Two different viral proteins suppress NUCLEAR FACTOR-YC-mediated antiviral immunity during infection in rice.

Plant viruses have multiple strategies to counter and evade the host's antiviral immune response. However, limited research has been conducted on the antiviral defense mechanisms commonly targeted by distinct types of plant viruses. In this study, we discovered that NUCLEAR FACTOR-YC (NF-YC) and NUCLEAR FACTOR-YA (NF-YA), 2 essential components of the NF-Y complex, were commonly targeted by viral proteins encoded by 2 different rice (Oryza sativa L.) viruses, rice stripe virus (RSV, Tenuivirus) and southern rice black streaked dwarf virus (SRBSDV, Fijivirus). In vitro and in vivo experiments showed that OsNF-YCs associate with OsNF-YAs and inhibit their transcriptional activation activity, resulting in the suppression of OsNF-YA-mediated plant susceptibility to rice viruses. Different viral proteins RSV P2 and SRBSDV SP8 directly disrupted the association of OsNF-YCs with OsNF-YAs, thereby suppressing the antiviral defense mediated by OsNF-YCs. These findings suggest an approach for conferring broad-spectrum disease resistance in rice and reveal a common mechanism employed by viral proteins to evade the host's antiviral defense by hindering the antiviral capabilities of OsNF-YCs.

Horizontally Transferred Salivary Protein Promotes Insect Feeding by Suppressing Ferredoxin-Mediated Plant Defenses.

Herbivorous insects such as whiteflies, planthoppers, and aphids secrete abundant orphan proteins to facilitate feeding. Yet, how these genes are recruited and evolve to mediate plant-insect interaction remains unknown. In this study, we report a horizontal gene transfer (HGT) event from fungi to an ancestor of Aleyrodidae insects approximately 42 to 190 million years ago. BtFTSP1 is a salivary protein that is secreted into host plants during Bemisia tabaci feeding. It targets a defensive ferredoxin 1 in Nicotiana tabacum (NtFD1) and disrupts the NtFD1-NtFD1 interaction in plant cytosol, leading to the degradation of NtFD1 in a ubiquitin-dependent manner. Silencing BtFTSP1 has negative effects on B. tabaci feeding while overexpressing BtFTSP1 in N. tabacum benefits insects and rescues the adverse effect caused by NtFD1 overexpression. The association between BtFTSP1 and NtFD1 is newly evolved after HGT, with the homologous FTSP in its fungal donor failing to interact and destabilize NtFD1. Our study illustrates the important roles of horizontally transferred genes in plant-insect interactions and suggests the potential origin of orphan salivary genes.

NF-YA transcription factors suppress jasmonic acid-mediated antiviral defense and facilitate viral infection in rice.

NF-Y transcription factors are known to play many diverse roles in the development and physiological responses of plants but little is known about their role in plant defense. Here, we demonstrate the negative roles of rice NF-YA family genes in antiviral defense against two different plant viruses, Rice stripe virus (RSV, Tenuivirus) and Southern rice black-streaked dwarf virus (SRBSDV, Fijivirus). RSV and SRBSDV both induced the expression of OsNF-YA family genes. Overexpression of OsNF-YAs enhanced rice susceptibility to virus infection, while OsNF-YAs RNAi mutants were more resistant. Transcriptome sequencing showed that the expression of jasmonic acid (JA)-related genes was significantly decreased in plants overexpressing OsNF-YA when they were infected by viruses. qRT-PCR and JA sensitivity assays confirmed that OsNF-YAs play negative roles in regulating the JA pathway. Further experiments showed that OsNF-YAs physically interact with JA signaling transcription factors OsMYC2/3 and interfere with JA signaling by dissociating the OsMYC2/3-OsMED25 complex, which inhibits the transcriptional activation activity of OsMYC2/3. Together, our results reveal that OsNF-YAs broadly inhibit plant antiviral defense by repressing JA signaling pathways, and provide new insight into how OsNF-YAs are directly associated with the JA pathway.

Engineering brassinosteroids pathway: a key strategy for enhancing crop yields.

KEY MESSAGE: Two significant studies have unveiled the pivotal role of BR regulation in shaping distinct features: the clustered-spikelet architecture in rice and the superior semi-dwarf stature in wheat.

A class of independently evolved transcriptional repressors in plant RNA viruses facilitates viral infection and vector feeding.

Plant viruses employ diverse virulence strategies to achieve successful infection, but there are few known general strategies of viral pathogenicity and transmission used by widely different plant viruses. Here, we report a class of independently evolved virulence factors in different plant RNA viruses which possess active transcriptional repressor activity. Rice viruses in the genera Fijivirus, Tenuivirus, and Cytorhabdovirus all have transcriptional repressors that interact in plants with the key components of jasmonic acid (JA) signaling, namely mediator subunit OsMED25, OsJAZ proteins, and OsMYC transcription factors. These transcriptional repressors can directly disassociate the OsMED25-OsMYC complex, inhibit the transcriptional activation of OsMYC, and then combine with OsJAZ proteins to cooperatively attenuate the JA pathway in a way that benefits viral infection. At the same time, these transcriptional repressors efficiently enhanced feeding by the virus insect vectors by repressing JA signaling. Our findings reveal a common strategy in unrelated plant viruses in which viral transcriptional repressors hijack and repress the JA pathway in favor of both viral pathogenicity and vector transmission.

Transcriptional profiling reveals a critical role of GmFT2a in soybean staygreen syndrome caused by the pest Riptortus pedestris.

Soybean staygreen syndrome, characterized by delayed leaf and stem senescence, abnormal pods, and aborted seeds, has recently become a serious and prominent problem in soybean production. Although the pest Riptortus pedestris has received increasing attention as the possible cause of staygreen syndrome, the mechanism remains unknown. Here, we clarify that direct feeding by R. pedestris, not transmission of a pathogen by this pest, is the primary cause of typical soybean staygreen syndrome and that critical feeding damage occurs at the early pod stage. Transcriptome profiling of soybean indicated that many signal transduction pathways, including photoperiod, hormone, defense response, and photosynthesis, respond to R. pedestris infestation. Importantly, we discovered that members of the FLOWERING LOCUS T (FT) gene family were suppressed by R. pedestris infestation, and overexpression of floral inducer GmFT2a attenuates staygreen symptoms by mediating soybean defense response and photosynthesis. Together, our findings systematically illustrate the association between pest infestation and soybean staygreen syndrome and provide the basis for establishing a targeted soybean pest prevention and control system.

The OsGSK2 Kinase Integrates Brassinosteroid and Jasmonic Acid Signaling by Interacting with OsJAZ4.

The crosstalk between brassinosteroid (BR) and jasmonic acid (JA) signaling is crucial for plant growth and defense responses. However, the detailed interplay between BRs and JA remains obscure. Here, we found that the rice (Oryza sativa) Glycogen synthase kinase3 (GSK3)-like kinase OsGSK2, a conserved kinase serving as a key suppressor of BR signaling, enhanced antiviral defense and the JA response. We identified a member of the JASMONATE ZIM-domain (JAZ) family, OsJAZ4, as a OsGSK2 substrate and confirmed that OsGSK2 interacted with and phosphorylated OsJAZ4. We demonstrated that OsGSK2 disrupted the OsJAZ4-OsNINJA complex and OsJAZ4-OsJAZ11 dimerization by competitively binding to the ZIM domain, perhaps helping to facilitate the degradation of OsJAZ4 via the 26S proteasome pathway. We also showed that OsJAZ4 negatively modulated JA signaling and antiviral defense and that the BR pathway was involved in modulating the stability of OsJAZ4 protein in an OsCORONATINE INSENSITIVE1-dependent manner. Collectively, these results suggest that OsGSK2 enhances plant antiviral defenses by activating JA signaling as it directly interacts with, phosphorylates, and destabilizes OsJAZ4. Thus, our findings provide a clear link between BR and JA signaling.

ARGONAUTE2 Enhances Grain Length and Salt Tolerance by Activating BIG GRAIN3 to Modulate Cytokinin Distribution in Rice.

Maintaining stable, high yields under fluctuating environmental conditions is a long-standing goal of crop improvement but is challenging due to internal trade-off mechanisms, which are poorly understood. Here, we identify ARGONAUTE2 (AGO2) as a candidate target for achieving this goal in rice (Oryza sativa). Overexpressing AGO2 led to a simultaneous increase in salt tolerance and grain length. These benefits were achieved via the activation of BIG GRAIN3 (BG3), encoding a purine permease potentially involved in cytokinin transport. AGO2 can become enriched on the BG3 locus and alter its histone methylation level, thus promoting BG3 expression. Cytokinin levels decreased in shoots but increased in roots of AGO2-overexpressing plants. While bg3 knockout mutants were hypersensitive to salt stress, plants overexpressing BG3 showed strong salt tolerance and large grains. The knockout of BG3 significantly reduced grain length and salt tolerance in AGO2-overexpressing plants. Both genes were transcriptionally suppressed by salt treatment. Salt treatment markedly increased cytokinin levels in roots but decreased them in shoots, resulting in a hormone distribution pattern similar to that in AGO2-overexpressing plants. These findings highlight the critical roles of the spatial distribution of cytokinins in both stress responses and grain development. Therefore, optimizing cytokinin distribution represents a promising strategy for improving both grain yield and stress tolerance in rice.

Distinct modes of manipulation of rice auxin response factor OsARF17 by different plant RNA viruses for infection.

Plant auxin response factor (ARF) transcription factors are an important class of key transcriptional modulators in auxin signaling. Despite the well-studied roles of ARF transcription factors in plant growth and development, it is largely unknown whether, and how, ARF transcription factors may be involved in plant resistance to pathogens. We show here that two fijiviruses (double-stranded RNA viruses) utilize their proteins to disturb the dimerization of OsARF17 and repress its transcriptional activation ability, while a tenuivirus (negative-sense single-stranded RNA virus) directly interferes with the DNA binding activity of OsARF17. These interactions impair OsARF17-mediated antiviral defense. OsARF17 also confers resistance to a cytorhabdovirus and was directly targeted by one of the viral proteins. Thus, OsARF17 is the common target of several very different viruses. This suggests that OsARF17 plays a crucial role in plant defense against different types of plant viruses, and that these viruses use independently evolved viral proteins to target this key component of auxin signaling and facilitate infection.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

The marksman: Bioactivated nematicides selectively kill plant-parasitic nematodes.

Plant-parasitic nematodes destroy crops and have a major impact on the food supply, but using chemicals to control them poses a risk to other animals and people. Selectivins kill nematodes but have little effect on other organisms.

Ustilaginoidea virens Nuclear Effector SCRE4 Suppresses Rice Immunity via Inhibiting Expression of a Positive Immune Regulator OsARF17.

Rice false smut caused by the biotrophic fungal pathogen Ustilaginoidea virens has become one of the most important diseases in rice. The large effector repertory in U. virens plays a crucial role in virulence. However, current knowledge of molecular mechanisms how U. virens effectors target rice immune signaling to promote infection is very limited. In this study, we identified and characterized an essential virulence effector, SCRE4 (Secreted Cysteine-Rich Effector 4), in U. virens. SCRE4 was confirmed as a secreted nuclear effector through yeast secretion, translocation assays and protein subcellular localization, as well as up-regulation during infection. The SCRE4 gene deletion attenuated the virulence of U. virens to rice. Consistently, ectopic expression of SCRE4 in rice inhibited chitin-triggered immunity and enhanced susceptibility to false smut, substantiating that SCRE4 is an essential virulence factor. Furthermore, SCRE4 transcriptionally suppressed the expression of OsARF17, an auxin response factor in rice, which positively regulates rice immune responses and resistance against U. virens. Additionally, the immunosuppressive capacity of SCRE4 depended on its nuclear localization. Therefore, we uncovered a virulence strategy in U. virens that transcriptionally suppresses the expression of the immune positive modulator OsARF17 through nucleus-localized effector SCRE4 to facilitate infection.

A rice LRR receptor-like protein associates with its adaptor kinase OsSOBIR1 to mediate plant immunity against viral infection.

Plants sense pathogen attacks using a variety of receptors at the cell surface. The LRR receptor-like proteins (RLP) and receptor-like kinases (RLK) are widely reported to participate in plant defence against bacterial and fungal pathogen invasion. However, the role of RLP and RLK in plant antiviral defence has rarely been reported. We employed a high-throughput-sequencing approach, transgenic rice plants and viral inoculation assays to investigate the role of OsRLP1 and OsSOBIR1 proteins in rice immunity against virus infection. The transcript of a rice LRR receptor-like protein, OsRLP1, was markedly up-regulated following infection by RBSDV, a devastating pathogen of rice and maize. Viral inoculation on various OsRLP1 mutants demonstrated that OsRLP1 modulates rice resistance against RBSDV infection. It was also shown that OsRLP1 is involved in the RBSDV-induced defence response by positively regulating the activation of MAPKs and PTI-related gene expression. OsRLP1 interacted with a receptor-like kinase OsSOBIR1, which was shown to regulate the PTI response and rice antiviral defence. Our results offer a novel insight into how a virus-induced receptor-like protein and its adaptor kinase activate the PTI response and antiviral defence in rice.

SPX4 interacts with both PHR1 and PAP1 to regulate critical steps in phosphorus-status-dependent anthocyanin biosynthesis.

Phosphate (Pi) is the plant-accessible form of phosphorus, and its insufficiency limits plant growth. The over-accumulation of anthocyanins in plants is often an indication of Pi starvation. However, whether the two pathways are directly linked and which components are involved in this process await identification. Here, we demonstrate that SPX4, a conserved regulator of the Pi response, transduces the Pi starvation signal to anthocyanin biosynthesis in Arabidopsis. When phr1spx4 plants were grown under low Pi conditions, DFR expression and anthocyanin biosynthesis were induced, which distinguished the plant from the behavior reported in the phr1 mutant. We also provide evidence that SPX4 interacts with PAP1, an MYB transcription factor that controls the anthocyanin biosynthetic pathway, in an inositol polyphosphate-dependent manner. Through a physical interaction, SPX4 prevented PAP1 from binding to its target gene promoter; by contrast, during Pi-deficient conditions, in the absence of inositol polyphosphates, PAP1 was released from SPX to activate anthocyanin biosynthesis. Our results reveal a direct link between Pi deficiency and flavonoid metabolism. This new regulatory module, at least partially independent from PHR1, may contribute to developing a strategy for plants to adapt to Pi starvation.

The hypersensitive induced reaction 3 (HIR3) gene contributes to plant basal resistance via an EDS1 and salicylic acid-dependent pathway.

The hypersensitive-induced reaction (HIR) gene family is associated with the hypersensitive response (HR) that is a part of the plant defense system against bacterial and fungal pathogens. The involvement of HIR genes in response to viral pathogens has not yet been studied. We now report that the HIR3 genes of Nicotiana benthamiana and Oryza sativa (rice) were upregulated following rice stripe virus (RSV) infection. Silencing of HIR3s in N. benthamiana resulted in an increased accumulation of RSV RNAs, whereas overexpression of HIR3s in N. benthamiana or rice reduced the expression of RSV RNAs and decreased symptom severity, while also conferring resistance to Turnip mosaic virus, Potato virus X, and the bacterial pathogens Pseudomonas syringae and Xanthomonas oryzae. Silencing of HIR3 genes in N. benthamiana reduced the content of salicylic acid (SA) and was accompanied by the downregulated expression of genes in the SA pathway. Transient expression of the two HIR3 gene homologs from N. benthamiana or the rice HIR3 gene in N. benthamiana leaves caused cell death and an accumulation of SA, but did not do so in EDS1-silenced plants or in plants expressing NahG. The results indicate that HIR3 contributes to plant basal resistance via an EDS1- and SA-dependent pathway.

Horizontal Transfer of a Retrotransposon from the Rice Planthopper to the Genome of an Insect DNA Virus.

Horizontal transfer of genetic materials between virus and host has been frequently identified. Three rice planthoppers, Laodelphax striatellus, Nilaparvata lugens, and Sogatella furcifera, are agriculturally important insects because they are destructive rice pests and also the vector of a number of phytopathogenic viruses. In this study, we discovered that a small region (∼300 nucleotides [nt]) of the genome of invertebrate iridescent virus 6 (IIV-6; genus Iridovirus, family Iridoviridae), a giant DNA virus that infects invertebrates but is not known to infect planthoppers, is highly homologous to the sequences present in high copy numbers in these three planthopper genomes. These sequences are related to the short interspersed nuclear elements (SINEs), a class of non-long terminal repeat (LTR) retrotransposons (retroposons), suggesting a horizontal transfer event of a transposable element from the rice planthopper genome to the IIV-6 genome. In addition, a number of planthopper transcripts mapped to these rice planthopper SINE-like sequences (RPSlSs) were identified and appear to be transcriptionally regulated along the different developmental stages of planthoppers. Small RNAs derived from these RPSlSs are predominantly 26 to 28 nt long, which is a typical characteristic of PIWI-interacting RNAs. Phylogenetic analysis suggests that IIV-6 acquires a SINE-like retrotransposon from S. furcifera after the evolutionary divergence of the three rice planthoppers. This study provides further examples of the horizontal transfer of an insect transposon to virus and suggests the association of rice planthoppers with iridoviruses in the past or present.IMPORTANCE This study provides an example of the horizontal transfer event from a rice planthopper genome to an IIV-6 genome. A small region of the IIV-6 genome (∼300 nt) is highly homologous to the sequences presented in high copy numbers of three rice planthopper genomes that are related to the SINEs, a class of retroposons. The expression of these planthopper SINE-like sequences was confirmed, and corresponding Piwi-interacting RNA-like small RNAs were identified and comprehensively characterized. Phylogenetic analysis suggests that the giant invertebrate iridovirus IIV-6 obtains this SINE-related sequence from Sogatella furcifera through a horizontal transfer event in the past. To the best of our knowledge, this is the first report of a horizontal transfer event between a planthopper and a giant DNA virus and also is the first evidence for the eukaryotic origin of genetic material in iridoviruses.

Occurrence of Soybean Yellow Common Mosaic Virus in Soybean in China Showing Yellow Common Mosaic Disease.

Soybean yellow common mosaic virus (SYCMV), a positive sense ssRNA virus classified in the genus Sobemovirus, was first reported and characterized in Korea (Nam et al., 2012). Currently, its only known host is soybean (Nam et al., 2012) on which it causes bright yellow mosaic and crinkling of the leaves (Lim et al., 2016). During a field survey in July 2019, bright yellow mosaic and mild crinkling symptoms were observed on soybean leaves (cv. Zhonghuang 13) in the Hubei province of China. To identify the possible pathogen(s) associated to the disease symptoms, leaves from five symptomatic plants were collected, pooled and total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). 10 µg of the total RNA was purified via magnetic beads (Thermo Fischer Scientific, USA) and a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA) was then used to construct an RNA sequencing library. Transcriptome sequencing was performed on an Illumina HiSeq 4000 (LC Sciences, USA). The average insert size for the paired-end library was 300 ± 50 bp. After quality control, a total of 47.5 million clean reads were obtained and assembled using the Trinity software (version 2.8.5). The assembled contigs were searched against NCBI virus RefSeqs (ftp://ftp.ncbi.nlm.nih.gov/refseq/release/viral) by the BLASTx algorithm with a cutoff E value of ≤10-5. 12 contigs sized from 3,421 to 4,093 bp were found to share a sequence identity of 77.5%-94.1% with SYCMV isolates from Japan (LC332541) and South Korea (JF495127.1). No other virus matches were identified. The largest contig (4,093 bp, MT816507) covers 99% of the expected complete genome of SYCMV (4,121 bp, KX096577). To verify the accuracy of the sequence assembled, RT-PCR-Sanger sequencing was performed on a single field plant sample using primers designed for SYCMV (Forward, 5'-GAACAAAGAGTCTGGATCTT-3'; Reverse, 5'-TCCTTCCAAAACCTCGCGGG-3'). The sequence of the amplicon (3854 bp, MT997092) exhibited an identity of 99.9% to the HTS-derived SYCMV contig sequence. Phylogenetic analysis of the amplicon sequence revealed that the SYCMV isolate from China formed a distinct branch in the tree (Fig. S1). Sap from symptomatic field plants was used to mechanically inoculate two soybean cultivars (Jiunong 9 and Kefeng 1, 10 plants per cultivar), and leaves inoculated with phosphate buffer saline (PBS, 0.01 M, pH 7.5) served as a control (3 plants per cultivar). All but the control plants developed systemic bright yellow mosaic symptoms 10 days after inoculation (Fig. S2A). The infection of the soybean plants with SYCMV was confirmed by RT-PCR with the newly designed primers for SYCMV (Forward, 5'- CCTACAGGCATTGGTTTCGT-3'; Reverse, 5'-CGTGAGGTTCTTGCTTCACA-3', anticipated amplicon size: 2,210 bp) (Fig. S2B) and by amplicon sequencing (100% sequence identity with MT9979092). In addition, the infection was further confirmed by immuno-blotting using an antibody against SYCMV coat protein (synthesized by GenScript, USA) (Fig. S2C). Together, the results demonstrate that SYCMV is the causal agent of the bright yellow mosaic symptoms in soybean observed in the field. To the best of our knowledge, this is the first report of SYCMV on soybean in China. These findings shall not only alert local growers to a potential new threat to soybean production in their region, but also provide new insights on the transmission, epidemiology and pathological properties of SYCMV in China.

Alterations of Rice (Oryza sativa L.) DNA Methylation Patterns Associated with Gene Expression in Response to Rice Black Streaked Dwarf Virus.

Rice black-streaked dwarf virus (RBSDV) causes severe yield losses in rice (Oryza sativa L.) in China. Studies have shown that the mechanisms of DNA methylation-mediated plant defense against DNA viruses and RNA viruses are different. However, in rice its function in response to infection of RBSDV, a double-stranded RNA virus, remains unclear. In this study, high-throughput single-base resolution bisulfite sequencing (BS-Seq) was carried out to analyze the distribution pattern and characteristics of cytosine methylation in RBSDV-infected rice. Widespread differences were identified in CG and non-CG contexts between the RBSDV-infected and RBSDV-free rice. We identified a large number of differentially methylated regions (DMRs) along the genome of RBSDV-infected rice. Additionally, the transcriptome sequencing analysis obtained 1119 differentially expressed genes (DEGs). Correlation analysis of DMRs-related genes (DMGs) and DEGs filtered 102 genes with positive correlation and 71 genes with negative correlation between methylation level at promoter regions and gene expression. Key genes associated with maintaining DNA methylation in rice were analyzed by RT-qPCR and indicated that OsDMT702 might be responsible for the global increase of DNA methylation level in rice under RBSDV stress. Our results suggest important roles of rice DNA methylation in response to RBSDV and provide potential target genes for rice antiviral immunity.

The Dual Effect of the Brassinosteroid Pathway on Rice Black-Streaked Dwarf Virus Infection by Modulating the Peroxidase-Mediated Oxidative Burst and Plant Defense.

The phytohormone brassinosteroid (BR) not only plays key roles in regulating plant growth and development but is also involved in modulating the plant defense system in response to pathogens. We previously found that BR application made rice plants more susceptible to the devastating pathogen rice black-streaked dwarf virus (RBSDV), but the mechanism of BR-mediated susceptibility remains unclear. We now show that both BR-deficient and -insensitive mutants are resistant to RBSDV infection. High-throughput sequencing showed that the defense hormone salicylic acid and jasmonic acid pathways were activated in the RBSDV-infected BR mutant. Meanwhile, a number of class III peroxidases (OsPrx) were significantly changed and basal reactive oxygen species (ROS) accumulated in BR mutants. Treatment with exogenous hormones and other chemicals demonstrated that the BR pathway could suppress the levels of OsPrx and the ROS burst by directly binding the promoters of OsPrx genes. Together, our findings indicate that BR-mediated susceptibility is at least partly caused by inhibition of the action of defense hormones, preventing the accumulation of the peroxidase-mediated oxidative burst.

AtHB2, a class II HD-ZIP protein, negatively regulates the expression of CsANS, which encodes a key enzyme in Camellia sinensis catechin biosynthesis.

Tea (Camellia sinensis) is an important cash crop that is beneficial to human health because of its remarkable content of catechins. The biosynthesis of catechins follows the flavonoid pathway, which is highly branched. Among the enzymes involved in catechin biosynthesis, ANTHOCYANIDIN SYNTHASE (CsANS) functions at a branch point and play a critical role. Our previous work has showed that the gene encoding CsANS is regulated by light signals; however, the molecular mechanism behind remains unclear. Here, we cloned a full-length CsANS promoter and found that it contained a cis-element recognized by Arabidopsis thaliana HOMEOBOX2 (AtHB2). AtHB2 constitutes one of the class II HOMEODOMAIN-LEUCINE ZIPPER (HD-ZIP) proteins, which accumulate in the dark and mediate the shade avoidance response in most angiosperms. To analyze the transcription of CsANS in vivo, ß-glucuronidase and luciferase reporter genes driven by the obtained promoter were introduced into A. thaliana and Nicotiana attenuata, respectively. In both expression systems there were indications that the A. thaliana PRODUCTION OF ANTHOCYANIN PIGMENT1 (AtPAP1), a MYB transcription factor of flavonoid biosynthesis, increased the activity of the CsANS promoter, while AtHB2 could significantly undermine the effect of AtPAP1. Yeast two-hybrid and bimolecular fluorescence complementation assays showed that AtHB2 interacted with the A. thaliana TRANSPARENT TESTA GLABRA 1 (AtTTG1). A yeast three-hybrid assay further suggested that AtHB2 represses the expression of CsANS and regulates its response to light signals through competitive interactions with AtTTG1. These results show that HD-ZIP II proteins participate in light regulation of flavonoid biosynthesis.