A specific notation for contrast medium and dehydrated ethanol injection into the vein of Marshall during mitral isthmus ablation-A case report.

BACKGROUND: Ablation of the vein of Marshall (VOM) by dehydrated ethanol (DE) is an important method for completely blocking the mitral isthmus (MI). Before DE ablation of the VOM, Marshall angiography should be performed so that the contrast medium is inevitably exposed to DE. METHOD: We present a case of DE ablation of the VOM. When iodixanol was exposed to DE, some floccule embolized the lumen of the over-the-wire (OTW) balloon dilatation catheter and led to the impossibility of DE ablation. Then, we performed in vitro experiments: iodixanol, not iomeprol, produced many stable white floccules when it encountered DE. CONCLUSION: Iodixanol is not an appropriate contrast for DE ablation of the VOM. However, if there is no other alternative contrast, the following methods might be used to address the problem: ⑴ diluted iodixanol (iodixanol:normal saline 1:1) could be used for VOM ablation; or ⑵ the lumen of the OTW could be flushed by NS after VOM angiography, and then DE injection could be performed.

Honeycomb-like structure (HLS) in the left anterior-descending coronary artery-recanalized thrombus demonstrated by intravascular ultrasound (IVUS) in a patient with polycythemia vera and thrombocythemia.

A 71 year old male patient who experienced acute myocardial infarction (AMI) 4 years ago and had a history of polycythemia vera and thrombocythemia was admitted because acute attack of chronic heart failure. Coronary angiography revealed an unusual filling defect in the middle segment of the left anterior descending (LAD) coronary artery and IVUS showed it is a HLS which is different from dissection or woven coronary artery. We review the recent literature of HLS in this article and further investigations are warranted for the optimal management of HLS.

Novel thiazole-pyrazolone hybrids as potent ACE inhibitors and their cardioprotective effect on isoproterenol-induced myocardial infarction.

A facile synthesis of a group of novel thiazole-pyrazolone hybrids and their investigation for angiotensin-converting enzyme (ACE) inhibition are reported in this study. These compounds were synthesized using a well-known approach, based on the condensation of ethyl acetoacetate with thiazolylhydrazines, and characterized by various spectroscopic and analytical techniques. The entire set of compounds displayed a moderate-to-excellent inhibitory activity against ACE. In particular, compound 4i was found to be the most potent ACE inhibitor and was further studied for cardioprotective effects against isoproterenol (ISO)-induced myocardial infarction (MI) in rats. Compound 4i improved the cardiac function and prevented cardiac injury induced by ISO in Sprague Dawley rats. The levels of oxidative stress and proinflammatory cytokines were also restored to near normal by 4i as compared with the ISO group. In the Western blot analysis, compound 4i prevented mitochondrial apoptosis after MI by downregulating the expression of cleaved caspase-3 and Bax, with the upregulation of Bcl-2, as compared with the ISO group.

Heat-induced amyloid-like aggregation of ß-lactoglobulin affected by glycation by α-dicarbonyl compounds in a model study.

BACKGROUND: α-Dicarbonyl compounds are widely generated in the Maillard reaction, caramelization and oil oxidation during heat treatment. These compounds can readily react with lysine and arginine residues of a protein, whereas the influence of these compounds on protein structure and quality has seldom been revealed. This study compared influence of glycation by glucose and α-dicarbonyl compounds on amyloid-like aggregation of ß-lactoglobulin (ß-LG), both fibrillation kinetics and conformation of aggregates were studied. RESULTS: Compared with glycation by glucose, the glycation by α-dicarbonyl compounds resulted in faster reduction of free amino group, sulfydryl group, and the relative content of ß-sheet secondary structure, according to the ultraviolet (UV) spectra or circular dichroism (CD) spectra results. Based on the analysis of fibrillation kinetics using thioflavin T (ThT) binding assay, the glycation by α-dicarbonyls were more efficient in suppressing the growth of fibrillar aggregates. In addition, glycation by α-dicarbonyl resulted in amorphous oligomers, which were compared with the amyloid-like aggregates in control and glucose-glycated samples, based on the transmission electron microscopy (TEM) observation. CONCLUSIONS: Glycation by α-dicarbonyl compounds induced larger decline in the ß-sheet structure of ß-LG than glycation by glucose, and thus largely suppressed the amyloid-like aggregation of ß-LG and changed the morphology of aggregates. © 2019 Society of Chemical Industry.

Adiponectin attenuates lipopolysaccharide-induced cell injury of H9c2 cells by regulating AMPK pathway.

Adiponectin, an adipokine synthesized and secreted majorly by adipose tissue, is reported to exert cardioprotective properties via anti-inflammation and antiapoptosis. Lipopolysaccharide (LPS) is a common inflammation and apoptosis inducer of cardiomyocytes. However, few studies have reported the roles of adiponectin on LPS-induced inflammation as well as apoptosis of H9c2 cells, and the possible mechanisms of these effects. In the present study, we found that adiponectin significantly relieved LPS-induced cytotoxicity including decreased viability and elevated LDH release, inhibited LPS-triggered inflammation, which is evidenced by increases in release of TNF-α, IL-1ß as well as IL-6, and attenuated the enhanced rates of apoptotic cells as well as increased caspase-3 activity caused by LPS in H9c2 cells. In addition, our data demonstrated that adiponectin upregulated AMP-activated protein kinase (AMPK) activation of H9c2 cells with or without LPS administration. Moreover, we found that blocking AMPK pathway by compound c attenuated the protective effects of adiponectin against the cytotoxicity, inflammatory response, and apoptosis of H9c2 cells resulted from LPS. Our observations bring novel insights for understanding the mediatory role of AMPK pathway implicated in the protective effects of adiponectin against LPS-induced cardiotoxicity.

Dynamic alterations of connexin43, matrix metalloproteinase-2 and tissue inhibitor of matrix metalloproteinase-2 during ventricular fibrillation in canine.

The aim of this study is to investigate the dynamic alterations of cardiac connexin 43 (Cx43), matrix metalloproteinase-2 (MMP-2) and tissue inhibitor of metalloproteinase-2 (TIMP-2) in the setting of different ventricular fibrillation (VF) duration. In this study, thirty-two dogs were randomly divided into sham control group, 8-min VF group, 12-min VF group, and 30-min VF group. Cx43 and phosphorylated Cx43 (p-Cx43) in tissues were detected by western blot and immunofluorescence analysis. MMP-2 and TIMP-2 were detected by western blot and immunohistochemistry analysis. The results showed that Cx43 levels in three VF groups were significantly decreased compared with sham control group. p-Cx43 levels in 12-min and 30-min VF groups were significantly reduced compared with sham control group. The ratio of p-Cx43/Cx43 was also decreased in VF groups. Compared with sham controls, no significant difference was observed between the sham control group and 8-min VF group in MMP-2 level, but MMP-2 level increased in 12-min and 30-min VF groups. The ratios of MMP-2/TIMP-2 were higher in VF groups, and were correlated with the duration of VF. A remarkable correlation was observed between the ratio of p-Cx43/Cx43 and MMP-2/TIMP-2 (r = -0.93, P < 0.01). In conclusion, the alteration of Cx43 and/or p-Cx43 levels and the imbalance of MMP-2 and TIMP-2 may contribute to the initiation and/or persistence of VF. Maneuvers managed to modulate Cx43 level or normalize the balance of MMP-2/TIMP-2 are promising to ameliorate prognosis of VF.

A novel ECG algorithm to differentiate between ventricular arrhythmia from right versus left ventricular outflow tract.

AIM: The aim of this study was to evaluate the accuracy of the diagnostic criteria for determining the origin of outflow tract ventricular arrhythmia (OTVA) and develop an ECG algorithm to predict its origin. METHOD: We analyzed the ECGs of 100 patients with OTVA who underwent successful ablation. The QRS complex was measured during sinus rhythm and ventricular arrhythmia. After the ECG algorithm was developed, it was validated in an additional 100 patients from two different hospitals. RESULTS: In this retrospective study, among the parameters without restrictions in the transition lead, the V2S/V3R index (AUC = 0.96) was significantly better in predicting ventricular arrhythmia originating from the right ventricular outflow tract (RVOT). Further, the larger initial r wave surface area (ISA) in V1 and V2 (AUC = 0.06) was significantly better in predicting ventricular arrhythmias originating from the left ventricular outflow tract (LVOT). Among the parameters with the transition lead in V3, the V2S/V3R index (AUC = 0.82) was significantly better in predicting VAs originating from the RVOT. On the contrary, the V3 R-wave deflection interval (AUC = 0.19) was significantly better in predicting ventricular arrhythmias originating from the LVOT. The algorithm combining the V2S/V3R index and the larger ISA in V1 and V2 could predict OTVA origin with an accuracy of 95.00%, a sensitivity of 87.18%, a specificity of 100.00%, a positive predictive value (PPV) of 100.00%, and a negative predictive value (NPV) of 92.42%. In the validation study, the algorithm exhibited excellent accuracy (95.00%) and AUC (AUC = 0.95), with a sensitivity of 94.12%, a specificity of 95.45%, a PPV of 91.43%, and an NPV of 96.92%. CONCLUSION: Our developed algorithm can reliably predict OTVA origin without restrictions in the transition lead.

Imbalance between tissue inhibitor of metalloproteinase 1 and matrix metalloproteinase 9 after cardiopulmonary resuscitation.

AIMS: This study aimed to determine whether (a) there was an imbalance between matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of metalloproteinase 1 (TIMP-1) after cardiopulmonary resuscitation (CPR) in a canine model of prolonged ventricular fibrillation (VF); (b) with the duration of VF, the degree of the imbalance would be greater; and (c) there was a relationship between the level of MMP-9 or TIMP-1 and the cardiac function. METHODS AND RESULTS: Ventricular fibrillation was electrically induced in 24 dogs. The animals were randomly divided into 3 groups (sham control, n = 8; 8-minute VF, n = 8; 12-minute VF, n = 8). Echocardiographic measurement and hemodynamic variables were recorded before VF and after return of spontaneous circulation. Tissue inhibitor of metalloproteinase 1 (TIMP-1) and MMP-9 were analyzed by Western blot and immunohistochemistry. Compared with sham controls, dogs under VF and CPR showed significantly decreased level of TIMP-1 (P < .001), and with the duration of VF, the level of TIMP-1 declined (P < .01). The level of MMP-9 did not achieve statistical significance in the 3 groups (P > .05); however, they were higher in VF and longer duration VF groups. The ratios of TIMP-1/MMP-9 were lower in VF groups (P < .05). There was a negative correlation between TIMP-1 and left atrium dimension and left ventricular diastolic dimensions (r = -0.83 and r = -0.96, respectively; P < .01) and a positive correlation between TIMP-1 and left ventricular ejection fraction (r = 0.85; P < .01). CONCLUSIONS: There was an imbalance between TIMP-1 and MMP-9 after CPR. It may partly contribute to the postresuscitation cardiac dysfunction.

Effect of ZP123, a gap junction modifier, on prolonged ventricular fibrillation in swine.

OBJECTIVES: It was the aim of this study to investigate the effect of ZP123 on prolonged ventricular fibrillation (VF) in swine. METHODS: VF was electrically induced in 20 pigs. The animals randomly received either ZP123 or saline control infusion before VF. After 8 min of untreated VF, cardiopulmonary resuscitation and biphasic defibrillation shocks were applied. VF mean frequency (VF(mf)) and mean amplitude (VF(ma)), hemodynamics, outcome of defibrillation and the rate of return of spontaneous circulation (ROSC) were analyzed. RESULTS: Compared with the control group, VF(mf) was higher but VF(ma) lower during the 8 min of VF in the drug group (11.8 ± 2.1 vs. 10.4 ± 2.0 Hz and 0.24 ± 0.10 vs. 0.31 ± 0.16 mV, respectively; p < 0.05). Hemodynamic variables in the 2 groups were comparable (p > 0.05). The defibrillation threshold was lower and the rate of successful defibrillation was higher in the drug group compared with the control group (92.2 ± 26.4 vs. 133.3 ± 28.9 J and 90 vs. 30%, respectively; p < 0.05). The rate of ROSC was not different between the 2 groups (40 vs. 30%; p > 0.05). CONCLUSION: In prolonged VF, ZP123 could decrease the defibrillation threshold and improve the rate of successful defibrillation. However, it could not improve the rate of ROSC - which may be due to its side effect of decreasing VF(ma).

[Changes in myocardial connexin 43 during ventricular fibrillation].

OBJECTIVE: To observe changes in connexin 43 (Cx43) after ventricular fibrillation (VF) and the effects of rotigaptide (ZP123) on Cx43. METHODS: Thirty domestic pigs were randomly assigned to three groups (10 in each group): sham group, model group and ZP123 group. VF was induced by an 80 V AC transthoracic shock for 5 seconds with the use of subcutaneous needles. Before the induction of VF, animals in ZP123 group were administered with ZP123 (1 µg/kg bolus+10 µg×kg(-1)×h(-1) dissolved in 50 ml normal saline and pumped for 15 minutes ). Those in model group received 50 ml normal saline pumped for 15 minutes. For pigs in sham group VF was not induced and no fluid was given. After 8 minutes of VF, animals were euthanized and myocardial tissues were harvested along the long axis of each left ventricular free wall. Immunofluorescence combined with laser scanning confocal microscope was used to detect the distribution of Cx43. Western blotting was used for quantitative determination of Cx43 protein expression. RESULTS: Immunofluorescence signals for Cx43 in sham group were strong and regularly distributed. In model group, Cx43 signals were weak and distributed in heterogeneity, while in ZP123 group, Cx43 signals were enhanced and their distribution were much more orderly. Compared with sham group, the percentage area and the optical densities (A value) of Cx43 fluorescence signals and Cx43 protein expression were significantly decreased in model group [the percentage area: (0.64±0.36)% vs.(1.27±0.19)%, A value: 15 201± 2 613 vs. 30 634±4 975, Cx43 protein expression: 0.72±0.08 vs. 0.97±0.07, all P<0.05]. The level of Cx43 expression in ZP 123 group [the percentage area (0.96±0.16)%, A value 22 100±4 404, Cx43 protein expression 0.82±0.04] was much higher than model group (all P<0.05). CONCLUSION: During VF, down-regulation of myocardial Cx43 expression occurred, which could be attenuated by administration of ZP123.

Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases.

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.

The digestibility of hydrothermally-treated bovine serum albumin glycated by glyoxal.

The digestion of dietary advanced glycation end products (AGEs) largely determines their absorption in humans. To help elucidate the health effects of dietary AGEs, changes in the digestive behavior of bovine serum albumin (BSA, dietary protein) caused by glycation derived from glyoxal (GO, an important precursor of AGEs) in a simulated food heating system have been investigated. The hydrothermal aggregation of BSA was suppressed by GO derived glycation, generating glycated aggregates of loose and branched structures, according to dynamic light scattering (DLS), circular dichroism (CD) spectroscopy, free sulfhydryl group, transmission electron microscopy (TEM) and small angle X-ray scattering (SAXS) results. Analysis of protein digests showed that glycation reduced the gastric and gastrointestinal digestibility of BSA and the bioavailability of all seven detected amino acids. A comparative analysis of the distribution of CML and lysine in glycated BSA digests with different molecular weights showed that carboxymethylation directly blocked the action of proteases on Lys residues.

Digestibility of Glyoxal-Glycated ß-Casein and ß-Lactoglobulin and Distribution of Peptide-Bound Advanced Glycation End Products in Gastrointestinal Digests.

This work reports the influence of glyoxal (GO)-derived glycation on the gastrointestinal enzymatic hydrolysis of ß-lactoglobulin and ß-casein. Reduced digestibility of glycated proteins was found in both gastric and intestinal stage. Distribution of Maillard reaction products in digests with different molecular weight ranges was investigated subsequently. The colorless and brown MRPs largely presented in the digests smaller than 20 kDa. However, the resistance of fluorescent advanced glycation end products (AGEs) to enzymatic hydrolysis gradually increased during glycation, rendering fluorescent AGEs largely present in the digests larger than 20 kDa. No free N (ε)-carboxymethyllysine (CML) was detected in digests. The relative amount of CML in digests larger than 1 kDa was higher than that of Lys, demonstrating the hindrance of CML to enzymatic hydrolysis. This study highlights the resistance of GO-derived AGEs to digestive proteases via blockage of tryptic cleavage sites or steric hindrance, which is a barrier to the absorption of dietary AGEs.

Effect of glycation derived from α-dicarbonyl compounds on the in vitro digestibility of ß-casein and ß-lactoglobulin: A model study with glyoxal, methylglyoxal and butanedione.

α-Dicarbonyl compounds, which are widely found in common consumed food, are one of the precursors of advanced glycation end products (AGEs). In this study, the effect of glycation derived from glyoxal (GO), methylglyoxal (MGO) or butanedione (BU) on the in vitro digestibility of ß-casein (ß-CN) and ß-lactoglobulin (ß-Lg) was investigated. Glycation from α-dicarbonyl compounds reduced the in vitro digestibility of studied proteins in both gastric and intestinal stage. In addition, glycation substantially altered the peptides released through gastric and gastrointestinal digestion, as detected by liquid chromatography electrospray-ionization tandem mass spectrometry (LC-ESI-MS/MS). Crosslinked glycation structures derived from BU considerably reduced the sensitivity of glycated ß-Lg towards digestive proteases, albeit to a lesser degree in glycated ß-CN due to its intrinsic unordered structure. By contrast, non-crosslinked AGEs that formed adjacent to enzymatic cleavage sites did not block the enzymatic reaction in several cases, as evidenced by the corresponding digested peptides modified with glycation structures. These findings expand our understanding of the nutritional influence of α-dicarbonyl compounds and health impact of relevant dietary AGEs.

[Corrigendum] Effects of rotigaptide (ZP123) on connexin43 remodeling in canine ventricular fibrillation.

Mol Med Rep 12: [Related article:] 5746­5752, 2015; DOI: 10.3892/mmr.2015.4193 Following the publication of this article on-line ahead of print, an interested reader drew to our attention some anomalies associated with the presentation of Fig. 1. In the lower panel, the fourth image from the left resembled a mirror image representation of the image in the first panel; the fifth image from the left bore a marked resemblance to a section of the third image, albeit displaced at an angle and with a different magnification; and an internal office investigation drew our attention to the fact that the sixth image in the upper panel resembled a section of the image in the third panel, although rotated through 180°.

Effects of rotigaptide (ZP123) on connexin43 remodeling in canine ventricular fibrillation.

The present study investigated the effects of rotigaptide (ZP123) on the expression, distribution and phosphorylation of connexin43 (Cx43) in myocardial cell membranes in cardioversion of ventricular fibrillation (VF). A model of prolonged VF (8, 12 and 30 min) was established in mongrel dogs (n=8/group), following treatment with ZP123 or normal saline (NS control). A sham control was included. Cardiopulmonary resuscitation was begun at the start of VF followed by defibrillation. Animals received a maximum of three defibrillations of increasing energy (70, 100 and 150 J biphasic shock) as required. The average defibrillation energy, defibrillation success rate, return of spontaneous circulation and survival rate were recorded. Cx43 and phosphorylated (p-)Cx43 expression in cardiomyocyte membranes was detected by western blot and immunofluorescence analyses. Compared with the NS-treated control groups, the success defibrillation rate in the 8-min and 12-min ZP123 groups was significantly higher (P<0.05), while the average defibrillation energy was significantly lower (P<0.05). Cx43 expression in the VF groups was significantly lower than that in the sham control group (P<0.05). Cx43 expression was higher in the 12-min and 30-min ZP123 groups than that in the NS control group (P<0.05), while p-Cx43 expression decreased, although the levels were significantly higher than those in the control groups (P<0.05). Cx43 expression was positively correlated with the defibrillation success rate (r=0.91; P<0.01) and negatively with the mean defibrillation energy (r=-0.854; P<0.01), while p-Cx43 expression was positively correlated with the success rate of the previous three defibrillations (r=0.926; P<0.01).In conclusion, ZP123 reduced Cx43 remodeling through regulating the expression, distribution and phosphorylation of Cx43, thereby reducing the defibrillation energy required for successful cardioversion.

ZP123 reduces energy required for defibrillation by preventing connexin43 remodeling during prolonged ventricular fibrillation in swine.

In ventricular fibrillation, the uncoupling of gap junctions slows conduction velocity and increases action-potential dispersion, which slows and diminishes defibrillation. We studied how the peptide ZP123, a gap-junction enhancer, might lower defibrillation-energy requirements during ventricular fibrillation in live pigs. We randomly assigned 33 pigs into 3 groups: ZP123 (receiving a 1-µg/kg bolus and 10 µg/kg/hr of ZP123), control (receiving saline solution), and sham (undergoing a sham operation). After a 30-min administration of agents, ventricular fibrillation was induced and left untreated for 8 min. Biphasic defibrillation of 50 J was increased by 50-J increments as necessary. Defibrillation-energy requirements were defined as the lowest energy required to achieve defibrillation. Electrocardiographic values were obtained before and after the administration of agents. Western blot and immunofluorescence analyses were performed on ventricular myocardial samples. All but one pig survived. The ZP123 treatment did not alter electrocardiographic variables. In the ZP123 group, the average required defibrillation energy was lower than that in the control group (327.28±269.6 vs 610±192.64 J; P=0.015), and the cumulative percentage of successful defibrillation at upper energy levels was higher (P<0.05). Supraventricular rhythm occurred more often in the ZP123 group than in the control group (72.7% vs 50%, P=0.042). Western-blot and immunofluorescence results showed that ZP123 did not alter the total amount of connexin43 but did prevent its dephosphorylation. We conclude that ZP123 can reduce defibrillation-energy requirements by preventing connexin43 remodeling during prolonged ventricular fibrillation.