of specific analogs on cell viability via the induction of apoptosis, also identifying their role in inhibiting the Wnt/ß-catenin pathway and activating the Hippo signals with a downstream reduction in CTGF expression. In particular, the berberine analogs NAX035 and NAX057 show the highest therapeutic efficacy, deserving further analyses to elucidate their mechanism of action more in detail, and in vivo studies on spontaneous neoplastic diseases are needed, aiming at improving veterinary treatments of cancer as well as translational cancer research.

Distamycin A and derivatives as synergic drugs in cisplatin-sensitive and -resistant ovarian cancer cells.

Acquired resistance to cisplatin (cDDP) is a multifactorial process that represents one of the main problems in ovarian cancer therapy. Distamycin A is a minor groove DNA binder whose toxicity has limited its use and prompted the synthesis of derivatives such as NAX001 and NAX002, which have a carbamoyl moiety and different numbers of pyrrolamidine groups. Their interaction with a B-DNA model and with an extended-TATA box model, [Polyd(AT)], was investigated using isothermal titration calorimetry (ITC) to better understand their mechanism of interaction with DNA and therefore better explain their cellular effects. Distamycin A interactions with Dickerson and Poly[d(AT)(6)] oligonucleotides show a different thermodynamic with respect to NAX002. The bulkier distamycin A analogue shows a non optimal binding to DNA due to its additional pyrrolamidine group. Cellular assays performed on cDDP-sensitive and -resistant cells showed that these compounds, distamycin A in particular, affect the expression of folate cycle enzymes even at cellular level. The optimal interaction of distamycin A with DNA may account for the down-regulation of both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) and the up-regulation of spermidine/spermine N1-acetyltransferase (SSAT) caused by this compound. These effects seem differently modulated by the cDDP-resistance phenotype. NAX002 which presents a lower affinity to DNA and slightly affected these enzymes, showed a synergic inhibition profile in combination with cDDP. In addition, their combination with cDDP or polyamine analogues increased cell sensitivity to the drugs suggesting that these interactions may have potential for development in the treatment of ovarian carcinoma.

APR-246-The Mutant TP53 Reactivator-Increases the Effectiveness of Berberine and Modified Berberines to Inhibit the Proliferation of Pancreatic Cancer Cells.

Pancreatic ductal adenocarcinoma (PDAC) is the most common form of pancreatic cancer. In ~75% of PDAC, the tumor suppressor TP53 gene is mutated. Novel approaches to treat cancer involve compounds called mutant TP53 reactivators. They interact with mutant TP53 proteins and restore some of their growth suppressive properties, but they may also interact with other proteins, e.g., TP63 and TP73. We examined the ability of the TP53 reactivator APR-246 to interact with eleven modified berberine compounds (NAX compounds) in the presence and absence of WT-TP53 in two PDAC cell lines: the MIA-PaCa-2, which has gain of function (GOF) TP53 mutations on both alleles, and PANC-28, which lacks expression of the WT TP53 protein. Our results indicate the TP53 reactivator-induced increase in therapeutic potential of many modified berberines.

Effects of the MDM2 inhibitor Nutlin-3a on sensitivity of pancreatic cancer cells to berberine and modified berberines in the presence and absence of WT-TP53.

Approaches to improve pancreatic cancer therapy are essential as this disease has a very bleak outcome. Approximately 80% of pancreatic cancers are pancreatic ductal adenocarcinomas (PDAC). A key regulatory gene frequently mutated (∼75%) in PDAC is the TP53 tumor suppressor gene which controls the transcription of multiple genes involved in cell cycle progression, apoptosis, cancer progression and other growth regulatory processes. The mouse double minute 2 homolog (MDM2) gene product is a nuclear-localized E3 ubiquitin ligase and negatively regulates the TP53 protein which results in its proteasomal degradation. Various MDM2 inhibitors have been isolated and examined in clinical trials, especially in patients with hematological malignancies. Nutlin-3a is one of the first MDM2 inhibitors isolated. Berberine (BBR) is a natural product found in many fruits and berries and used in traditional medicine for centuries. It has many biological effects, and some are anti-proliferative in nature. BBR may activate the expression of TP53 and inhibit cell cycle progression as well as other events important in cell growth. To understand more about the potential of compounds like BBR and chemical modified BBRs (NAX compounds) to sensitize PDAC cells to MDM2 inhibitors, we introduced either WT-TP53 or the pLXSN empty vector control into two PDAC cell lines, one lacking expression of TP53 (PANC-28) and one with gain-of-function mutant TP53 on both alleles (MIA-PaCa-2). Our results indicate that nutlin-3a was able to increase the sensitivity to BBR and certain NAX compounds. The effects of nutlin-3a were usually more substantial in those cells containing an introduced WT TP53 gene. These results highlight the importance of knowledge of the type of TP53 mutation that is present in cancer patients before the administration of drugs which function by stabilization of the TP53 protein.

Potential application of berberine in the treatment of Escherichia coli sepsis.

Gram-negative sepsis ranks as the leading cause of death in intensive care units. Despite the development of new antibiotics, mortality from gram-negative sepsis remains high. The present study aims to investigate the in vivo effects of berberine (BBR) administration on septic death induced by intraperitoneal Escherichia coli injection. The results showed that (i) single 5 mg/kg dose of BBR increases the survival of septic mice, (ii) BBR administration improves the antimicrobial efficacy of antibiotic drug, (iii) BBR pre-treatment prevents improvements of BBR therapy without affecting the pro-survival effects of antibiotic drug. The effects of BBR administration were associated with immunological alterations represented by changes in CD4+ and CD8+ lymphocytes population and IL-6 and TNF-α production. This study highlighted the benefits of berberine administration as antibiotic adjuvant in E. coli sepsis. Furthermore, information about berberine-induced immunological perturbations and their influence on host response to infection and therapy has been shown.

[Corrigendum] TOOLBOX: Strep­Tagged nano­assemblies of antibody­drug­conjugates (ADC) for modular and conditional cancer drugging.

Following the publication of the above article, the authors have requested a change in the authorship on the paper, and the revised list of authors is presented above; essentially, the ninth intended author, Giuseppe Salvo (G.S.), was inadverently omitted from the author list. G.S. contributed towards the T design and the preparation of the tagged ScFv. Therefore, the revised authors' names and affiliations, as they should have been presented in the original version of this paper, are as follows: Elisa Tremante1, Leonardo Sibilio2,7, Fabio Centola2,8, Nadine Knutti3,9, Gerd Holzapfel4, Isabella Manni5, Matteo Allegretti1, Paolo Lombardi6, Giuseppe Salvo2,10, Loredana Cecchetelli2, Karlheinz Friedrich3, Joachim BertraM4 and Patrizio Giacomini1. 1Oncogenomics and Epigenetics, IRCCS Regina Elena National Cancer Institute, Rome; 2Ibi Lorenzini, Aprilia, Italy; 3University Hospital Jena, Institute of Biochemistry II, Jena; 4IBA GmbH, Göttingen, Germany; 5SAFU, IRCCS Regina Elena National Cancer Institute, Rome; 6NaxosPharma, Novate Milanese, Milan, Italy. Correspondence to: Dr Patrizio Giacomini. Oncogenomics and Epigenetics, IRCCS Regina Elena National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy. E­mail: patrizio.giacomini@ifo.gov.it. Present address: 7Menarini Biotech, Pomezia, Rome, Italy. Present address: 8Merck Serono Spa, Global Analytical Department, Guidonia Montecelio, Rome, Italy. Present address: 9University Hospital Jena Institute for Clinical Chemistry and Laboratory Diagnostics, Jena, Germany. Present address: 10External Quality Assurance (ExM), MSD Italia S.r.l., Via Vitorchiano 151, 00189 Rome.Italy. Furthermore, the Authors' contributions section should be amended to read as follows: Authors' contributions: ET and MA tested the TOOLBOX concept and performed the flow cytometry experiments. LS, FC, GS and LC designed and prepared the tagged ScFv. NK and KF designed and prepared the GFP promoter­reporter construct. GH and JB designed and manufactured Strep­Tactins. ET and IM performed animal studies. PL designed and manufactured NAX and NAXT compounds. PG conceptualized TOOLBOX and wrote the manuscript with the contribution of all authors. All authors have approved the final version of the manuscript. All the authors agree with the inclusion of Giuseppe Salvo as an author on this paper, and are grateful to the Editor for allowing them the opportunity to publish this Corrigendum. Furthermore, they apologize to the readership of the Journal for any inconvenience caused. [the original article was published in Oncology Reports 45: 77, 2021; DOI: 10.3892/or.2021.8028].

TOOLBOX: Strep­Tagged nano­assemblies of antibody­drug­conjugates (ADC) for modular and conditional cancer drugging

Herein, we describe TOOLBOX, a 3­step modular nano­assembly targeting system that permits the combinatorial exchange of antibody specificities and toxic payloads, introducing modularity in antibody­drug conjugate (ADC) manufacturing. TOOLBOX integrates 3 building blocks: i) a recombinant antibody fragment (that in the selected setting targets the proto­oncogene ERBB2) genetically fused to an 8 amino acid Strep­Tag®; ii) a multivalent protein adapter, called Strep­Tactin®; iii) two anticancer agents, e.g. DNA nanobinders and the maytansinoid DM1, both carrying a chemically attached Strep­Tag that reversibly turns them into inactive prodrugs. Stoichiometrically optimized complexes of Strep­Tagged antibody fragments and drugs, bridged by Strep­Tactin, were specifically uptaken by breast cancer cells expressing ERBB2, and this unexpectedly resulted in conditional prodrug reactivation. A promoter­reporter system showed that TOOLBOX inhibited downstream ERBB2 signaling not only in ERBB2­overexpressing/­amplified SK­BR­3 cells grown in vitro, but also in ERBB2­low/non­amplified BRC230 triple­negative breast carcinoma cells xenotransplanted in nude mice. Thus, TOOLBOX is a modular ADC­like nano­assembly platform for precision oncology.

Correction to "Pyridine Derivative of the Natural Alkaloid Berberine as Human Telomeric G4-DNA Binder: A Solution and Solid-State Study".

[This corrects the article DOI: 10.1021/acsmedchemlett.9b00516.].

Pyridine Derivative of the Natural Alkaloid Berberine as Human Telomeric G4-DNA Binder: A Solution and Solid-State Study.

Telomerase is an enzyme deputed to the maintenance of eukaryotic chromosomes; however, its overexpression is a recognized hallmark of many cancer forms. A viable route for the inhibition of telomerase in malignant cells is the stabilization of G-quadruplex structures (G4) at the 3' overhang of telomeres. Berberine has shown in this regard valuable G4 binding properties together with a significant anticancer activity and telomerase inhibition effects. Here, we focused on a berberine derivative featuring a pyridine containing side group at the 13th position. Such modification actually improves the binding toward telomeric G-quadruplexes and establishes a degree of selectivity in the interaction with different sequences. Moreover, the X-ray crystal structure obtained for the complex formed by the ligand and a bimolecular human telomeric quadruplex affords a better understanding of the 13-berberine derivatives behavior with telomeric G4 and allows to draw useful insights for the future design of derivatives with remarkable anticancer properties.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Abilities of berberine and chemically modified berberines to inhibit proliferation of pancreatic cancer cells.

Berberine (BBR) is a common nutraceutical consumed by millions worldwide. BBR has many different effects on human health, e.g., diabetes, diarrhea, inflammation and now more recently it has been proposed to have potent anti-cancer effects. BBR has been shown to suppress the growth of cancer cells more than normal cells. BBR has been proposed to exert its growth-inhibitory effects by many different biochemical mechanisms including: suppression of cell cycle progression, induction of reactive oxygen species, induction of apoptosis and autophagy and interactions with DNA potentially leading to DNA damage, and altered gene expression. Pancreatic cancer is a leading cancer worldwide associated with a poor prognosis. As our population ages, pancreatic cancer has an increasing incidence and will likely become the second leading cause of death from cancer. There are few truly-effective therapeutic options for pancreatic cancer. Surgery and certain chemotherapeutic drugs are used to treat pancreatic cancer patients. Novel approaches to treat pancreatic cancer patients are direly needed as they usually survive for less than a year after being diagnosed. In the following manuscript, we discuss the abilities of BBR and certain chemically-modified BBRs (NAX compounds) to suppress growth of pancreatic cancer cells.

Effects of the MDM-2 inhibitor Nutlin-3a on PDAC cells containing and lacking WT-TP53 on sensitivity to chemotherapy, signal transduction inhibitors and nutraceuticals.

Mutations at the TP53 gene are readily detected (approximately 50-75%) in pancreatic ductal adenocarcinoma (PDAC) patients. TP53 was previously thought to be a difficult target as it is often mutated, deleted or inactivated on both chromosomes in certain cancers. In the following study, the effects of restoration of wild-type (WT) TP53 activity on the sensitivities of MIA-PaCa-2 pancreatic cancer cells to the MDM2 inhibitor nutlin-3a in combination with chemotherapy, targeted therapy, as well as, nutraceuticals were examined. Upon introduction of the WT-TP53 gene into MIA-PaCa-2 cells, which contain a TP53 gain of function (GOF) mutation, the sensitivity to the MDM2 inhibitor increased. However, effects of nutlin-3a were also observed in MIA-PaCa-2 cells lacking WT-TP53, as upon co-treatment with nutlin-3a, the sensitivity to certain inhibitors, chemotherapeutic drugs and nutraceuticals increased. Interestingly, co-treatment with nutlin-3a and certain chemotherapeutic drug such as irinotecan and oxaliplatin resulted in antagonistic effects in cells both lacking and containing WT-TP53 activity. These studies indicate the sensitizing abilities that WT-TP53 activity can have in PDAC cells which normally lack WT-TP53, as well as, the effects that the MDM2 inhibitor nutlin-3a can have in both cells containing and lacking WT-TP53 to various therapeutic agents.