Expression of Delta-like protein 4 in the human endometrium.

Activation of Delta-Notch signaling pathway promotes the development of the vascular system in embryo, normal adult tissues, and cancerous lesions. Delta and Notch genes are known to be expressed in endothelial cells, and little is known of their expression beyond the vascular system. The purpose of this study was to investigate whether Delta gene would be expressed in cells of the uterine endometrium. In this study, we found that the human endometrial cells expressed one of the Delta ligands, Delta-like 4 protein (Dll4). Dll4 was expressed in human endometrium in a spatiotemporal fashion. Immunohistochemistry studies showed the cytoplasm as well as membrane staining with apical localization both in the luminal and glandular epithelium and moderate diffuse staining in the cytoplasm of the stromal cells. Western blot analysis showed that the size of the endometrial Dll4 was identical to that in the human umbilical endothelial cells. The expression of Dll4 mRNA in human endometrial cells was quantitatively determined by real-time PCR. Dll4 mRNA expressed in the glandular epithelium showed large variations, and it was significantly elevated in the mid and late proliferative and early secretory endometrium. Endometrial stromal cells contained less Dll4 mRNA and had no clear correlation with the menstrual cycle. The effect of hormones was studied in the primary culture of isolated glandular epithelial and stromal cells. In glandular cells, estradiol had little effect, and medroxyprogesterone acetate significantly reduced the mRNAs compared with that of control. Relaxin induced the Dll4 mRNA. In stromal cells, both estradiol and medroxyprogesterone acetate reduced the Dll4 mRNA. To our knowledge, this is the first report of the expression of Dll4 in the endometrium. We propose that endometrial Dll4 may enhance the development of the endometrial microvascular system and facilitate the implantation of blastocyst in a fertile cycle.

Neurotensin and neurotensin receptors.

Neurotensin is a brain and gastrointestinal peptide that fulfils many central and peripheral functions through its interaction with specific receptors. Three subtypes of neurotensin receptors have been cloned. Two of them belong to the family of G protein-coupled receptors, whereas the third one is an entirely new type of neuropeptide receptor and is identical to gp95/sortilin, a 100 kDa-protein with a single transmembrane domain. In this review, the present knowledge regarding the molecular and pharmacological properties of the three cloned neurotensin receptors is summarized and the relationship between these receptors and the known pharmacological effects of neurotensin is discussed.

Sortilin/neurotensin receptor-3: a new tool to investigate neurotensin signaling and cellular trafficking?

The identification of gp95sortilin, a sorting protein, as being the 100 kDa neurotensin (NT) receptor, a non-G-protein coupled receptor, constitutes a new and interesting but intriguing step in the neuropeptide signaling as well as in cellular trafficking. The isolation of the same protein by three different experimental approaches sum up the complexity for researchers involved in the functional significance of the so-called sortilin/neurotensin receptor 3 (NTR3). This review will concentrate on the putative physiological and cellular roles of sortilin/NTR3 as most results so far have proposed hypothetical conclusions rather than concrete evidence.

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line.

Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major secretory protein of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human endometrial adenocarcinoma cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59-bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis-elements.(ABSTRACT TRUNCATED AT 250 WORDS)

Ligand-activated progesterone receptor isoform hPR-A is a stronger transactivator than hPR-B for the expression of IGFBP-1 (insulin-like growth factor binding protein-1) in human endometrial stromal cells.

In human endometrium, the levels of progesterone receptor (PR) isoforms hPR-A and hPR-B are differentially regulated during the reproductive cycle. Progesterone significantly increases the content of hPR-A, the predominant isoform in decidualized stromal cells (1). The purpose of this study was to determine the capacity of hPR-A and hPR-B to transactivate the progestin-dependent target gene in human endometrial stromal cells. We examined the effect of cotransfection of hPR-A or hPR-B on the expression of the human insulin-like growth factor binding protein-1 (IGFBP-1) in endometrial stromal cells. The primary culture of human endometrial stromal cells was transfected with the hPR-A or hPR-B expression vector and the IGFBP-1 promoter construct p275CAT, which contains two functional progesterone response elements (PRE1 and PRE2) in decidualized stromal cells. Medroxyprogesterone acetate (MPA) increased the promoter activities ranging from 1.2- to 27-fold in cells cotransfected with hPR-A or hPR-B in eight endometrial specimens. The promoter activity increased by the hPR-A was significantly higher than hPR-B (15 +/- 8 vs. 4 +/- 2, mean +/- SD; n = 8, P < 0.005). Site-specific mutation showed that the induced activity by hPR-A was mediated through the PRE1 and PRE2 sites. Addition of hPR-B reduced the effect of hPR-A. The high transactivation capacity of hPR-A was also activated by other ligands, progesterone, Org 2058, and norethindrone. These observations indicate that hPR-A is a stronger transactivator than hPR-B for the IGFBP-1 promoter in endometrial stromal cells. Previous studies have shown the progestin-dependent production of IGFBP-1 correlates with its mRNA levels and transcription rate. Thus, we have determined the effect of hPR-A and hPR-B on the production of IGFBP-1 in stromal cells treated with MPA. The production rate in cells uniformly infected with AdPRA (recombinant Ad5-directed PR expression system) was significantly higher (P < 0.001) than the rate in uninfected cells and in cells infected with AdPRB or AdCMV (the Ad5 viral expression vector). This result, in concert with the promoter analysis, provides evidence that hPR-A is a strong inducer for the chromosomal IGFBP-1 gene in endometrial stromal cells.

Targeting two-pore domain K(+) channels TREK-1 and TASK-3 for the treatment of depression: a new therapeutic concept.

Depression is a disease that is particularly frequent, affecting up to 20% of the population in Western countries. The origins of this pathology involve multiple genes as well as environmental and developmental factors leading to a disorder that remains difficult to treat. Several therapies for depression have been developed and these mainly target monoamine neurotransmitters. However, these treatments are not only associated with numerous adverse effects, but they are also ineffective for more than one-third of patients. Therefore, the need to develop new concepts to treat depression is crucial. Recently, studies using knockout mouse models have provided evidence for a crucial role of two members of the two-pore domain potassium channel (K2P ) family, tandem P-domain weak inward rectifying K(+) (TWIK)-related K(+) channel 1 (TREK-1) and TWIK-related acid-sensitive K(+) channel 3 (TASK-3) in the pathophysiology of depression. It is believed that TREK-1 and TASK-3 antagonists could lead to the development of new antidepressants. Herein, we describe the discovery of spadin, a natural peptide released from the maturation of the neurotensin receptor-3 (also known as sortilin), which specifically blocks the activity of the TREK-1 channel and displays particular antidepressant properties, with a rapid onset of action and the absence of adverse effects. The development of such molecules may open a new era in the field of psychiatry.

In vitro and in vivo regulation of synaptogenesis by the novel antidepressant spadin.

BACKGROUND AND PURPOSE: We have described a novel antidepressant peptide, spadin, that acts by blocking the TWIK-related-potassium channel, type 1 (TREK-1). Here, we examined possible mechanisms of action of spadin at both molecular and cellular levels. EXPERIMENTAL APPROACHES: Effects of spadin were measured in primary cultures of neurons or tissues from mice injected i.v. with spadin. Western blots, qPCR, histochemical and electrophysiological techniques were used. KEY RESULTS: In vitro, spadin increased neuronal membrane potential and activated both the MAPK and PI3K signalling pathways, in a time- and concentration-dependent manner. The latter pathway was involved in the protective effect of spadin against staurosporine-induced apoptosis. Also, spadin enhanced both mRNA expression and protein of two markers of synaptogenesis, the post-synaptic density protein of 95 kDalton (PSD-95) and synapsin. We confirmed these effects on synaptogenesis by the observation that spadin treatment significantly increased the proportion of mature spines in cortical neurons. Finally, in vivo injections of spadin led to a rapid increase in both mRNA expression and protein level of brain-derived neurotrophic factor (BDNF) in the hippocampus, confirming the antidepressant action of the peptide. We argue for a new role of spadin in synaptogenesis as both PSD-95 and synapsin mRNA expression and protein levels were further enhanced in the hippocampus, following treatment in vivo with the peptide. CONCLUSIONS AND IMPLICATIONS: These findings provide new mechanisms of action for the rapidly acting antidepressant peptide spadin by stimulating expression of BDNF and synaptic proteins, both in vitro and in vivo.

Astroglial Control of the Antidepressant-Like Effects of Prefrontal Cortex Deep Brain Stimulation.

Although deep brain stimulation (DBS) shows promising efficacy as a therapy for intractable depression, the neurobiological bases underlying its therapeutic action remain largely unknown. The present study was aimed at characterizing the effects of infralimbic prefrontal cortex (IL-PFC) DBS on several pre-clinical markers of the antidepressant-like response and at investigating putative non-neuronal mechanism underlying DBS action. We found that DBS induced an antidepressant-like response that was prevented by IL-PFC neuronal lesion and by adenosine A1 receptor antagonists including caffeine. Moreover, high frequency DBS induced a rapid increase of hippocampal mitosis and reversed the effects of stress on hippocampal synaptic metaplasticity. In addition, DBS increased spontaneous IL-PFC low-frequency oscillations and both raphe 5-HT firing activity and synaptogenesis. Unambiguously, a local glial lesion counteracted all these neurobiological effects of DBS. Further in vivo electrophysiological results revealed that this astrocytic modulation of DBS involved adenosine A1 receptors and K(+) buffering system. Finally, a glial lesion within the site of stimulation failed to counteract the beneficial effects of low frequency (30 Hz) DBS. It is proposed that an unaltered neuronal-glial system constitutes a major prerequisite to optimize antidepressant DBS efficacy. It is also suggested that decreasing frequency could heighten antidepressant response of partial responders.

Modulation of aromatase activity in human endometrial stromal cells by steroids, tamoxifen and RU 486.

The regulation of aromatase activity (AA) in human endometrial stromal cells by various steroids was studied in primary cell culture. Various progestins, but not androgens or glucocorticoids, stimulated AA. Medroxyprogesterone acetate (MPA) was the most potent progestin. Estrogen (E) alone did not change the activity but it potentiated the stimulation of AA by progestin. Biphasic regulation of AA by progestin was noted in both time- and dose-dependent manners. Endometrial AA was stimulated by MPA and reached the maximum rate between 2-5 days of incubation with subsequent decline of AA in prolonged culture. When stromal cells were treated with MPA (0.03 to 30 microM) for 3 days, AA was increased over the control at all the concentrations tested. The maximum was found at doses between 0.1-1 microM. The activities reduced steadily from the maximum stimulation to less than 50% when the concentration of MPA increased from 1-30 microM. In addition, initial treatment of stroma cells with MPA (1-3 days) resulted in further increase of activity after progestin withdrawal. The enhancement of the induction of AA by E did not alter the biphasic pattern regulated by progestin alone, i.e. E enhanced both the stimulation and the decay of AA. The time study of the effect of E showed that enhancement of AA required at least 10 h of incubation of E with MPA conditioned cells. The effect of E is dose dependent between 0.04-40 nM and shows the greatest effect in the presence of MPA between 0.01-1 microM. The optimal concentrations of E and progestin that stimulate AA in culture are similar to the plasma concentrations after pregnancy, suggesting that the physiological function of the endometrial aromatase is at the time of decidualization. The effects of antiprogestin, Ru 486, and antiestrogen, tamoxifen (TAM), on AA were studied. Ru 486 or TAM alone did not alter AA. Ru 486 inhibited the MPA stimulated AA in a dose-dependent manner suggesting that the effect of progestin may be mediated through a receptor mechanism. Enhancement, but no inhibitory effect, was observed when cells were treated with TAM + MPA and TAM + MPA + E. The effectiveness of Ru 486 to inhibit the induction of AA in endometrial cells may be of primary importance for contraception.

Effect of relaxin on aromatase activity in human endometrial stromal cells.

Previous studies have shown that the aromatase activity in human endometrial stromal cells was stimulated by progestin and enhanced by estrogen and forskolin (Fk), an agent that stimulates the accumulation of intracellular cAMP. Present study was undertaken to investigate whether any peptide hormone would affect endometrial aromatase activity. Stromal cells were isolated from normal proliferative and secretory endometria and cultured in nutrient medium. Porcine relaxin (RLX) was added to culture medium individually or in combination with medroxyprogesterone acetate (MPA) and estradiol (E2). Cells treated with RLX alone did not affect the aromatase activity. RLX, however, exerted a synergistic effect on aromatase activity in the presence of MPA or MPA plus E2. On the other hand, human CG, epidermal growth factor, human PRL, and insulin did not increase the aromatase activity in the presence or absence of MPA and E2 studied in a limited number of specimens. The progestin-dependent effect of RLX on aromatase activity was dose dependent indicating that the biological effect of RLX is mediated through a saturable mechanism. When RLX was added to MPA-pretreated cells, additional increase of aromatase activity was seen after 24 h incubation indicating that the action of RLX on stromal cells is not an acute effect. Antiprogestin, RU486, inhibited the stimulation of aromatase activity in both MPA and MPA plus RLX treated cells. RLX has either no effect or a moderate increase (up to 2-fold over the control) on intracellular cAMP content. On the other hand, Fk increased the intracellular cAMP level and enhanced the aromatase activity in the presence of progestin. Also RLX did not replace the effect of Fk since additional increase of aromatase activity was noted when stromal cells were incubated with MPA plus RLX plus Fk in comparison to MPA plus RLX or MPA plus Fk. These results suggest that the action of RLX on stromal cells may be mediated through an intracellular messenger independent of cAMP. Present studies provide evidence that RLX exerts a synergistic effect on aromatase activity in the presence of progestin in human endometrial stromal cells. It is evident that human endometrium is a target organ of RLX.

Differential internalization of somatostatin in COS-7 cells transfected with SST1 and SST2 receptor subtypes: a confocal microscopic study using novel fluorescent somatostatin derivatives.

A growing body of evidence suggests that neuropeptide binding to G protein-linked receptors may result in internalization of receptor-ligand complexes, followed by intracellular mobilization and degradation of the ligand into its target cells. Because of discrepant results in the literature concerning the occurrence of such a mechanism for the tetradecapeptide somatostatin (SRIF), we have reinvestigated this question by comparing the binding and internalization of iodinated and fluorescent derivatives of the metabolically stable analog of SRIF, [D-Trp8]SRIF, in COS-7 cells transfected with complementary DNA encoding the sst1 or sst2A receptor subtype. A series of fluoresceinyl and Bodipy fluorescent derivatives of [D-Trp8]SRIF-14 was purified by HPLC, analyzed for purity by mass spectrometry, and tested for biological activity in a membrane binding assay. Of the six compounds tested, fluoresceinyl and Bodipy derivatives labeled in position alpha (fluo-SRIF) retained high affinity for SRIF receptors. COS-7 cells transfected with complementary DNA encoding either sst1 or sst2A receptors both displayed specific, high affinity binding of iodinated and fluo-SRIF. At 4 C, the labeling was confined to the cell surface in both cell types, as indicated by the fact that it was entirely removable by a hypertonic acid wash and assumed a pericellular distribution in the confocal microscope. At 37 C, the fate of specifically bound ligand varied markedly according to the type of receptor transfected. In cells encoding the sst1 receptor, approximately 20% of specifically bound ligand was recovered in the acid-resistant (i.e. intracellular) fraction. This fraction remained clustered at the periphery of the cell, suggesting that it was being sequestered either within or immediately beneath the plasma membrane. By contrast, in cells transfected with sst2A receptors, up to 75% of specifically bound ligand was recovered inside the cells, where it clustered into small endosome-like particles. These particles increased in size and moved toward the nucleus with time, suggestive of receptor-ligand complexes proceeding down the endocytic pathway. These results demonstrate that neuropeptides may be processed differently depending on the subtype of receptor expressed in their target cells and suggest that these different processing patterns may reflect different modes of sensitization/desensitization and recycling of the receptors, and thereby of transmembrane signaling.

Intracellular dynamics of sst5 receptors in transfected COS-7 cells: maintenance of cell surface receptors during ligand-induced endocytosis.

Internalization of G protein-coupled receptors is crucial for resensitization of phosphorylation-desensitized receptors, but also for their long term desensitization through sequestration. To elucidate the mechanisms regulating cell surface availability of the somatostatin (SRIF) receptor subtype sst5, we characterized its internalization properties in transfected COS-7 cells using biochemical, confocal microscopic, and electron microscopic techniques. Our results demonstrated rapid and efficient sequestration of specifically bound [125I]Tyr0-D-Trp8-SRIF (up to 45% of bound radioactivity). Combined immunocytochemical detection of sst5 and visualization of a fluorescent SRIF analog by confocal microscopy revealed that whereas the internalized ligand progressively clustered toward the cell center with time, immunoreactive receptors remained predominantly associated with the plasma membrane. The preservation of cell surface receptors was confirmed by binding experiments on whole cells revealing a lack of saturability of [125I]Tyr0-D-Trp8-SRIF binding at 37 C. Binding was rendered saturable by the drug monensin, showing that receptor recycling played a key role in the preservation of cell surface receptors. Electron microscopy demonstrated that in addition to receptor recycling, internalization of receptor-ligand complexes triggered a massive recruitment of sst5 receptor molecules from intracellular stores to the membrane. This combination of recycling and recruitment of spare receptors may protect sst5 from long term down-regulation through sequestration and, therefore, facilitate extended SRIF signaling.

Estrogen synthesis in normal and malignant human endometrium.

The ability of human endometrium to synthesize estrogen from testosterone (T) was investigated. Normal and malignant endometrial specimens were incubated in a complete nutrient medium with 1 muC/ml (approximately 10 pmol/ml) of [3H]T for 20 hrs. Various estrogens: estrone (E1), estradiol (E2), estrone sulfate (E1S), and estradiol-3-sulfate (E2S) were isolated from cultured tissue and medium. The capacity of aromatization, expressed in pmol of estrogen formed/g of tissue, of proliferative endometria was found to be significantly higher than that of secretory endometria (prol. n=12, 0.53 +/- 0.21, vs sec. n=13, 0.15 +/- 0.09, mean +/- s.d., P less than 0.005). In nine cancer endometrial specimens studied, the estrogen produced varied from 0.3 to 15 pmol/g of tissue. These studies represent the first evidence that human endometrium is capable of synthesizing estrogens from delta 4 androgens at a concentration similar to plasma level. The changes of the capacity of aromatization during the two phases of the menstrual cycle indicate that the estrogen synthesis in endometrium is apparently regulated by hormones. The presence of aromatase in cancer endometria may play an important role in promoting the cell growth in estrogen sensitive endometrial cancer.

Differential effects of progestin and relaxin on the synthesis and secretion of immunoreactive prolactin in long term culture of human endometrial stromal cells.

PRL secretion from human endometrium is a continuous process extending from the luteal phase of the menstrual cycle throughout the entire gestational stage. We have developed a long term primary cell culture system to elucidate the hormonal requirements for this sustained production of PRL. The effects of medroxyprogesterone acetate (MPA), progesterone, and relaxin (RLX) on the production of immunoreactive PRL were investigated. MPA stimulated cell growth and PRL production rate during days 5-20 of culture. Progesterone was 20-40% less effective in stimulating PRL than MPA. Stimulation of PRL was continued 1-2 weeks after MPA withdrawal. Relaxin did not promote cell growth. However, it induced the PRL production which fluctuated during the long term culture. The maximal response to RLX was 2- to 3-fold higher or similar to that of MPA. Only five of nine endometrial specimens examined responded to RLX alone. The effect of MPA plus RLX was significantly greater than that of MPA or RLX alone. The highest production rate was shown in cells treated with MPA and then RLX in sequence. After a month of culture, the production rates (micrograms of PRL per 0.1 mg cell DNA/day) under various culture conditions (A, control; B, MPA; C, MPA for 10-15 days and no hormone afterward; D, both MPA and RLX; and E, MPA and RLX in sequence) were: A, about 0-0.01 (n = 12); B, 2.5 +/- 0.9 (n = 8); C, 4.8 +/- 2.5 (n = 8); D, 5.7 +/- 3.0 (n = 5); and E, 11 +/- 3.7 (n = 7); mean +/- SD; n, number of specimens). Endometrial stromal cells were incubated with [35S]methionine, and [35S]immunoreactive PRL and other secretory proteins were analyzed on sodium dodecyl sulfate-polyacrylamide gel electrophoresis to characterize the size and isoforms of immunoreactive PRL. PRL was one of the five major secretory proteins (23-25K, 32K, 42K, 78K, and 150K daltons, sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing condition) induced by MPA and RLX in endometrial stromal cells. More than 90% of immunoreactive PRL was secreted into the medium. The apparent mol wt of immunoreactive PRL were 21K, 23K (the predominant size), and 25K daltons. Results obtained from the incorporation of [14C]glucosamine into immunoreactive PRL indicated that both 23K and 25K PRL contained glycosylated PRL. A 45K-dalton glycosylated immunoreactive PRL was also present in the culture medium.(ABSTRACT TRUNCATED AT 400 WORDS)

Identification and expression of a variant isoform of the levocabastine-sensitive neurotensin receptor in the mouse central nervous system.

This work describes the molecular cloning of a variant isoform of the low-affinity levocabastine-sensitive neurotensin receptor isolated from mouse brain. Although the corresponding mRNA encodes for a 282 amino acid protein unable to bind neurotensin after transient transfection in COS-7 cells, this non-functional neurotensin receptor is expressed in cerebral neocortex, cerebellum, olfactory bulb, striatum and hypothalamus with a level similar to that of the full-length low-affinity neurotensin receptor. By contrast, this receptor form is very weakly expressed in mesencephalon and absent in the pituitary, but is the major product in the spinal cord.

Pharmacological properties of the mouse neurotensin receptor 3. Maintenance of cell surface receptor during internalization of neurotensin.

We recently reported the molecular identification of a new type of receptor for the neuropeptide neurotensin (NT), the neurotensin receptor 3 (NTR3), identical to sortilin, which binds receptor-associated protein. Here, we demonstrate that the cloned mouse NTR3 is expressed on the plasma membrane of transfected COS-7 cells. The mouse NTR3 is detectable by photoaffinity labeling and immunoblotting at the cell surface as a 100 kDa N-glycosylated protein. Biochemical analysis and confocal microscopic imaging clearly indicate that NT is efficiently internalized after binding to NTR3, and that despite this internalization, the amount of receptor present on the cell surface is maintained.

Regional and cellular distribution of low affinity neurotensin receptor mRNA in adult and developing mouse brain.

Levocabastine-sensitive neurotensin receptor (NTRL) mRNAs were localized by in situ hybridization in adult and developing mouse brain. NTRL hybridization signal was widely distributed throughout the neuraxis. The highest concentrations of NTRL mRNA were detected in the olfactory system, olfactory tubercle, cerebral and cerebellar cortices, hippocampal formation, and selective hypothalamic nuclei. Moderate to dense hybridization signal was also observed in association with a variety of auditory, visual, and somatosensory relay nuclei, suggesting that the NTRL might be involved in a widespread modulation of primary afferent pathways. Finally a high expression of NTRL was evident in brainstem structures implicated in descending antinociceptive influences (e.g., the periaqueductal gray, nucleus raphe magnus, gigantocellular reticular nucleus, pars alpha, and lateral paragigantocellular nucleus) consistent with the proposed mediation of NT-induced analgesia by the NTRL. Although most of the regions found here to express NTRL mRNA were previously reported to be devoid of mRNA encoding the high affinity NT receptor (NTRH), a few areas (e.g., the anterior olfactory nucleus, medial septum, diagonal band of Broca, reticular thalamic nucleus, suprachiasmatic hypothalamic nucleus, and pontine nucleus) were enriched in both receptor subtypes, suggesting a possible coexpression of these receptors by the same cells. Ontogenic studies revealed that in the mouse brain, NTRL mRNA was detected only from postnatal day 14 and did not reach adulthood concentrations before day 30. In cerebral cortex, the developmental increase in NTRL expression was correlated over time with the decrease in NTRH expression previously documented in the rat, suggesting a progressive takeover of the latter by the former for transduction of the effects of NT in this structure.

Pharmacological, molecular and functional characterization of glial neurotensin receptors.

The pharmacological properties, molecular identity and physiopathological regulation of neurotensin receptors expressed by central astrocytes were investigated in primary glial cultures and sections from the adult rat brain. Binding experiments carried out on astrocytes in culture revealed the presence of a single apparent class of neurotensin binding sites. These sites bound [125]neurotensin with an affinity (6 nM) comparable to that of the recently cloned NT2 low-affinity receptor expressed in transfected cells. The glial receptor was sensitive to the antihistamine, levocabastine, but less so than the NT2 site expressed in heterologous expression systems, suggesting the presence of an additional site or a differential coupling of the NT2 receptor in glia. Reverse transcription-polymerase chain reaction experiments demonstrated that both NT2 and NT3 neurotensin receptor sub-types were in fact expressed by cortical glial cells in culture. Confocal microscopic visualization of specifically bound fluorescent neurotensin indicated that this expression concerned only a sub-population of astrocytes in culture, in conformity with earlier reports of a heterogeneous expression of neuropeptides and their receptors by glial cells. To further investigate the functionality of NT2 receptors expressed in astrocytes, dual immunohistochemical labeling of glial fibrillary acidic protein and in situ hybridization of NT2 messenger RNA was performed on sections of normal and lesioned rat brain. In sections from normal brain, only a small subset of immunolabeled astrocytes hybridized NT2 messenger RNA. By contrast, in sections of stab-wounded rat brains, there was a marked increase in the number of NT2-hybridizing astrocytes in the surround of the lesion. Furthermore, NT2 expression within immunopositive reactive astrocytes was significantly enhanced as compared to immunolabeled glial cells in the brain of control animals. These results indicate that NT2 receptor expression is up-regulated during astrocytic reaction, suggesting that NT2 receptors may play a role in regulating glial response to injury.

Distribution of neurotensin binding sites in rat brain: a light microscopic radioautographic study using monoiodo [125I]Tyr3-neurotensin.

The topographic distribution of specifically labeled neurotensin binding sites was examined by light microscopic radioautography in rat brain sections incubated with monoiodo [125I]Tyr3-neurotensin. Preliminary experiments indicated that under the present experimental conditions [125I]neurotensin specifically binds to a single apparent population of sites with a dissociation constant of 7.7 +/- 0.3 nM, and that fixation of the labeled sections with glutaraldehyde ensures regionally proportional retention of more than 70% of bound [125I]neurotensin molecules. High concentrations of [125I]neurotensin binding sites were detected in the olfactory bulb and tubercle, parts of the neocortex, the lateral septum, the diagonal band of Broca, the caudate putamen, the amygdala, the dentate gyrus, the anterior dorsal nucleus of the thalamus, the suprachiasmatic nucleus of the hypothalamus, the medial habenula, the zona incerta, the substantia nigra and the ventral tegmental area. In certain areas, such as in the diagonal band of Broca, the substantia innominata, the nucleus basalis and the pars compacta of the substantia nigra, discrete accumulations of silver grains were apparent over neuronal perikarya and their proximal dendrites. In most areas, however, the label appeared more or less uniformly distributed over nerve cell bodies and surrounding neuropil. In several instances, the labeling conformed with the distribution of cell bodies of origin and terminal aborizations of specific projection systems, suggesting that neurotensin receptors might be distributed both proximally and distally on the plasma membrane of certain neurons. Such putative "neurotensinoceptive" projection systems might involve part of the mesostriatal, mesocortical and mesolimbic dopamine systems, as well as the raphe-prosencephalic serotonin system and the habenulo-interpeduncular and basal forebrain-cortical cholinergic systems. Finally, areas of dense [125I]neurotensin labeling often corresponded to zones previously shown to exhibit intense acetylcholinesterase staining, suggesting the existence of a possible link between the expression of neurotensin binding sites and that of acetylcholinesterase in certain neuronal populations.

Partial characterization of the CCAAT box in the promoter of the hLGFBP-1 gene: interaction with negatively acting transcription factors in decidualized human endometrial stromal cells.

The CCAAT cis-element and its adjacent DNA sequence (-82 to -52 bp) in the human insulin-like growth factor binding protein-1 gene (IGFBP-1) promoter are active in both decidualized human endometrial stromal cells and HepG2 cells. In HepG2 cells, CCAAT activity is mediated by interacting with hepatocyte nuclear factor, HNF-1. In endometrial cells, this region is protected by the nuclear extracts of endometrial decidual cells, however, the transactivator which interacts with the region has not been identified. This study was carried out to characterize and identify the stromal/decidual nuclear proteins that interact with the IGFBP-1 CCAAT motif. Gel shift analysis showed that the CCAAT motif (-82 to -52 bp) formed three specific complexes (CI, CII, and CIII) by extracts from human endometrial decidual or stromal cells. The intensity of CIII formed by the nuclear extracts of decidual cells was less compared to that formed by stromal cells whereas CI/CII was found to be opposite. To evaluate the transcription factors that bind to this region, a number of known CCAAT binding proteins were tested. Among them, the CCAAT binding proteins NF-Y (alpha2(1) collagen promoter CCAAT binding protein) and CBF (hsp70 promoter CCAAT binding protein), were characterized by the gel shift assay. The NF-Y consensus binding sequence (the alpha2(1) collagen promoter) and NF-YA,B antibody abolished or shifted CIII. Although the CBF consensus binding sequence (the hsp70 promoter) eliminated all three complexes, the antibody to CBF had no effect on all three complexes. The nuclear extracts of the endometrial stromal/decidual cells did not form a band corresponding to the HNF-1/CCAAT complex. These results indicate that the CCAAT motif binds to NF-Y and the CI/CII binding protein (remains to be identified) but not HNF-1 in endometrium. Systematic mutation in the CCAAT motif showed that NF-Y(CIII binding protein) bound to the 12 bp sequence GGCGCTGCCAAT(-79 to -68 bp) and the CI/CII binding protein bound to 9 bp, TGCCAATCA(-74 to -66 bp). These findings indicate that the CCAAT motif is a composite element. The CCAAT mediated function was analyzed in decidualized endometrial stromal cells. Mutations in the CCAAT motif increased the promoter activity. The maximum activity was found in mutants which abolished the NF-Y complex. The CCAAT core sequence mutants in which both CIII and CI/CII were abolished, also increased the promoter activity. Results indicated that NF-Y and the CI/CII binding protein, yet to be identified, interact with the composite CCAAT element in the IGFBP-1 promoter to repress the promoter activity in endometrial decidual cells.