Genome-wide analysis and expression pattern of the ZoPP2C gene family in Zingiber officinale Roscoe.

BACKGROUND: Protein phosphatases type 2C (PP2C) are heavily involved in plant growth and development, hormone-related signaling pathways and the response of various biotic and abiotic stresses. However, a comprehensive report identifying the genome-scale of PP2C gene family in ginger is yet to be published. RESULTS: In this study, 97 ZoPP2C genes were identified based on the ginger genome. These genes were classified into 15 branches (A-O) according to the phylogenetic analysis and distributed unevenly on 11 ginger chromosomes. The proteins mainly functioned in the nucleus. Similar motif patterns and exon/intron arrangement structures were identified in the same subfamily of ZoPP2Cs. Collinearity analysis indicated that ZoPP2Cs had 33 pairs of fragment duplicated events uniformly distributed on the corresponding chromosomes. Furthermore, ZoPP2Cs showed greater evolutionary proximity to banana's PP2Cs. The forecast of cis-regulatory elements and transcription factor binding sites demonstrated that ZoPP2Cs participate in ginger growth, development, and responses to hormones and stresses. ZoERFs have plenty of binding sites of ZoPP2Cs, suggesting a potential synergistic contribution between ZoERFs and ZoPP2Cs towards regulating growth/development and adverse conditions. The protein-protein interaction network displayed that five ZoPP2Cs (9/23/26/49/92) proteins have robust interaction relationship and potential function as hub proteins. Furthermore, the RNA-Seq and qRT-PCR analyses have shown that ZoPP2Cs exhibit various expression patterns during ginger maturation and responses to environmental stresses such as chilling, drought, flooding, salt, and Fusarium solani. Notably, exogenous application of melatonin led to notable up-regulation of ZoPP2Cs (17/59/11/72/43) under chilling stress. CONCLUSIONS: Taken together, our investigation provides significant insights of the ginger PP2C gene family and establishes the groundwork for its functional validation and genetic engineering applications.

Porcine deltacoronavirus nonstructural protein 2 inhibits type I and III IFN production by targeting STING for degradation.

Porcine deltacoronavirus (PDCoV) is an enteropathogenic coronavirus that has been reported to use various strategies to counter the host antiviral innate immune response. The cGAS-STING signalling pathway plays an important role in antiviral innate immunity. However, it remains unclear whether PDCoV achieves immune evasion by regulating the cGAS-STING pathway. Here, we demonstrated that the nonstructural protein 2 (nsp2) encoded by PDCoV inhibits cGAS-STING-mediated type I and III interferon (IFN) responses via the regulation of porcine STING (pSTING) stability. Mechanistically, ectopically expressed PDCoV nsp2 was found to interact with the N-terminal region of pSTING. Consequently, pSTING was degraded through K48-linked ubiquitination and the proteasomal pathway, leading to the disruption of cGAS-STING signalling. Furthermore, K150 and K236 of pSTING were identified as crucial residues for nsp2-mediated ubiquitination and degradation. In summary, our findings provide a basis for elucidating the immune evasion mechanism of PDCoV and will contribute to the development of targets for anti-coronavirus drugs.

Identification of pigeon mitochondrial antiviral signaling protein (MAVS) and its role in antiviral innate immunity.

Pigeons can be infected with various RNA viruses, and their innate immune system responds to viral infection to establish an antiviral response. Mitochondrial antiviral signaling protein (MAVS), an important adaptor protein in signal transduction, plays a pivotal role in amplifying the innate immune response. In this study, we successfully cloned pigeon MAVS (piMAVS) and performed a bioinformatics analysis. The results showed that the caspase recruitment domain (CARD) and transmembrane (TM) domain are highly conserved in poultry and mammals but poorly conserved in other species. Furthermore, we observed that MAVS expression is upregulated both in pigeons and pigeon embryonic fibroblasts (PEFs) upon RNA virus infection. Overexpression of MAVS resulted in increased levels of ß-interferon (IFN-ß), IFN-stimulated genes (ISGs), and interleukin (ILs) mRNA and inhibited Newcastle disease virus (NDV) replication. We also found that piMAVS and human MAVS (huMAVS) induced stronger expression of IFN-ß and ISGs when compared to chicken MAVS (chMAVS), and this phenomenon was also reflected in the degree of inhibition of NDV replication. Our findings demonstrate that piMAVS plays an important role in repressing viral replication by regulating the activation of the IFN signal pathway in pigeons. This study not only sheds light on the function of piMAVS in innate immunity but also contributes to a more comprehensive understanding of the innate immunity system in poultry. Our data also provide unique insights into the differences in innate immunity between poultry and mammal.

Phage cocktail superimposed disinfection: A ecological strategy for preventing pathogenic bacterial infections in dairy farms.

Bovine mastitis (BM) is mainly caused by bacterial infection that has a highly impact on dairy production, affecting both economic viability and animal well-being. A cross-sectional study was conducted in dairy farms to investigate the prevalence and antimicrobial resistance patterns of bacterial pathogens associated with BM. The analysis revealed that Staphylococcus (49%), Escherichia (16%), Pseudomonas (11%), and Klebsiella (6%) were the primary bacterial pathogens associated with mastitis. A significant proportion of Staphylococcus strains displayed multiple drug resistance. The use of disinfectants is an important conventional measure to control the pathogenic bacteria in the environment. Bacteriophages (Phages), possessing antibacterial properties, are natural green and effective disinfectants. Moreover, they mitigate the risk of generating harmful disinfection byproducts, which are commonly associated with traditional disinfection methods. Based on the primary bacterial pathogens associated with mastitis in the investigation area, a phage cocktail, named SPBC-SJ, containing seven phages capable of lysing S. aureus, E. coli, and P. aeruginosa was formulated. SPBC-SJ exhibited superior bactericidal activity and catharsis effect on pollutants (glass surface) compared to chemical disinfectants. Clinical trials confirmed that the SPBC-SJ-based superimposed disinfection group (phage combined with chemical disinfectants) not only cut down the dosage of disinfectants used, but significantly reduced total bacterial counts on the ground and in the feeding trough of dairy farms. Furthermore, SPBC-SJ significantly reduced the abundance of Staphylococcus and Pseudomonas in the environment of the dairy farm. These findings suggest that phage-based superimposed disinfection is a promising alternative method to combat mastitis pathogens in dairy farms due to its highly efficient and environmentally-friendly properties.

Genome-wide analyses based on a novel donkey 40K liquid chip reveal the gene responsible for coat color diversity in Chinese Dezhou donkey.

Dezhou donkey is one of the representative local breeds in China, which is mainly divided into two strains: Sanfen and Wutou. There are obvious differences in coat color between the two strains. The former shows light points around the eyes, around the muzzle and under the belly, while the latter is completely solid black. In this study, genome-wide association analysis was performed for the differences in coat color traits between the Sanfen (n = 97) and Wutou (n = 108) strains using a novel donkey 40K liquid chip developed based on GenoBaits technology, to identify genomic regions and causal genes that could explain this variation. We also used FST and The cross-population composite likelihood ratio test (XPCLR) analyses to explore selected regions related to coat color differences. We identified one significant region on chromosome 15, with the most significant SNP located within the agouti signaling protein (ASIP) gene. At the same time, both FST and XPCLR methods detected the same selected region on chromosome 15, and ASIP was the gene with the strongest signal. ASIP and melanocortin 1 receptor (MC1R) control the ratio of eumelanin to pheomelanin through their protein activity. They are deeply involved in the process of melanosome organation and melanogenesis, thus affecting mammals' coat color variation. We used a range of genome-wide approach to identify the genetic basis of coat color variation in Dezhou donkeys. The results provide a supplement to the color variation study in Chinese donkeys at the genome-wide level, and preliminarily verified the reliability of the Molbreeding Donkey No. 1 40K liquid chip.

Development and mouse model evaluation of a new phage cocktail intended as an alternative to antibiotics for treatment of Staphylococcus aureus-induced bovine mastitis.

Bovine mastitis is a prevalent infectious disease in dairy herds worldwide, resulting in substantial economic losses. Staphylococcus aureus is a major cause of mastitis in animals, and its antibiotic resistance poses challenges for treatment. Recently, renewed interest has focused on the development of alternative methods to antibiotic therapy, including bacteriophages (phages), for controlling bacterial infections. In this study, 2 lytic phages, vB_SauM_JDYN (JDYN) and vB_SauM_JDF86 (JDF86), were isolated from the cattle sewage effluent samples collected from dairy farms in Shanghai. The 2 phages have a broad bactericidal spectrum against Staphylococcus of various origins. Genomic and morphological analyses revealed that the 2 phages belonged to the Myoviridae family. Moreover, JDYN and JDF86 remained stable under a wide temperature and pH range and were almost unaffected in chloroform. In this study, we prepared a phage cocktail (PHC-1) which consisted of a 1:1:1 ratio of JDYN, JDF86, and SLPW (a previously characterized phage). We found that PHC-1 showed the strongest bacteriolytic effect and the lowest frequency of emergence of bacteriophage insensitive mutants compared with monophages. Bovine mammary epithelial cells and lactating mice mastitis models were used to evaluate the effectiveness of PHC-1 in vitro and in vivo, respectively. The results demonstrated that PHC-1 treatment significantly reduced bacterial load, alleviated inflammatory response, and improved mastitis pathology. Altogether, these results suggest that PHC-1 has the potential to treat S. aureus-induced bovine mastitis and that phage cocktails can combat antibiotic-resistant S. aureus infections.

A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.

Analysis of lncRNA and mRNA expression profiling in immature and mature DeZhou donkey (equine Taurus) testes.

Testicular development and spermatogenesis are tightly regulated by the number of genes and noncoding genes, and mRNAs and lncRNAs play vital roles in regulating posttranscriptional gene expression. However, mRNAs and lncRNAs have not been systematically identified in the testes of donkeys. In this study, mRNA and lncRNA expression profiles in the testes of DeZhou donkeys between 2 months and 2 years of age were comprehensively analysed by RNA sequencing. We identified 56,605 lncRNAs and 61,857 mRNAs by gene expression analysis, and 21,845 lncRNAs (p < .05) and 14,109 mRNAs (p < .05) were differentially expressed in the immature (2-month-old, n = 3, noADGW) and mature (2-year-old, n = 3, ADGW) stages. In addition, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that the predicted target genes were enriched in the adherens junction, cell cycle, propanoate metabolism and cell adhesion molecule pathways. This study identified and analysed a comprehensive catalogue of lncRNAs and mRNAs in donkey testes, which provides a useful resource for further investigation of biological function in donkey lncRNAs.

mRNA sequencing provides new insights into the pathogenesis of Hirschsprung's disease in mice.

PURPOSE: The aim of this study is to use RNA sequencing and RT-qPCR to identify the main susceptibility genes linked to the occurrence and development of Hirschsprung disease in the colonic tissues of EDNRBm1yzcm and wild mice. METHODS: RNA was extracted from colon tissues of 3 mutant homozygous mice and 3 wild mice. RNA degradation, contamination concentration, and integrity were then measured. The extracted RNA was then sequenced using the Illumina platform. The obtained sequence data are filtered to ensure data quality and compared to the reference genome for further analysis. DESeq2 was used for gene expression analysis of the raw data. In addition, graphene oxide enrichment analysis and RT-qPCR validation were also performed. RESULTS: This study identified 8354 differentially expressed genes in EDNRBm1yzcm and wild mouse colon tissues by RNA sequencing, including 4346 upregulated genes and 4005 downregulated genes. Correspondingly, the results of RT-qPCR analysis showed good correlation with the transcriptome data. In addition, GO and KEGG enrichment results suggested that there were 8103 terms and 320 pathways in all DEGs. When P < 0.05, 1081 GO terms and 320 KEGG pathways reached a significant level. Finally, through the existing studies and the enrichment results of differentially expressed genes, it was determined that axon guidance and the focal adhesion pathway may be closely related to the occurrence of HSCR. CONCLUSIONS: This study analyzed and identified the differential genes in colonic tissues between EDNRBm1yzcm mice and wild mice, which provided new insight for further mining the potential pathogenic genes of Hirschsprung's disease.

Comparative Genomics Identifies the Evolutionarily Conserved Gene TPM3 as a Target of eca-miR-1 Involved in the Skeletal Muscle Development of Donkeys.

Species within the genus Equus are valued for their draft ability. Skeletal muscle forms the foundation of the draft ability of Equus species; however, skeletal muscle development-related conserved genes and their target miRNAs are rarely reported for Equus. In this study, a comparative genomics analysis was performed among five species (horse, donkey, zebra, cattle, and goat), and the results showed that a total of 15,262 (47.43%) genes formed the core gene set of the five species. Only nine chromosomes (Chr01, Chr02, Chr03, Chr06, Chr10, Chr18, Chr22, Chr27, Chr29, and Chr30) exhibited a good collinearity relationship among Equus species. The micro-synteny analysis results showed that TPM3 was evolutionarily conserved in chromosome 1 in Equus. Furthermore, donkeys were used as the model species for Equus to investigate the genetic role of TPM3 in muscle development. Interestingly, the results of comparative transcriptomics showed that the TPM3 gene was differentially expressed in donkey skeletal muscle S1 (2 months old) and S2 (24 months old), as verified via RT-PCR. Dual-luciferase test analysis showed that the TPM3 gene was targeted by differentially expressed miRNA (eca-miR-1). Furthermore, a total of 17 TPM3 gene family members were identified in the whole genome of donkey, and a heatmap analysis showed that EaTPM3-5 was a key member of the TPM3 gene family, which is involved in skeletal muscle development. In conclusion, the TPM3 gene was conserved in Equus, and EaTPM3-5 was targeted by eca-miR-1, which is involved in skeletal muscle development in donkeys.

Overview-gold nanoparticles-based sensitive nanosensors in mycotoxins detection.

Food-borne mycotoxins is one of the food safety concerns in the world. At present, nanosensors are widely used in the detection and analysis of mycotoxins due to their high specificity and sensitivity. In nanosensor-based mycotoxindetections, the sensitivity is mainly improved from two aspects. On the one hand, based on the principle of immune response, antigens and antibodies can be modified and developed. Such as single-domain heavy chain antibodies, aptamers, peptides, and antigen mimotopes. On the other hand, improvements and innovations have been made on signal amplification materials, including gold nanoparticles (AuNPs), quantum dots, and graphene, etc. Among them, gold nanoparticles can not only be used as a signal amplification material, but also can be used as carriers for identification elements, which can be used for signal amplification in detection. In this article, we systematically summarized the emerging strategies for enhancing the detection sensitivity of traditional gold nanoparticles-based nanosensors, in terms of recognition elements and signal amplification. Representative examples were selected to illustrate the potential mechanism of each strategy in enhancing the colorimetric signal intensity of AuNP and its potential application in biosensing. Finally, our review suggested the challenges and future prospects of gold particles in detection of mycotoxins.

Knockdown of lncRNA H19 alleviates ox-LDL-induced HCAECs inflammation and injury by mediating miR-20a-5p/HDAC4 axis.

BACKGROUND: Coronary artery disease (CAD) seriously disturbs the life of people. LncRNA H19 is reported to promote the progression of CAD; Nevertheless, the detailed mechanism by which H19 modulates CAD development is unclear. METHODS: Clinical samples of CAD patients were collected, meanwhile we established in vitro and in vivo models of CAD by treating HCAECs with ox-LDL and feeding ApoE-/- mice with high fat diets (HFD). MTT assay was adopted to assess the cell viability. Transwell detection was applied to test the migration, and apoptosis was tested by flow cytometry. The levels of inflammatory cytokines were examined by ELISA. The relation among H19, miR-20a-5p and HDAC4 was explored by dual luciferase reporter and RIP assay. RESULTS: H19 and HDAC4 levels were elevated, while miR-20a-5p was reduced in plasma of CAD patients and ox-LDL-treated HCAECs. ox-LDL increased H19 level and induced apoptosis and inflammation in HCAECs, while silencing of H19 rescued this phenomenon. In addition, the level of H19 was negatively correlated with miR-20a-5p, and miR-20a-5p inhibitor restored the effect of H19 silencing on HCAECs function. HDAC4 was the downstream mRNA of miR-20a-5p, and miR-20a-5p upregulation reversed ox-LDL-induced HCAECs injury through targeting HDAC4. Furthermore, H19 silencing significantly alleviated the coronary atherosclerotic plaques and inhibited the inflammatory responses in vivo. CONCLUSIONS: We proved that knockdown of H19 alleviated ox-LDL-induced HCAECs injury via miR-20a-5p/HDAC4 axis, which might provide a new tactics against CAD.

Chicken miR-126-5p negatively regulates antiviral innate immunity by targeting TRAF3.

Innate immunity plays an essential role in preventing the invasion of pathogenic microorganisms. However, innate immunity is a double-edged sword, whose excessive activation is detrimental to immune homeostasis and even leads to a "cytokine storm" of the infected host. The host develops a series of negative regulatory mechanisms to balance the immune response. Here, we report a negative regulatory mechanism of chicken innate immunity mediated by miRNA. In the GEO database, we found that miR-126-5p was markedly up-regulated in chickens infected by RNA viruses. Upregulation of miR-126-5p by RNA virus was then further shown via both a cell model and in vivo tests. Overexpression of miR-126-5p significantly inhibited the expression of interferon and inflammatory cytokine-related genes induced by RNA viruses. The opposite result was achieved after the knockdown of miR-126-5p expression. Bioinformatics analysis identified TRAF3 as candidate target gene of miR-126-5p. Experimentally, miR-126-5p can target TRAF3, as shown by the effects of miR-126-5p on the endogenous expression of TRAF3, and by the TRAF3 3'UTR driven luciferase reporter assay. Furthermore, we demonstrated that miR-126-5p negatively regulated innate immunity by blocking the MAVS-TRAF3-TBK1 axis, with a co-expression assay. Overall, our results suggest that miR-126-5p is involved in the negative regulation of chicken innate immunity, which might contribute to maintaining immune balance.

Functional characterization of goose IRF1 in IFN induction and anti-NDV infection.

Interferon regulatory factors (IRFs) play a key role in many aspects of immune response, and IRF1, IRF3, and IRF7 are positive regulators of IFN induction in mammals. However, IRF3, as the most critical regulatory factor in mammals, is naturally absent in birds, which attracts us to study the functions of other members of the avian IRF family. In the present study, we cloned goose IRF1 (GoIRF1) and conducted a series of bioinformatics analyses to compare the protein homology of GoIRF1 with that of IRF1 in other species. The overexpression of GoIRF1 in DF-1 cells induced the activation of IFN-ß, and this activation is independent of the dosage of the transfected GoIRF1 plasmids. The overexpression of GoIRF1 in goose embryonic fibroblasts (GEFs) induced the expression of IFNs, proinflammatory cytokines, and IFN-stimulated genes (ISGs); it also inhibited the replication of green fluorescent protein (GFP)-tagged Newcastle disease virus (NDV) (NDV-GFP) and GFP-tagged vesicular stomatitis virus (VSV) (VSV-GFP). Our results suggest that GoIRF1 is an important regulator of IFNs, proinflammatory cytokines, and ISGs and plays a role in antiviral innate immunity in geese.

Changes in sperm metabolites of Dezhou donkey after cryopreservation.

Sperm cryopreservation technology has laid the foundation for promoting the popularity of artificial insemination in donkey reproduction, but the freeze-thaw process can cause sperm damage, and the viability of frozen sperm is greatly reduced, resulting in low insemination ability. Sperm metabolites play an important role in the freezing process of spermatozoa and have a major influence on the freezability of spermatozoa. The aim of this study was to explore the differential metabolites in donkey spermatozoa before and after cryopreservation by liquid chromatography-tandem mass spectrometry (LC-MS/MS). We analysed ejaculate samples from male donkeys obtained before and after freezing and identified 1323 metabolites. Compared with fresh sperm (F), the metabolites of cryopreserved sperm (CRY) were significantly changed, and 570 metabolites were significantly different between the two groups (p < .05). Among them, 277 metabolites were higher in frozen sperm, while the opposite was true for 293 metabolites. These metabolites mainly include phospholipids, lysophospholipids and amino acids., most of which are associated with oxidative stress and sperm capacitation. We describe significantly different metabolites before and after freezing that are significantly associated with decreased sperm motility post-freezing and can be used as biomarkers of decreased sperm motility post-freezing.

Metabolomic profiling of Dezhou donkey seminal plasma related to freezability.

Donkeys are indispensable livestock in China because they have transport function and medicinal value. With the popularization of artificial insemination on donkeys, semen cryopreservation technology has gradually become a research hotspot. Seminal plasma is a necessary medium for transporting sperm and provides energy and nutrition for sperm. Seminal plasma metabolites play an important role in the process of sperm freezing, and also have an important impact on sperm motility and fertilization rate after freezing and thawing. In this study, liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was used to compare the metabolic characteristics of seminal plasma of high freezability (HF) and low freezability (LF) male donkeys. We identified 672 metabolites from donkey seminal plasma, of which 33 metabolites were significantly different between the two groups. Metabolites were identified and categorized according to their major chemical classes, including homogeneous non-metal compounds, nucleosides, nucleotides, and analogues, organosulphur compounds, phenylpropanoids and polyketide, organoheterocyclic compounds, organic oxygen compounds, benzenoids, organic acids and derivatives, lipids and lipid-like molecules, organooxygen compounds, alkaloids and derivatives, organic nitrogen compounds. The results showed that the contents of phosphatidylcholine, piceatannol and enkephalin in donkey semen of HF group were significantly higher than those of LF group (p < .05), while the contents of taurocholic and lysophosphatidic acid were significantly lower than those of LF group (p < .05). The different metabolites were mainly related to sperm biological pathway response and oxidative stress. These metabolites may be considered as candidate biomarkers for different fertility in jacks.

A Preliminary Study of Antibiotic Resistance Genes in Domestic Honey Produced in China.

Antibiotic resistance genes (ARGs) are emerging contaminants that pose a health risk to humans worldwide. Little information on ARGs in bee honey is available. This study profiles ARGs in bee honey samples produced in China, the biggest producer in the world. Of 317 known ARGs encoding resistance to 8 classes of antibiotics, 212 were found in collected honey samples by a real-time quantitative polymerase chain reaction approach. Occurrence frequencies of genes providing resistance to FCA (fluoroquinolone, quinolone, florfenicol, chloramphenicol, and amphenicol) and aminoglycosides were 21.0% and 18.5%, respectively. Frequencies of genes encoding efflux pumps were 42.5% and those of destructase genes 36.6%, indicating that these two mechanisms were predominant for resistance. Nine plasmid-mediated quinolone resistance genes were detected. Of the nine transposase genes known to be involved in antibiotic resistance, eight were found in the samples examined, with tnpA-4, tnpA-5, and tnpA-6 being more abundant. The abundance of the transposase genes was associated with genes conferring resistance to tetracyclines (r = 0.648, p < 0.01), macrolide-lincosamide-streptogramin B (r = 0.642, p < 0.01), FCA (r = 0.517, p < 0.01), and aminoglycosides (r = 0.401, 0.01 < p < 0.05). This is the first study on the abundance and diversity of ARGs in Chinese bee honey products. These findings suggest that bee honey may be a significant source of ARGs that might pose threat to public health. Further research is required to collect more samples in diverse geographic regions in China to make a more comprehensive judgment of ARG in bee honey.

Acetylation at K108 of the NS1 protein is important for the replication and virulence of influenza virus.

Non-structural protein 1 (NS1) of influenza virus is a multifunctional protein that plays an important role in virus replication and virulence. In this study, an acetylation modification was identified at the K108 residue of the NS1 protein of H1N1 influenza virus. To further explore the function of the K108 acetylation modification of the NS1 protein, a deacetylation-mimic mutation (K108R) and a constant acetylation-mimic mutation (K108Q) were introduced into the NS1 protein in the background of A/WSN/1933 H1N1 (WSN), resulting in two mutant viruses (WSN-NS1-108R and WSN-NS1-108Q). In vitro and mouse studies showed that the deacetylation-mimic mutation K108R in the NS1 protein attenuated the replication and virulence of WSN-NS1-108R, while the constant acetylation-mimic mutant virus WSN-NS1-108Q showed similar replication and pathogenicity as the wild-type WSN virus (WSN-wt). The results indicated that acetylation at K108 of the NS1 protein has an important role in the replication and virulence of influenza virus. To further explore the potential mechanism, the type I interferon (IFN-I) antagonistic activity of the three NS1 proteins (NS1-108Q, NS1-108R, and NS1-wt) was compared in cells, which showed that the K108R mutation significantly attenuated the IFN-ß antagonistic activity of the NS1 protein compared with NS1-wt and NS1-108Q. Both NS1-wt and NS1-108Q inhibited the IFN-ß response activated by RIG-I CARD domain, MAVS, TBK1, and IRF3 more efficiently than the NS1-108R protein in cells. Taken together, the results indicated that acetylation at NS1 K108 is important for the IFN antagonistic activity of the NS1 protein and virulence of the influenza virus.

Alterations in the Iron Homeostasis Network of Hepatocytes Caused by Hepatitis B Virus.

BACKGROUND: It is unclear whether hepatitis B virus (HBV) itself causes iron metabolism disorder in patients with chronic hepatitis B (CHB). In this study, we investigated the effect of HBV on iron metabolism at the clinical and cellular levels to determine the pathogenesis of CHB. MATERIALS: We enrolled 41 CHB patients and 20 healthy controls (HCs) in a retrospective study. Parameters of iron status included serum iron (SI), ferritin (SF), transferrin (TRF), soluble transferrin receptor (sTfR), transferrin saturation (TS), total iron-binding capacity (TIBC), unsaturated iron-binding capacity (UIBC), and hepcidin. Liver function indicators included serum alanine transaminase (ALT) and albumin. Furthermore, we investigated the correlations between iron markers and liver function indicators. Finally, the alterations in SF, TRF, transferrin receptor (TfR), and hepcidin expression were detected by RT-PCR, western blot, and cell immunofluorescence after HepG2 cells and Huh7 cells were transfected with the pSM2-HBV plasmid. We also measured these alterations between HepG2 cells and HepG2.215 cells. The significance of differences was analyzed by SPSS version 17.0. RESULTS: Compared with healthy controls, the CHB patients were more likely to have lower levels of serum hepcidin, TRF, sTfR, TIBC, and UIBC and higher levels of SI, SF, and TS (p < 0.05, all). In CHB patients, the levels of SI and SF correlated positively with ALT concentrations, and the serum hepcidin concentrations correlated positively with albumin concentrations (p < 0.05, all). The expression levels of ferritin, transferrin, and hepcidin mRNA and protein were significantly higher in HepG2.215 cells than in HepG2 cells, while expression levels of TfR were lower. The alterations in these iron markers in HepG2 and Huh7 cells that were transfected with pSM2-HBV plasmid were consistent with those in HepG2.215 cells. CONCLUSIONS: Serum iron markers tended to be abnormal in CHB patients. In hepatocytes, HBV promoted the expression of ferritin, transferrin, and hepcidin, while it inhibited the expression of TfR.

cas9 Enhances Bacterial Virulence by Repressing the regR Transcriptional Regulator in Streptococcus agalactiae.

Clustered regularly interspaced palindromic repeats (CRISPR) and their associated cas genes have been demonstrated to regulate self-genes and virulence in many pathogens. In this study, we found that inactivation of cas9 caused reduced adhesion and intracellular survival of the piscine Streptococcus agalactiae strain GD201008-001 and significantly decreased the virulence of this strain in zebrafish and mice. Further investigation indicated that the regR transcriptional regulator was upregulated in the Δcas9 mutant. As regR mediates the repression of hyaluronidase, a critical factor involved in opening the blood-brain barrier (BBB) in mice, cas9-mediated repression of regR transcription is important for S. agalactiae to open the BBB and thereby cause meningitis in animals. This study expands our understanding of endogenous gene regulation mediated by CRISPR-Cas systems in bacteria.