A principal component analysis of metabolome and cognitive decline among Japanese older adults: cross-sectional analysis using Tohoku Medical Megabank Cohort Study.

BackgroundDementia is the leading cause of disability and imposes a significant burden on society. Previous studies have suggested an association between metabolites and cognitive decline. Although the metabolite composition differs between Western and Asian populations, studies targeting Asian populations remain scarce.MethodsThis cross-sectional study used data from a cohort survey of community-dwelling older adults aged ≥ 60 years living in Miyagi, Japan, conducted by Tohoku Medical Megabank Organization between 2013 and 2016. Forty-three metabolite variables quantified using nuclear magnetic resonance spectroscopy were used as explanatory variables. Dependent variable was the presence of cognitive decline (≤ 23 points), assessed by the Mini-Mental State Examination. Principal component (PC) analysis was performed to reduce the dimensionality of metabolite variables, followed by logistic regression analysis to calculate odds ratios (ORs) and 95% confidence intervals (CIs) for cognitive decline.ResultsA total of 2,940 participants were included (men: 49.0%, mean age: 67.6 years). Among them, 1.9% showed cognitive decline. The first 12 PC components (PC1-PC12) accounted for 71.7% of the total variance. Multivariate analysis showed that PC1, which mainly represented essential amino acids, was associated with lower odds of cognitive decline (OR = 0.89; 95% CI, 0.80-0.98). PC2, which mainly included ketone bodies, was associated with cognitive decline (OR = 1.29; 95% CI, 1.11-1.51). PC3, which included amino acids, was associated with lower odds of cognitive decline (OR = 0.81; 95% CI, 0.66-0.99).ConclusionAmino acids are protectively associated with cognitive decline, whereas ketone metabolites are associated with higher odds of cognitive decline.

Pretreatment with tadalafil attenuates cardiotoxicity induced by combretastatin A4 disodium phosphate in rats.

Combretastatin A4 disodium phosphate (CA4DP) is a prodrug of combretastatin A4 (CA4), a microtubule-disassembling agent that exhibits antitumor effects by inhibiting tumor cell proliferation and inducing morphological changes and apoptosis in vascular endothelial cells in tumors. However, cardiotoxicity induced by ischemia and hypertension is a severe adverse event. In this study, we focused on the fact that phosphodiesterase (PDE) 5 inhibitors dilate the heart and peripheral blood vessels and aimed to investigate whether co-administration of tadalafil, a PDE5 inhibitor, can attenuate cardiotoxicity without altering the antitumor effect of CA4DP. To investigate cardiotoxicity, CA4DP and/or tadalafil were administered to rats, and blood pressure, echocardiography, histopathology, and cGMP concentration in the myocardium were examined. Administration of CA4DP increased systolic blood pressure, decreased cardiac function, lowered cGMP levels in the myocardium, and led to necrosis of myocardial cells. Co-administration of tadalafil attenuated these CA4DP-induced changes. To investigate the antitumor effect, canine mammary carcinoma cell lines (CHMp-13a) and human umbilical vein endothelial cells were cultured with CA4 and/or tadalafil, and cell proliferation and endothelial vascular tube disruption were examined. CHMp-13a cells were transplanted into nude mice and treated with CA4DP and/or tadalafil. CA4-induced inhibition of cell proliferation and disruption of the endothelial vascular tube were not affected by co-treatment with tadalafil, and the antitumor effects of CA4DP in xenograft mice were not reduced by co-administration of tadalafil. These results revealed that myocardial damage induced by CA4DP was attenuated by co-administration of tadalafil while maintaining antitumor efficacy.

Higher-resolution quantification of white matter hypointensities by large-scale transfer learning from 2D images on the JPSC-AD cohort.

White matter lesions (WML) commonly occur in older brains and are quantifiable on MRI, often used as a biomarker in Aging research. Although algorithms are regularly proposed that identify these lesions from T2-fluid-attenuated inversion recovery (FLAIR) sequences, none so far can estimate lesions directly from T1-weighted images with acceptable accuracy. Since 3D T1 is a polyvalent and higher-resolution sequence, it could be beneficial to obtain the distribution of WML directly from it. However a serious difficulty, both for algorithms and human, can be found in the ambiguities of brain signal intensity in T1 images. This manuscript shows that a cross-domain ConvNet (Convolutional Neural Network) approach can help solve this problem. Still, this is non-trivial, as it would appear to require a large and varied dataset (for robustness) labelled at the same high resolution (for spatial accuracy). Instead, our model was taught from two-dimensional FLAIR images with a loss function designed to handle the super-resolution need. And crucially, we leveraged a very large training set for this task, the recently assembled, multi-sites Japan Prospective Studies Collaboration for Aging and Dementia (JPSC-AD) cohort. We describe the two-step procedure that we followed to handle such a large number of imperfectly labeled samples. A large-scale accuracy evaluation conducted against FreeSurfer 7, and a further visual expert rating revealed that WML segmentation from our ConvNet was consistently better. Finally, we made a directly usable software program based on that trained ConvNet model, available at https://github.com/bthyreau/deep-T1-WMH.

Sex-Dependent Effects of the APOE ɛ4 Allele on Behavioral Traits and White Matter Structures in Young Adults.

The APOE ɛ4 allele is associated with a risk of Alzheimer's disease in the elderly, with the association being pronounced in females. Conversely, findings of the effects of the APOE ɛ4 allele in young adults are mixed. Here, we investigated the sex-genotype interaction effects of the APOE ɛ4 allele on cognitive functions as well as brain structures among 1258 young adults. After adjusting for multiple comparisons, there were significant effects of the interaction between sex and the number of APOE ɛ4 allele on some speed tasks (e.g., simple processing speed tasks and the reverse Stroop task) as well as on regional white matter volume (rWMV). The observed sex-genotype interaction conferred better cognitive performance and greater rWMV in the anterior frontal and precentral white matter areas in females having more APOE ɛ4 alleles and reduced rWMV in the same areas in male having more APOE ɛ4 alleles. These findings support the long-debated antagonistic pleiotropic effects of the APOE ɛ4 allele in females.

Polygenic risk score for bipolar disorder associates with divergent thinking and brain structures in the prefrontal cortex.

It has been hypothesized that a higher genetic risk of bipolar disorder (BD) is associated with greater creativity. Given the clinical importance of bipolar disorder and the importance of creativity to human society and cultural development, it is essential to reveal their associations and the neural basis of the genetic risk of bipolar disorder to gain insight into its etiology. However, despite the previous demonstration of the associations of polygenic risk score (PRS) of BD and creative jobs, the associations of BD-PRS and creativity measured by the divergent thinking (CMDT) and regional gray matter volume (rGMV) as well as regional white matter volume (rWMV) have not been investigated. Using psychological analyses and whole-brain voxel-by-voxel analyses, we examined these potential associations in 1558 young, typically developing adult students. After adjusting for confounding variables and multiple comparisons, a greater BD-PRS was associated with a greater total CMDT fluency score, and a significant relationship was found in fluency subscores. A greater BD-PRS was also associated with lower total mood disturbance. Neuroimaging analyses revealed that the BD-PRS was associated with greater rGMV in the right inferior frontal gyrus, which is a consistently affected area in BD, as well as a greater rWMV in the left middle frontal gyrus, which has been suggested to play a central role in the increased creativity associated with the risk of BD with creativity. These findings suggest a relationship between the genetic risk of BD and CMDT and prefrontal cortical structures among young educated individuals.

Study Profile of the Tohoku Medical Megabank Community-Based Cohort Study.

BACKGROUND: We established a community-based cohort study to assess the long-term impact of the Great East Japan Earthquake on disaster victims and gene-environment interactions on the incidence of major diseases, such as cancer and cardiovascular diseases. METHODS: We asked participants to join our cohort in the health check-up settings and assessment center based settings. Inclusion criteria were aged 20 years or over and living in Miyagi or Iwate Prefecture. We obtained information on lifestyle, effect of disaster, blood, and urine information (Type 1 survey), and some detailed measurements (Type 2 survey), such as carotid echography and calcaneal ultrasound bone mineral density. All participants agreed to measure genome information and to distribute their information widely. RESULTS: As a result, 87,865 gave their informed consent to join our study. Participation rate at health check-up site was about 70%. The participants in the Type 1 survey were more likely to have psychological distress than those in the Type 2 survey, and women were more likely to have psychological distress than men. Additionally, coastal residents were more likely to have higher degrees of psychological distress than inland residents, regardless of sex. CONCLUSION: This cohort comprised a large sample size and it contains information on the natural disaster, genome information, and metabolome information. This cohort also had several detailed measurements. Using this cohort enabled us to clarify the long-term effect of the disaster and also to establish personalized prevention based on genome, metabolome, and other omics information.

Association between the social isolation and depressive symptoms after the great East Japan earthquake: findings from the baseline survey of the TMM CommCohort study.

BACKGROUND: Social isolation and mental health issues have become a severe problem in disaster areas in the Great East Japan Earthquake. This study examined whether the combination of the house damage and social isolation or the combination of the death of family members and social isolation is associated with depressive symptoms among survivors using the baseline study data of the Tohoku Medical Megabank Project Community-Based Cohort Study (TMM CommCohort Study). METHODS: We used cross-sectional data from a baseline survey of 48,958 participants (18,423 males, 30,535 females; aged 60.1 ± 11.2 years) to examine the association between social isolation measured by the Lubben social network scale 6 (LSNS-6) and depressive symptoms measured by the Center for Epidemiological Studies-Depressive Scale (CES-D). The presence of social isolation and depressive symptoms was defined by an LSNS-6 score of < 12 and a CES-D score of ≥16, respectively. We performed a logistic regression analysis to determine the multivariable-adjusted odds ratio (95% confidence interval) [AOR (95% CI)] for depressive symptoms according to sex in the social isolation in comparison to without social isolation, and the associations of the combination of the house damage or the death of family members and social isolation and depressive symptoms. RESULTS: Social isolation was significantly associated with depressive symptoms (males: OR = 1.87; 95% CI = 1.72-2.04, females: OR = 2.13; 95% CI = 2.00-2.26). Both males and females respondents with severe house damage and social isolation had a greater risk of depressive symptoms in comparison to those with an undamaged house and without social isolation (males: OR = 3.40; 95% CI = 2.73-4.24, females: OR = 2.92; 95% CI = 2.46-3.46). The risk of depressive symptoms was also higher in both males and females respondents with the death of family members and social isolation in comparison to those without the death of family members and without social isolation (males: OR = 2.18; 95% CI = 1.90-2.50, females: OR = 2.60; 95% CI = 2.35-2.88). CONCLUSION: The findings suggested that a combination of social isolation and severe house damage and the death of family members caused by a large-scale natural disaster was associated with a higher risk of depressive symptoms although the interaction was not statistically significant.

Alzheimer's Disease and Type 2 Diabetes Mellitus: The Use of MCT Oil and a Ketogenic Diet.

Recently, type 2 diabetes mellitus (T2DM) has been reported to be strongly associated with Alzheimer's disease (AD). This is partly due to insulin resistance in the brain. Insulin signaling and the number of insulin receptors may decline in the brain of T2DM patients, resulting in impaired synaptic formation, neuronal plasticity, and mitochondrial metabolism. In AD patients, hypometabolism of glucose in the brain is observed before the onset of symptoms. Amyloid-ß accumulation, a main pathology of AD, also relates to impaired insulin action and glucose metabolism, although ketone metabolism is not affected. Therefore, the shift from glucose metabolism to ketone metabolism may be a reasonable pathway for neuronal protection. To promote ketone metabolism, medium-chain triglyceride (MCT) oil and a ketogenic diet could be introduced as an alternative source of energy in the brain of AD patients.

Originality of divergent thinking is associated with working memory-related brain activity: Evidence from a large sample study.

The originality of creativity measured by divergent thinking (CMDT) is a unique variable that is positively correlated with psychometric intelligence and other psychological measures. Here, we aimed to determine the associations of CMDT originality/fluency scores and brain activity associated with working memory (WM) and simple cognitive processes during the N-back paradigm in a cohort of 1221 young adults. We observed that originality/fluency scores were associated with greater brain activity during the 0-back simple cognitive task and 2-back WM task in key nodes of the ventral attention system in the right hemisphere. Further, subjects with higher originality/fluency scores showed lower task-induced deactivations in areas of the default mode network, especially during the 2-back task. Psychological analyses revealed the associations of originality/fluency scores with both psychometric intelligence and systemizing. We also observed the effects of interaction between sex and originality/fluency scores on functional activity during the 0-back task in posterior parts of the default mode network together with other areas as well as simple processing speed. These results indicate that the originality of CMDT is associated with (a) greater activation of the ventral attention system, which is involved in reorienting attention and (b) reduced task-induced deactivation of the default mode network, which is indicative of alterations in attentional reallocation, and (c) cognitive correlates of originality of CMDT and revealed sex differences in these associations.

Convergent creative thinking performance is associated with white matter structures: Evidence from a large sample study.

In laboratory settings, creativity is measured using tasks of divergent as well as convergent thinking. It has been suggested that brain connectivity is important for creativity. In the present study, we investigated the associations of convergent thinking performance of compound Remote Associates Test (CRAT) with fractional anisotropy (FA) in diffusion tensor imaging and regional white matter (WM) volume (rWMV) in voxel-based morphometry in a large sample of healthy young adults (360 males and 280 females; mean age: 20.9 years, SD â€‹= â€‹1.6). We showed that CRAT performance was positively correlated with WM pathway property (i.e., FA) in the left fronto-occipital fasciculus and the left inferior longitudinal fasciculus, which play important roles in processing of language and concept. Further, CRAT performance was negatively correlated with rWMV in the widespread frontal temporal subcortical and cerebellar WM areas, suggesting the unique association of convergent thinking with WM connectivity.

Diversity of ATM gene variants: a population-based genome data analysis for precision medicine.

BACKGROUND: Ataxia-telangiectasia (AT) is a rare autosomal recessive disorder that causes deficiency or dysfunction of the ataxia-telangiectasia mutated (ATM) protein. Not only AT patients, but also certain ATM heterozygous mutation carriers show a significantly reduced life expectancy due to cancer and ischemic heart disease; in particular, female carriers having particular alleles have an increased risk of breast cancer. The frequency of such risk heterozygotes at a population level remains to be fully determined, and evidence-based preventive medical guidelines have not yet been established. METHODS: Using the 3.5KJPNv2 allele frequency panel of Japanese Multi Omics Reference Panel v201902, which shows single-nucleotide variant (SNV) and insertion/deletion (INDEL) allele frequencies from 3552 Japanese healthy individuals, we investigated the diversity of ATM gene variants. RESULTS: We detected 2845 (2370 SNV and 475 INDEL) variants in the ATM gene, including 1338 (1160 SNV and 178 INDEL) novel variants. Also, we found a stop-gained SNV (NC_000008.11:g.108115650G > A (p.Trp266*)) and a disruptive-inframe-deletion (NC_000008.11:g. 108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal) and two frameshift INDELs (NC_000008.11:g.108119714CAA/C (p.Glu376fs) and NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)), which would be novel variants predicted to lead to loss of ATM functionality. CONCLUSION: The combination of population-based biobanking and human genomics provided a novel insight of diversity of ATM gene variants at a population level. For the advancement of precision medicine, such approach will be useful to predict novel pathogenic/likely pathogenic variants in the ATM gene and to establish preventive medical guidelines for certain ATM heterozygotes pertaining to their risk of particular diseases.

Increased grey matter volume of the right superior temporal gyrus in healthy children with autistic cognitive style: A VBM study.

The empathizing-systemizing model describes human cognitive style using empathizing (the drive to identify another's mental state and respond appropriately) and systemizing (the drive to assess or construct rule-based systems). 'Brain type' was envisioned to explain individual differences in cognitive style based on the discrepancy of the two drives. In this model, individuals with autism spectrum disorder (ASD), a neurodevelopmental disorder, have extremely stronger systemizing. Revealing the underlying mechanisms of individual differences in cognitive style might contribute to elucidation of the pathology of ASD. We used voxel-based morphometry to compare the brain structures among the brain types (those who have stronger empathizing, those who have equally stronger drive to both, and those who have stronger systemizing) in 207 healthy children (age range: 5-15). Results showed that children with stronger systemizing had significantly greater grey matter volume of the right superior temporal gyrus (rSTG) than the others. The brain region, a distinctive brain structure of those with stronger systemizing, was overlapped with that of children with ASD. The rSTG is involved in detailed perceptual processing in social cognition, which is partially related to stronger systemizing. Our results contribute to elucidation of the underlying mechanisms of individual differences in cognitive style.

A Common CACNA1C Gene Risk Variant has Sex-Dependent Effects on Behavioral Traits and Brain Functional Activity.

Genome-wide association studies have suggested that allelic variations in the CACNA1C gene confer susceptibility to schizophrenia and bipolar disorder only in women. Here we investigated the sex-specific effects of the CACNA1C variant rs1024582 on psychiatry-related traits, brain activity during tasks and rest, and brain volume in 1207 normal male and female subjects. After correcting for multiple comparisons, there were significant interaction effects between sex and the minor allele of this polymorphism on the hostile behavior subscale scores of the Coronary-Prone Type Scale mediated by higher scores in female carriers of the minor allele. Imaging analyses revealed significant interaction effects between sex and the minor allele on fractional amplitude of low-frequency fluctuations in the right dorsolateral prefrontal cortex and on brain activity during the 2-back task in areas of the right posterior cingulate cortex, right thalamus, and right hippocampus, which were all mediated by reduced activity in female carriers of the minor allele. Our results demonstrated that the rs1024582 risk variant of CACNA1C is associated with reduced activity in the frontolimbic regions at rest and during a working memory task as well as with greater hostility in females in the healthy population.

Hypoperfusion in the posterior cingulate cortex is associated with lower bone mass density in elderly women with osteopenia and Alzheimer's disease.

Accelerated bone loss is closely associated with Alzheimer's disease (AD), but the relationship between bone mineral density (BMD) and imaging markers of neurodegeneration remains uncertain. We examined the effect of low bone mass (osteopenia) on regional cerebral blood flow (rCBF) in patients with AD (n = 19) and non-demented aging (n = 12). We enrolled 31 female outpatients diagnosed with osteopenia (age ≥ 65 years) who had both a single-photon emission computed tomography brain scan and dual-energy X-ray absorptiometry bone scan taken at their initial investigation. We analyzed the relationship between osteopenia (-2.5 < T-score < -1) and rCBF in 62 cortical areas measured using the stereotactic extraction estimation analysis on single-photon emission computed tomography (SPECT) (mean Z-scores). We found that the mean Z-scores of 14 cerebral subregions, most of which are often affected early in AD, were significantly lower in the AD group than the non-demented group (P < .001). The age-stratified multivariate regression analysis showed that the decreased rCBF in the left posterior cingulate cortex (PCC) was an independent predictor of osteopenia (r = -0.395; P = .005). BMD and rCBF in the left PCC were significantly correlated in the overall population (r = -0.54; P = .001), as well as the AD group (r = -0.514; P = .02). These imaging data suggest that osteopenia may contribute to neurodegeneration of a brain network hub associated with AD.

A single nucleotide polymorphism (-250 A/C) of the GFAP gene is associated with brain structures and cerebral blood flow.

AIM: Glial fibrillary acidic protein (GFAP), the intermediate filament protein expressed in astrocytes, plays a key role in many aspects of brain function through communication with neurons or blood vessels. A common single nucleotide polymorphism (SNP), GFAP -250 C/A (rs2070935), is associated with the transcriptional regulation of GFAP, which can potentially result in the genotype-specific brain structure. This study aimed to verify the biological effects of the GFAP variants on brain structure and function. METHODS: We investigated the associations between the GFAP variants and magnetic resonance imaging findings, including gray and white matter volumes, white matter integrity, and resting arterial blood flow, from 1212 healthy Japanese subjects. RESULTS: The GFAP -250 C/A genotype was significantly associated with total gray matter volume, total white matter volume, average mean diffusivity, and mean cerebral blood flow. In voxel-by-voxel analyses, the GFAP genotype showed significant associations with the regional gray and white matter volumes in the inferior frontal lobe and corpus callosum, the regional mean diffusivity in the left posterior region, and the regional cerebral blood flow throughout the brain. CONCLUSION: This study revealed a common SNP that is significantly associated with multiple global brain structure parameters.

Alzheimer's Disease and Specialized Pro-Resolving Lipid Mediators: Do MaR1, RvD1, and NPD1 Show Promise for Prevention and Treatment?

Alzheimer's disease (AD) is a common neurodegenerative disease and a major contributor to progressive cognitive impairment in an aging society. As the pathophysiology of AD involves chronic neuroinflammation, the resolution of inflammation and the group of lipid mediators that actively regulate it-i.e., specialized pro-resolving lipid mediators (SPMs)-attracted attention in recent years as therapeutic targets. This review focuses on the following three specific SPMs and summarizes their relationships to AD, as they were shown to effectively address and reduce the risk of AD-related neuroinflammation: maresin 1 (MaR1), resolvin D1 (RvD1), and neuroprotectin D1 (NPD1). These three SPMs are metabolites of docosahexaenoic acid (DHA), which is contained in fish oils and is thus easily available to the public. They are expected to become incorporated into promising avenues for preventing and treating AD in the future.

Study design and baseline characteristics of a population-based prospective cohort study of dementia in Japan: the Japan Prospective Studies Collaboration for Aging and Dementia (JPSC-AD).

BACKGROUND: The burden of dementia is growing rapidly and has become a medical and social problem in Japan. Prospective cohort studies have been considered an effective methodology to clarify the risk factors and the etiology of dementia. We aimed to perform a large-scale dementia cohort study to elucidate environmental and genetic risk factors for dementia, as well as their interaction. METHODS: The Japan Prospective Studies Collaboration for Aging and Dementia (JPSC-AD) is a multisite, population-based prospective cohort study of dementia, which was designed to enroll approximately 10,000 community-dwelling residents aged 65 years or older from 8 sites in Japan and to follow them up prospectively for at least 5 years. Baseline exposure data, including lifestyles, medical information, diets, physical activities, blood pressure, cognitive function, blood test, brain magnetic resonance imaging (MRI), and DNA samples, were collected with a pre-specified protocol and standardized measurement methods. The primary outcome was the development of dementia and its subtypes. The diagnosis of dementia was adjudicated by an endpoint adjudication committee using standard criteria and clinical information according to the Diagnostic and Statistical Manual of Mental Disorders, 3rd Revised Edition. For brain MRI, three-dimensional acquisition of T1-weighted images was performed. Individual participant data were pooled for data analyses. RESULTS: The baseline survey was conducted from 2016 to 2018. The follow-up surveys are ongoing. A total of 11,410 individuals aged 65 years or older participated in the study. The mean age was 74.4 years, and 41.9% were male. The prevalence of dementia at baseline was 8.5% in overall participants. However, it was 16.4% among three sites where additional home visit and/or nursing home visit surveys were performed. Approximately two-thirds of dementia cases at baseline were Alzheimer's disease. CONCLUSIONS: The prospective cohort data from the JPSC-AD will provide valuable insights regarding the risk factors and etiology of dementia as well as for the development of predictive models and diagnostic markers for the future onset of dementia. The findings of this study will improve our understanding of dementia and provide helpful information to establish effective preventive strategies for dementia in Japan.

Non-invasive three-dimensional power Doppler imaging for the assessment of acute cerebral blood flow alteration in a mouse model of subarachnoid haemorrhage.

We aimed to evaluate the feasibility of a non-invasive method of cerebral blood flow (CBF) measurement using high-frequency power Doppler ultrasound imaging in a mouse model of subarachnoid haemorrhage (SAH). The 3-dimensionally (3D) reconstructed blood flow signals (%vascularity) within the brain volume of the middle cerebral artery territory correlated well with reference parameters, baseline carotid artery blood flow (r2  = 0.52, P < 0.0001) and normalized CBF changes (r2  = 0.74 P < 0.0001). These data suggest that the 3D power Doppler analysis may have the potential for reflecting real-time CBF changes during the acute phase of experimental SAH, which may be applicable to preclinical studies on early brain injury.

Effect of hippotherapy on gait symmetry in children with cerebral palsy: A pilot study.

We aimed to investigate the effect of hippotherapy on gait symmetry in children with cerebral palsy (CP). Twelve children with Gross Motor Function Classification System (GMFCS) levels II-IV received weekly hippotherapy lesson for 1 year. Gait analyses were performed during a 5-m walking test, using a portable, tri-axial accelerometer-based motion recorder. The baseline symmetry index derived from the Lissajous index (LI) figure before hippotherapy was greater than the LI in age-matched normal subjects (P < 0.01). Hippotherapy was associated with a decreased LI (-10.4 ± 4.9%, P = 0.018) and an improved GMFCS score (-0.6 ± 0.7, P = 0.02). These data suggest that hippotherapy has a beneficial effect on symmetry of the trunk movement in children with CP.

Clinical Utility of a Semiquantitative Method Using Lumbar Radiography as a Screening Tool for Osteoporosis in Elderly Subjects.

BACKGROUND Osteoporosis is a major global public health problem in the current aging era. Osteoporosis is often diagnosed only after patients have a fracture that causes a severe decline in ability to perform activities of daily life. Although the current criterion standard for diagnosing osteoporosis is dual-energy X-ray absorptiometry (DXA), this modality remains less prevalent among general practitioners in geriatric medicine. The aim of this study was to determine the diagnostic utility of visual inspection of lumbar radiography in detecting bone mineral density (BMD) decline. MATERIAL AND METHODS We retrospectively reviewed medical data of 78 patients who underwent both lateral lumbar radiography and DXA. Board-certified radiologists determined the clinical grade of each patient's condition according to the semiquantitative (SQ) method of lumbar fracture assessment. We compared the grades and young adult means of BMD in the lumbar spine and hips as measured using DXA. RESULTS BMD of the femoral neck was significantly lower in patients with severe osteoporosis (grades 2 and 3 as classified using the SQ method) than in those with mild osteoporosis (grades 0 and 1; P<0.05). A receiver operating characteristic curve analysis showed that the SQ method can help predict the decrease in BMD (young adult mean score of <70%) in the femoral neck with moderate accuracy (sensitivity, 0.621; specificity, 0.829; area under the curve, 0.742). CONCLUSIONS These results suggest that lateral lumbar radiography can provide useful information about bone mineral status and can serve as a tool for osteoporosis screening by general practitioners.