N6-Methyladenosine (m6A) Sequencing Reveals Heterodera glycines-Induced Dynamic Methylation Promoting Soybean Defense.

Unraveling the intricacies of soybean cyst nematode (Heterodera glycines) race 4 resistance and susceptibility in soybean breeding lines-11-452 (highly resistant) and Dongsheng1 (DS1, highly susceptible)-was the focal point of this study. Employing cutting-edge N6-methyladenosine (m6A) and RNA sequencing techniques, we delved into the impact of m6A modification on gene expression and plant defense responses. Through the evaluation of nematode development in both resistant and susceptible roots, a pivotal time point (3 days postinoculation) for m6A methylation sequencing was identified. Our sequencing data exhibited robust statistics, successful soybean genome mapping, and prevalent m6A peak distributions, primarily in the 3' untranslated region and stop codon regions. Analysis of differential methylation peaks and differentially expressed genes revealed distinctive patterns between resistant and susceptible genotypes. In the highly resistant line (11-452), key resistance and defense-associated genes displayed increased expression coupled with inhibited methylation, encompassing crucial players such as R genes, receptor kinases, and transcription factors. Conversely, the highly susceptible DS1 line exhibited heightened expression correlated with decreased methylation in genes linked to susceptibility pathways, including Mildew Locus O-like proteins and regulatory elements affecting defense mechanisms. Genome-wide assessments, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses, and differential methylation peak/differentially expressed gene overlap emphasized the intricate interplay of m6A modifications, alternative splicing, microRNA, and gene regulation in plant defense. Protein-protein interaction networks illuminated defense-pivotal genes, delineating divergent mechanisms in resistant and susceptible responses. This study sheds light on the dynamic correlation between methylation, splicing, and gene expression, providing profound insights into plant responses to nematode infection.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

Determination of the basic optical parameters of ZnSnN(2).

Polycrystalline ZnSnN(2) thin films were successfully prepared by DC magnetron sputtering at room temperature. Both the as-deposited and annealed films showed n-type conduction, with electron concentration varying between 1.6×10(18) and 2.3×10(17) cm(-3) and the maximum mobility of 3.98 cm(2) V(-1) s(-1). The basic optical parameters such as the refraction index, extinction coefficient, and absorption coefficient were precisely determined through the spectroscopic ellipsometry measurement and analysis. The optical bandgap of the ZnSnN(2)films was calculated to around 1.9 eV, with the absorption coefficient greater than 10(4) cm(-1) at wavelengths less than 845 nm. The easy-fabricated ZnSnN(2) possesses a sound absorption coefficient ranging from the ultraviolet through visible light and into the near-infrared, comparable to some typical photovoltaic materials such as GaAs, CdTe, and InP.

Alveolar ridge preservation with deproteinized bovine bone graft and collagen membrane and delayed implants.

To evaluate clinically and radiographically an alveolar ridge, preservation technique with deproteinized bovine bone graft and absorbable collagen membrane and then restoration with delayed implants were done. The study included 30 patients. The trial group's sockets were filled with deproteinized bovine bone graft (Bio-Oss) and covered with absorbable collagen membrane (Bio-Gide). The control group's sockets healed without any treatment. Panoramic radiograph and computed tomography were taken immediately after graft and 3 and 6 months later to evaluate the height, width, and volume change of the alveolar ridge bone. Dental implants were inserted in all sockets at 6 months, and osseointegration condition was evaluated in the following 12 months. All sockets healed uneventfully. In the trial group, the mean (SD) height reduction of the alveolar ridge bone was 1.05 (0.24) mm at 3 months and 1.54 (0.25) mm at 6 months. The width reduction was 1.11 (0.13) mm at 3 months and 1.84 (0.35) mm at 6 months. Bone volume reduction was 193.79 (21.47) mm at 3 months and 262.06 (33.08) mm at 6 months. At the same trend, in the control group, the bone height reduction was 2.12 (0.15) mm at 3 months and 3.26 (0.29) mm at 6 months. The width reduction was 2.72 (0.19) mm at 3 months and 3.56 (0.28) mm at 6 months. Bone volume reduction was 252.19 (37.21) mm at 3 months and 342.32 (36.41) mm at 6 months. There was a significant difference in alveolar ridge bone height, width, and volume reduction in the 2 groups. The osseointegration condition had no significant difference between the 2 groups. This study suggested that the deproteinized bovine bone graft and absorbable collagen membrane were beneficial to preserve the alveolar ridge bone and had no influence on the osseointegration of delayed implant.

Full-Length Transcriptome Analysis of Soybean Cyst Nematode (Heterodera glycines) Reveals an Association of Behaviors in Response to Attractive pH and Salt Solutions with Activation of Transmembrane Receptors, Ion Channels, and Ca2+ Transporters.

Soybean cyst nematode (Heterodera glycines Ichinohe), a devastating pathogen in soybean, was chosen as a model system to investigate nematode behavior and gene expression changes in response to acidic and basic pH and salt signals (pH 4.5, 5.25, 8.6, and 10 and NaCl) through full-length transcriptome sequencing of 18 samples. An average of 4.36 Gbp of clean reads per sample were generated, and 3972 novel genes and 29,529 novel transcripts were identified. Sequence structural variation during or after transcription may be associated with the nematode's behavioral response. The functional analysis of 1817/4962 differentially expressed genes/transcripts showed that signal transduction pathways, including transmembrane receptors, ion channels, and Ca2+ transporters, were activated, but pathways involved in nematode development (e.g., ribosome) and energy production (e.g., oxidative phosphorylation) were inhibited. A corresponding model was established. Our findings suggest that these receptors and ion channels might be potential targets for nematicides or drug discovery.

Secondary healing after removal of large keratocystic odontogenic tumor in the mandible: enucleation followed by open packing of iodoform gauze.

PURPOSE: The aim of this retrospective study was to present the findings of an open packing method after enucleation of large keratocystic odontogenic tumors (KCOTs) in the mandible. PATIENTS AND METHODS: We performed a retrospective case series study of 27 patients with KCOTs larger than 5 cm treated at our institution between September 2003 and September 2008. A conservative surgical treatment was applied, which involved enucleation of the primary lesion and open packing of the residual osseous defect with iodoform gauze for secondary healing. Bone regeneration, tumor recurrence, and surgical complications were observed and analyzed. We used the χ(2) test and Pearson correlation coefficient for statistical analysis. RESULTS: The postoperative follow-up time was 52.3 months on average (range, 24 to 84 months). The packing gauze was changed every 2 weeks after enucleation, and the total duration for packing was 10.2 months on average (range, 7-15 months). Bone regeneration and satisfactory secondary healing were observed clinically and radiographically after treatment. Only 1 case had a recurrence 6 months after initial treatment, which was attributed to insufficient bony unroofing during enucleation. The recurrent lesion was re-treated by the same method, and no recurrence occurred in the following 6 years. No serious complications from this method of treatment were observed. No significant variables were found to be related to the recurrence. CONCLUSIONS: Enucleation with subsequent open packing was shown to be a conservative and comfortable treatment for patients and appears to be an effective choice for the management of large KCOTs in the mandible.

Full-Length Transcriptional Analysis of the Same Soybean Genotype With Compatible and Incompatible Reactions to Heterodera glycines Reveals Nematode Infection Activating Plant Defense Response.

Full-length transcriptome sequencing with long reads is a powerful tool to analyze transcriptional and post-transcriptional events; however, it has not been applied on soybean (Glycine max). Here, a comparative full-length transcriptome analysis was performed on soybean genotype 09-138 infected with soybean cyst nematode (SCN, Heterodera glycines) race 4 (SCN4, incompatible reaction) and race 5 (SCN5, compatible reaction) using Oxford Nanopore Technology. Each of 9 full-length samples collected 8 days post inoculation with/without nematodes generated an average of 6.1 GB of clean data and a total of 65,038 transcript sequences. After redundant transcripts were removed, 1,117 novel genes and 41,096 novel transcripts were identified. By analyzing the sequence structure of the novel transcripts, a total of 28,759 complete open reading frame (ORF) sequences, 5,337 transcription factors, 288 long non-coding RNAs, and 40,090 novel transcripts with function annotation were predicted. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of differentially expressed genes (DEGs) revealed that growth hormone, auxin-activated signaling pathway and multidimensional cell growth, and phenylpropanoid biosynthesis pathway were enriched by infection with both nematode races. More DEGs associated with stress response elements, plant-hormone signaling transduction pathway, and plant-pathogen interaction pathway with more upregulation were found in the incompatible reaction with SCN4 infection, and more DEGs with more upregulation involved in cell wall modification and carbohydrate bioprocess were detected in the compatible reaction with SCN5 infection when compared with each other. Among them, overlapping DEGs with a quantitative difference was triggered. The combination of protein-protein interaction with DEGs for the first time indicated that nematode infection activated the interactions between transcription factor WRKY and VQ (valine-glutamine motif) to contribute to soybean defense. The knowledge of the SCN-soybean interaction mechanism as a model will present more understanding of other plant-nematode interactions.

Transgressive resistance to Heterodera glycines in chromosome segment substitution lines derived from susceptible soybean parents.

Chromosome segment substitution lines (CSSLs) are valuable genetic resources for quantitative trait loci (QTL) mapping of complex agronomic traits especially suitable for minor effect QTL. Here, 162 BC3 F7 -BC7 F3 CSSLs derived from crossing two susceptible parent lines, soybean [Glycine max (L.) Merr.] 'Suinong14' (recurrent parent) × wild soybean (G. soja Siebold & Zucc.) ZYD00006, were used for QTL mapping of soybean cyst nematode (SCN, Heterodera glycine Ichinohe) resistance based on female index (FI) and cysts per gram root (CGR) through phenotypic screening and whole-genome resequencing of CSSLs. Phenotypic results displayed a wide range of distribution and transgressive lines in both HG Type 2.5.7 FI and CGR and demonstrated a higher correlation between CGR and root weight (R2 = .5424) compared with than between FI and CGR (R2 = .0018). Using the single-marker analysis nonparametric mapping test, 33 significant QTL were detected on 18 chromosomes contributing resistance to FI and CGR. Fourteen QTL contributing 5.6-15.5% phenotypic variance (PVE) to FI were revealed on 11 chromosomes, and 16 QTL accounting for 6.1-36.2% PVE in CGR were detected on 14 chromosomes with strong additive effect by multiple-QTL model (MQM) mapping. Twenty-five and 13 out of all 38 QTL identified for FI and CGR on 20 chromosomes were from ZYD00006 and Suinong14, respectively. The CSSLs with the combination of positive alleles for FI, CGR, and root weight exhibited low nematode reproduction. For the first time, QTL associated with CGR have been detected, and both FI and CGR should be considered for breeding purposes in the absence of strong resistance genes such as rhg1 and Rhg4.

Investigation of impacted permanent teeth except the third molar in Chinese patients through an X-ray study.

PURPOSE: To investigate the incidence and the local factors of impacted permanent teeth, except for the third molar, in Chinese patients through an x-ray study. MATERIALS AND METHODS: A total of 548 impacted permanent teeth from panoramic radiographs were studied and recorded according to the patients' gender and age, tooth position, and classification of impaction. The local factors contributing to impacted permanent tooth were also investigated. RESULTS: The incidence of impacted permanent teeth in the Chinese was 6.15%. The impacted tooth showed a predilection for women and was more common in the maxilla. The impaction of the canine had the greatest occurrence, 28.10% of all impacted teeth. Vertical impaction was most common (49.09%). The chief local factor for impacted teeth was the lack of interdental space (49.64%). CONCLUSIONS: All permanent teeth can occur with impaction in Chinese patients. Dentists should perform a thorough evaluation before planning suitable treatment.

The effect of chemical sympathectomy and stress on bone remodeling in adult rats.

OBJECTIVES: Bone remodeling has recently been revealed to be under sympathetic nerve control. The role of the sympathetic nerve system is not clearly understood. The present study aim to explore the effect of chemical sympathectomy and stress on bone remodeling in adult rats. METHODS: 24 twelve-month-old Wistar rats were divided into three group (sympathectomy, stress and control). The sympathectomy and stress group rats were administered 6-hydroxydopamine (150 mg/kg each day) and saline (1 ml/kg each day) intraperitoneal respectively for one week and exposed to stress procedure for another three weeks. The stress procedure was mild, unpredictable footshock, administered for one hour once daily. Analysis of serum chemistry, microcomputed tomography, dual energy X-ray absorptiometry, biomechanical testing and bone histomorphometry were employed. RESULTS: The stress group rats showed increased bone resorption in contrast to the sympathectomy and control group rats. The serum level of calcium and phosphorus cations and norepinephrine were enhanced, the cancellous bone volume and bone mineral density were reduced, bone mechanical property such as strength, ductility and toughness were weakened, the osteoclast counts and osteoclast surfaces were increased and the bone formatin rate were decreased significantly in the stress group rats in contrast to the other two groups rats. There was no significant difference of bone remodeling between the sympathectomy group and control group rats. CONCLUSION: Our study showed stress-increased sympathetic nerve system activity enhanced bone resorption while chemical sympathectomy inhibited bone resorption under stress. We postulate sympathetic neurotransmitter and neuropepitide may play a role in regulating bone remodeling.

MiR-205 mediated APC regulation contributes to pancreatic cancer cell proliferation.

BACKGROUND: Pancreatic cancer is a deadly malignancy with aggressive properties. MicroRNAs (miRNAs) participate in the pathogenesis of a variety of diseases and molecular processes by targeting functional mRNAs. Nevertheless, the regulatory role of miRNAs in signaling pathways involved in pancreatic cancer remains largely unknown. AIM: To explore the molecular regulation involved in pancreatic cancer and potential mechanisms of miR-205. METHODS: Microarray analysis was performed to investigate the expression profile of miRNAs in pancreatic cancer. Expression of miR-205 was validated by qRT-PCR. Target prediction and functional enrichment analysis were employed to seek potential target genes of miR-205 and potential functions of these genes. The target binding of miR-205 and adenomatous polyposis coli (APC) was validated by luciferase reporter assay. APC protein expression in pancreatic cancer was validated by qRT-PCR and Western blot. Proliferation was evaluated by MTT and colony formation assays. RESULTS: A large number of miRNAs with altered expression were identified in pancreatic cancer. MiR-205 was significantly up-regulated. APC was found to be a validated target of miR-205 and down-regulated in pancreatic cancer. Proliferation experiments showed that miR-205 could promote cell proliferation in pancreatic cancer by targeting APC. CONCLUSION: The above findings suggested that miR-205 mediated APC regulation contributes to pancreatic cancer development, which could be considered as a novel prognostic biomarker for clinical care.

Influence of preservation of the alveolar ridge on delayed implants after extraction of teeth with different defects in the buccal bone.

Our aim was to evaluate the influence of preservation of the alveolar ridge on delayed implants with different defects in the buccal bone. We enrolled 60 patients who had one posterior mandibular tooth extracted. Cone-beam computed tomography (CT) was used to measure the buccal bone defects in the alveolar ridge before the tooth was extracted (level A=3 to 5 mm, and level B=more than 5 mm). After the tooth had been extracted, the socket either had the alveolar ridge preserved (trial group) or it was left to heal spontaneously (control group). The changes in the dimensions of the alveolar ridge from preoperatively to 6 months postoperatively were evaluated by cone-beam CT. Suitable implants were inserted 6 months later, and their length and diameter recorded. The implant stability quotient was evaluated for the following 3 months. The dimensions of the bone in the alveolar ridge in the trial group were significantly less than those in the control groups in both levels. Fifty-seven patients required implants (except 3 in level B in the control group). There were more longer and wider implants in the trial group than in the control group in Level B. 3 months after implantation, there were no significant differences in implant stability quotients between the groups, though in the control group, Level B, the mean (SD) value was 69.50 (1.00) while in the other groups values were all above 70 at 3 months. We conclude that when the defect in the buccal bone was more than 5mm, the alveolar ridge preservation demonstrated a remarkable effect in preserving the alveolar ridge dimension and delayed implantation.

Improved sedation for dental extraction by using video eyewear in conjunction with nitrous oxide: a randomized, controlled, cross-over clinical trial.

OBJECTIVE: The purpose of this study was to investigate the effect of a portable video eyewear entertainment system used in conjunction with nitrous oxide/oxygen sedation during the removal of impacted lower third molars. STUDY DESIGN: Thirty-eight patients had their bilateral third molars removed under local anesthesia and nitrous oxide/oxygen inhalation sedation in 2 visits. On one side, video eyewear was used (group NE). On the other side, the tooth was removed without the use of video eyewear (group N). Vital signs were monitored. Overall behavior and the outcome of treatment were assessed. RESULTS: All 38 patients completed the study. The mean scores on behavior rating in group NE were significantly higher than those in group N (P < .05). The majority of patients (92.1%) preferred nitrous oxide with video eyewear. CONCLUSIONS: The use of video eyewear appeared to augment the effectiveness of nitrous oxide sedation in dental extraction patients.

Matrix metalloproteinase and its inhibitor in temporomandibular joint osteoarthrosis after indirect trauma in young goats.

Our aim was to examine the change in expression of matrix metalloproteinases (MMP-13), matrix metalloproteinases-3 (MMP-3), and tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) in the articular cartilage of goats with experimentally-induced osteoarthrosis of the temporomandibular joint (TMJ) at various times. Osteoarthrosis was induced in 20 goats in the bilateral TMJ and 5 goats acted as controls. There were 5 goats in each group, and a group was killed at 7 days, and 1, 3, and 6 months postoperatively. The samples were collected, and the joints evaluated histologically. Immunofluorescence was used to detect the presence of MMPs and TIMP-1 in the articular disc and condylar cartilage. The ultrastructure of the articular disc and condylar surface at 1 month was examined with scanning electron microscopy (SEM). Osteoarthrosis of the TMJ progressed gradually over time. MMP-13, MMP-3, and TIMP-1 were expressed strongly in the TMJ soon after injury; MMP-13 became gradually weakened, and MMP-3 strengthened later. None of these were expressed in the normal condyle. After a month the surface of the arthrotic condyle was uneven, and the underlying collagen fibrils were exposed in irregular fissures on the surface. The secretion of TIMP-1 was related closely to the changes of MMPs during osteoarthrosis of the TMJ. The unbalanced ratio between them caused degradation of the matrix of the cartilage and might be the cause of osteoarthrosis of the TMJ.

Regulation of skeletal muscle differentiation in fibroblasts by exogenous MyoD gene in vitro and in vivo.

MyoD of the myogenic regulatory factors (MRFs) family regulates the skeletal muscle differentiation program. In this study, stably transfected NIH3T3-derived cell lines were established, in which exogenous MyoD was expressed at high levels. Transcriptional activation of endogenous muscle regulatory gene and induction towards the skeletal muscle lineages were observed with phase-contrast microscopy when continuously cultured in vitro. Moreover, to determine their ability of myogenic formation in vivo, the transfected cells were implanted in nude mice subcutaneously for up to 10 weeks. The morphological characterization of inductive cells was observed using transmission electron microscope and histological staining. Myogenesis of fibroblasts incubated in the medium was activated by overexpression of MyoD, and the cells were accumulated and fused into multinucleated myotubes. Correlatively, RT-PCR and immunohistochemistry confirmed the increased expression of characteristic downstream molecule myogenin and mysion heavy chains during myogenic differentiation. Ecoptic myogenesis was found and remained stable phenotype when the transfected cells were seeded in vivo. Our results suggest that MyoD can be considered to be a determining factor of myogenic lineages, and it may play an important role in the cell therapy and cell-mediated gene therapy of the skeletal muscle.

[Surgical orthodontic technique for the treatment of maxillofacial deformities and dysfunction of occlusion after maxillofacial fractures].

OBJECTIVE: To evaluate a new technique to treat severe maxillofacial deformity and dysfunction of occlusion after the maxillofacial fractures. METHODS: Thirty-four consecutive patients, with delayed maxillofacial deformities and dysfunction of occlusion after the maxillofacial fractures, were treated by the use of x-ray cephalometric analysis, model surgery, open reduction and rigid internal fixation. RESULTS: Thirty-three patients were successfully corrected the maxillofacial deformities, facilitated normal occlusal relationship. Only one patient with severe damage of the brain was presented a mild occlusion dysfunction one year after the operation. CONCLUSIONS: The above-mentioned technique may be a viable and effective option for the management of the deformities of the face and dentition after the maxillofacial fractures.