Analysis of the diverse antigenic landscape of the malaria protein RH5 identifies a potent vaccine-induced human public antibody clonotype.

The highly conserved and essential Plasmodium falciparum reticulocyte-binding protein homolog 5 (PfRH5) has emerged as the leading target for vaccines against the disease-causing blood stage of malaria. However, the features of the human vaccine-induced antibody response that confer highly potent inhibition of malaria parasite invasion into red blood cells are not well defined. Here, we characterize 236 human IgG monoclonal antibodies, derived from 15 donors, induced by the most advanced PfRH5 vaccine. We define the antigenic landscape of this molecule and establish that epitope specificity, antibody association rate, and intra-PfRH5 antibody interactions are key determinants of functional anti-parasitic potency. In addition, we identify a germline IgG gene combination that results in an exceptionally potent class of antibody and demonstrate its prophylactic potential to protect against P. falciparum parasite challenge in vivo. This comprehensive dataset provides a framework to guide rational design of next-generation vaccines and prophylactic antibodies to protect against blood-stage malaria.

Antibody escape of SARS-CoV-2 Omicron BA.4 and BA.5 from vaccine and BA.1 serum.

The Omicron lineage of SARS-CoV-2, which was first described in November 2021, spread rapidly to become globally dominant and has split into a number of sublineages. BA.1 dominated the initial wave but has been replaced by BA.2 in many countries. Recent sequencing from South Africa's Gauteng region uncovered two new sublineages, BA.4 and BA.5, which are taking over locally, driving a new wave. BA.4 and BA.5 contain identical spike sequences, and although closely related to BA.2, they contain further mutations in the receptor-binding domain of their spikes. Here, we study the neutralization of BA.4/5 using a range of vaccine and naturally immune serum and panels of monoclonal antibodies. BA.4/5 shows reduced neutralization by the serum from individuals vaccinated with triple doses of AstraZeneca or Pfizer vaccine compared with BA.1 and BA.2. Furthermore, using the serum from BA.1 vaccine breakthrough infections, there are, likewise, significant reductions in the neutralization of BA.4/5, raising the possibility of repeat Omicron infections.

Potent cross-reactive antibodies following Omicron breakthrough in vaccinees.

Highly transmissible Omicron variants of SARS-CoV-2 currently dominate globally. Here, we compare neutralization of Omicron BA.1, BA.1.1, and BA.2. BA.2 RBD has slightly higher ACE2 affinity than BA.1 and slightly reduced neutralization by vaccine serum, possibly associated with its increased transmissibility. Neutralization differences between sub-lineages for mAbs (including therapeutics) mostly arise from variation in residues bordering the ACE2 binding site; however, more distant mutations S371F (BA.2) and R346K (BA.1.1) markedly reduce neutralization by therapeutic antibody Vir-S309. In-depth structure-and-function analyses of 27 potent RBD-binding mAbs isolated from vaccinated volunteers following breakthrough Omicron-BA.1 infection reveals that they are focused in two main clusters within the RBD, with potent right-shoulder antibodies showing increased prevalence. Selection and somatic maturation have optimized antibody potency in less-mutated epitopes and recovered potency in highly mutated epitopes. All 27 mAbs potently neutralize early pandemic strains, and many show broad reactivity with variants of concern.

Antibody evasion by the P.1 strain of SARS-CoV-2.

Terminating the SARS-CoV-2 pandemic relies upon pan-global vaccination. Current vaccines elicit neutralizing antibody responses to the virus spike derived from early isolates. However, new strains have emerged with multiple mutations, including P.1 from Brazil, B.1.351 from South Africa, and B.1.1.7 from the UK (12, 10, and 9 changes in the spike, respectively). All have mutations in the ACE2 binding site, with P.1 and B.1.351 having a virtually identical triplet (E484K, K417N/T, and N501Y), which we show confer similar increased affinity for ACE2. We show that, surprisingly, P.1 is significantly less resistant to naturally acquired or vaccine-induced antibody responses than B.1.351, suggesting that changes outside the receptor-binding domain (RBD) impact neutralization. Monoclonal antibody (mAb) 222 neutralizes all three variants despite interacting with two of the ACE2-binding site mutations. We explain this through structural analysis and use the 222 light chain to largely restore neutralization potency to a major class of public antibodies.

Reduced neutralization of SARS-CoV-2 B.1.1.7 variant by convalescent and vaccine sera.

SARS-CoV-2 has caused over 2 million deaths in little over a year. Vaccines are being deployed at scale, aiming to generate responses against the virus spike. The scale of the pandemic and error-prone virus replication is leading to the appearance of mutant viruses and potentially escape from antibody responses. Variant B.1.1.7, now dominant in the UK, with increased transmission, harbors 9 amino acid changes in the spike, including N501Y in the ACE2 interacting surface. We examine the ability of B.1.1.7 to evade antibody responses elicited by natural SARS-CoV-2 infection or vaccination. We map the impact of N501Y by structure/function analysis of a large panel of well-characterized monoclonal antibodies. B.1.1.7 is harder to neutralize than parental virus, compromising neutralization by some members of a major class of public antibodies through light-chain contacts with residue 501. However, widespread escape from monoclonal antibodies or antibody responses generated by natural infection or vaccination was not observed.

The antigenic anatomy of SARS-CoV-2 receptor binding domain.

Antibodies are crucial to immune protection against SARS-CoV-2, with some in emergency use as therapeutics. Here, we identify 377 human monoclonal antibodies (mAbs) recognizing the virus spike and focus mainly on 80 that bind the receptor binding domain (RBD). We devise a competition data-driven method to map RBD binding sites. We find that although antibody binding sites are widely dispersed, neutralizing antibody binding is focused, with nearly all highly inhibitory mAbs (IC50 < 0.1 µg/mL) blocking receptor interaction, except for one that binds a unique epitope in the N-terminal domain. Many of these neutralizing mAbs use public V-genes and are close to germline. We dissect the structural basis of recognition for this large panel of antibodies through X-ray crystallography and cryoelectron microscopy of 19 Fab-antigen structures. We find novel binding modes for some potently inhibitory antibodies and demonstrate that strongly neutralizing mAbs protect, prophylactically or therapeutically, in animal models.

Reduced neutralization of SARS-CoV-2 B.1.617 by vaccine and convalescent serum.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has undergone progressive change, with variants conferring advantage rapidly becoming dominant lineages, e.g., B.1.617. With apparent increased transmissibility, variant B.1.617.2 has contributed to the current wave of infection ravaging the Indian subcontinent and has been designated a variant of concern in the United Kingdom. Here we study the ability of monoclonal antibodies and convalescent and vaccine sera to neutralize B.1.617.1 and B.1.617.2, complement this with structural analyses of Fab/receptor binding domain (RBD) complexes, and map the antigenic space of current variants. Neutralization of both viruses is reduced compared with ancestral Wuhan-related strains, but there is no evidence of widespread antibody escape as seen with B.1.351. However, B.1.351 and P.1 sera showed markedly more reduction in neutralization of B.1.617.2, suggesting that individuals infected previously by these variants may be more susceptible to reinfection by B.1.617.2. This observation provides important new insights for immunization policy with future variant vaccines in non-immune populations.

De novo design of discrete, stable 310-helix peptide assemblies.

The α-helix is pre-eminent in structural biology1 and widely exploited in protein folding2, design3 and engineering4. Although other helical peptide conformations do exist near to the α-helical region of conformational space-namely, 310-helices and π-helices5-these occur much less frequently in protein structures. Less favourable internal energies and reduced tendencies to pack into higher-order structures mean that 310-helices rarely exceed six residues in length in natural proteins, and that they tend not to form normal supersecondary, tertiary or quaternary interactions. Here we show that despite their absence in nature, synthetic peptide assemblies can be built from 310-helices. We report the rational design, solution-phase characterization and an X-ray crystal structure for water-soluble bundles of 310-helices with consolidated hydrophobic cores. The design uses six-residue repeats informed by analysing 310-helical conformations in known protein structures, and incorporates α-aminoisobutyric acid residues. Design iterations reveal a tipping point between α-helical and 310-helical folding, and identify features required for stabilizing assemblies of 310-helices. This work provides principles and rules to open opportunities for designing into this hitherto unexplored region of protein-structure space.

Probing a Major DNA Weakness: Resolving the Groove and Sequence Selectivity of the Diimine Complex Λ-[Ru(phen)2 phi]2.

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Structural basis of outer membrane protein insertion by the BAM complex.

All Gram-negative bacteria, mitochondria and chloroplasts have outer membrane proteins (OMPs) that perform many fundamental biological processes. The OMPs in Gram-negative bacteria are inserted and folded into the outer membrane by the ß-barrel assembly machinery (BAM). The mechanism involved is poorly understood, owing to the absence of a structure of the entire BAM complex. Here we report two crystal structures of the Escherichia coli BAM complex in two distinct states: an inward-open state and a lateral-open state. Our structures reveal that the five polypeptide transport-associated domains of BamA form a ring architecture with four associated lipoproteins, BamB-BamE, in the periplasm. Our structural, functional studies and molecular dynamics simulations indicate that these subunits rotate with respect to the integral membrane ß-barrel of BamA to induce movement of the ß-strands of the barrel and promote insertion of the nascent OMP.

A four-helix bundle stores copper for methane oxidation.

Methane-oxidizing bacteria (methanotrophs) require large quantities of copper for the membrane-bound (particulate) methane monooxygenase. Certain methanotrophs are also able to switch to using the iron-containing soluble methane monooxygenase to catalyse methane oxidation, with this switchover regulated by copper. Methane monooxygenases are nature's primary biological mechanism for suppressing atmospheric levels of methane, a potent greenhouse gas. Furthermore, methanotrophs and methane monooxygenases have enormous potential in bioremediation and for biotransformations producing bulk and fine chemicals, and in bioenergy, particularly considering increased methane availability from renewable sources and hydraulic fracturing of shale rock. Here we discover and characterize a novel copper storage protein (Csp1) from the methanotroph Methylosinus trichosporium OB3b that is exported from the cytosol, and stores copper for particulate methane monooxygenase. Csp1 is a tetramer of four-helix bundles with each monomer binding up to 13 Cu(I) ions in a previously unseen manner via mainly Cys residues that point into the core of the bundle. Csp1 is the first example of a protein that stores a metal within an established protein-folding motif. This work provides a detailed insight into how methanotrophs accumulate copper for the oxidation of methane. Understanding this process is essential if the wide-ranging biotechnological applications of methanotrophs are to be realized. Cytosolic homologues of Csp1 are present in diverse bacteria, thus challenging the dogma that such organisms do not use copper in this location.

Structural basis for outer membrane lipopolysaccharide insertion.

Lipopolysaccharide (LPS) is essential for most Gram-negative bacteria and has crucial roles in protection of the bacteria from harsh environments and toxic compounds, including antibiotics. Seven LPS transport proteins (that is, LptA-LptG) form a trans-envelope protein complex responsible for the transport of LPS from the inner membrane to the outer membrane, the mechanism for which is poorly understood. Here we report the first crystal structure of the unique integral membrane LPS translocon LptD-LptE complex. LptD forms a novel 26-stranded ß-barrel, which is to our knowledge the largest ß-barrel reported so far. LptE adopts a roll-like structure located inside the barrel of LptD to form an unprecedented two-protein 'barrel and plug' architecture. The structure, molecular dynamics simulations and functional assays suggest that the hydrophilic O-antigen and the core oligosaccharide of the LPS may pass through the barrel and the lipid A of the LPS may be inserted into the outer leaflet of the outer membrane through a lateral opening between strands ß1 and ß26 of LptD. These findings not only help us to understand important aspects of bacterial outer membrane biogenesis, but also have significant potential for the development of novel drugs against multi-drug resistant pathogenic bacteria.

Bulk changes in posterior scleral collagen microstructure in human high myopia.

Purpose: We aimed to characterize any bulk changes in posterior scleral collagen fibril bundle architecture in human eyes with high myopia. Methods: Wide-angle X-ray scattering (WAXS) was employed to map collagen orientation at 0.5 mm × 0.5 mm spatial intervals across the posterior sclera of seven non-myopic human eyes and three eyes with high myopia (>6D of refractive error). At each sampled point, WAXS provided thickness-averaged measures of the angular distribution of preferentially aligned collagen fibrils within the tissue plane and the anisotropic proportion (the ratio of preferentially aligned to total collagen scatter). Results: Non-myopic specimens featured well-conserved microstructural features, including strong uniaxial collagen alignment along the extraocular muscle insertion sites of the mid-posterior sclera and a highly anisotropic annulus of collagen circumscribing the nerve head in the peripapillary sclera. All three myopic specimens exhibited notable alterations in the peripapillary sclera, including a partial loss of circumferential collagen alignment and a redistribution of the normally observed regional pattern of collagen anisotropic proportion. Linear mixed-model analysis indicated that the mean fiber angle deviation from the circumferential orientation in the peripapillary sclera of highly myopic eyes (23.9° ± 18.2) was statistically significantly higher than that of controls (17.9° ± 12.0; p<0.05). Conclusions: Bulk alterations in the normal posterior scleral collagen microstructure occur in human eyes with high myopia. These changes could reflect remodeling of the posterior sclera during axial lengthening and/or a mechanical adaption to tissue stresses induced by fluid pressure or eye movements that may be exacerbated in enlarged eyes.

Exploiting Microbeams for Membrane Protein Structure Determination.

A reproducible, and sample independent means of predictably obtaining large, well-ordered crystals has proven elusive in macromolecular crystallography. In the structure determination pipeline, crystallisation often proves to be a rate-limiting step, and the process of obtaining even small or badly ordered crystals can prove time-consuming and laborious. This is particularly true in the field of membrane protein crystallography and this is reflected in the limited number of unique membrane protein structures deposited in the protein data bank (less than 650 by June 2016 - http://blanco.biomol.uci.edu/mpstruc ). Over recent years the requirement for, and time and cost associated with obtaining, large crystals has been partially alleviated through the development of beamline instrumentation allowing data collection, and structure solution, from ever-smaller crystals. Advances in several areas have led to a step change in what might be considered achievable during a synchrotron trip over the last decade. This chapter will briefly review the current status of the field, the tools available to ease data collection and processing, and give some examples of exploitation of these for membrane protein microfocus macromolecular crystallography.

Structural model for covalent adhesion of the Streptococcus pyogenes pilus through a thioester bond.

The human pathogen Streptococcus pyogenes produces pili that are essential for adhesion to host surface receptors. Cpa, the adhesin at the pilus tip, was recently shown to have a thioester-containing domain. The thioester bond is believed to be important in adhesion, implying a mechanism of covalent attachment analogous to that used by human complement factors. Here, we have characterized a second active thioester-containing domain on Cpa, the N-terminal domain of Cpa (CpaN). Expression of CpaN in Escherichia coli gave covalently linked dimers. These were shown by x-ray crystallography and mass spectrometry to comprise two CpaN molecules cross-linked by the polyamine spermidine following reaction with the thioester bonds. This cross-linked CpaN dimer provides a model for the covalent attachment of Cpa to target receptors and thus the streptococcal pilus to host cells. Similar thioester domains were identified in cell wall proteins of other Gram-positive pathogens, suggesting that thioester domains are more widely used and provide a mechanism of adhesion by covalent bonding to target molecules on host cells that mimics that used by the human complement system to eliminate pathogens.

Characterization of the proline-utilization pathway in Mycobacterium tuberculosis through structural and functional studies.

The proline-utilization pathway in Mycobacterium tuberculosis (Mtb) has recently been identified as an important factor in Mtb persistence in vivo, suggesting that this pathway could be a valuable therapeutic target against tuberculosis (TB). In Mtb, two distinct enzymes perform the conversion of proline into glutamate: the first step is the oxidation of proline into Δ(1)-pyrroline-5-carboxylic acid (P5C) by the flavoenzyme proline dehydrogenase (PruB), and the second reaction involves converting the tautomeric form of P5C (glutamate-γ-semialdehyde) into glutamate using the NAD(+)-dependent Δ(1)-pyrroline-5-carboxylic dehydrogenase (PruA). Here, the three-dimensional structures of Mtb-PruA, determined by X-ray crystallography, in the apo state and in complex with NAD(+) are described at 2.5 and 2.1 Šresolution, respectively. The structure reveals a conserved NAD(+)-binding mode, common to other related enzymes. Species-specific conformational differences in the active site, however, linked to changes in the dimer interface, suggest possibilities for selective inhibition of Mtb-PruA despite its reasonably high sequence identity to other PruA enzymes. Using recombinant PruA and PruB, the proline-utilization pathway in Mtb has also been reconstituted in vitro. Functional validation using a novel NMR approach has demonstrated that the PruA and PruB enzymes are together sufficient to convert proline to glutamate, the first such demonstration for monofunctional proline-utilization enzymes.

A slow-forming isopeptide bond in the structure of the major pilin SpaD from Corynebacterium diphtheriae has implications for pilus assembly.

The Gram-positive organism Corynebacterium diphtheriae, the cause of diphtheria in humans, expresses pili on its surface which it uses for adhesion and colonization of its host. These pili are covalent protein polymers composed of three types of pilin subunit that are assembled by specific sortase enzymes. A structural analysis of the major pilin SpaD, which forms the polymeric backbone of one of the three types of pilus expressed by C. diphtheriae, is reported. Mass-spectral and crystallographic analysis shows that SpaD contains three internal Lys-Asn isopeptide bonds. One of these, shown by mass spectrometry to be located in the N-terminal D1 domain of the protein, only forms slowly, implying an energy barrier to bond formation. Two crystal structures, of the full-length three-domain protein at 2.5 Å resolution and of a two-domain (D2-D3) construct at 1.87 Å resolution, show that each of the three Ig-like domains contains a single Lys-Asn isopeptide-bond cross-link, assumed to give mechanical stability as in other such pili. Additional stabilizing features include a disulfide bond in the D3 domain and a calcium-binding loop in D2. The N-terminal D1 domain is more flexible than the others and, by analogy with other major pilins of this type, the slow formation of its isopeptide bond can be attributed to its location adjacent to the lysine used in sortase-mediated polymerization during pilus assembly.

Correction: Re-pairing DNA: binding of a ruthenium phi complex to a double mismatch.

[This corrects the article DOI: 10.1039/D4SC01448K.].

Re-pairing DNA: binding of a ruthenium phi complex to a double mismatch.

We report a crystal structure at atomic resolution (0.9 Å) of a ruthenium complex bound to a consecutive DNA double mismatch, which results in a TA basepair with flipped out thymine, together with the formation of an adenine bulge. The structure shows a form of metalloinsertion interaction of the Λ-[Ru(phen)2phi]2+ (phi = 9,10-phenanthrenediimine) complex at the bulge site. The metal complex interacts with the DNA via the major groove, where specific interactions between the adenines of the DNA and the phen ligands of the complex are formed. One Δ-[Ru(phen)2phi]2+ complex interacts via the minor groove, which shows sandwiching of its phi ligand between the phi ligands of the other two ruthenium complexes, and no interaction of its phen ligands with DNA. To our knowledge, this binding model represents a new form of metalloinsertion in showing major rather than minor groove insertion.