Synthesis and antitubercular activity of novel 4-arylalkyl substituted thio-, oxy- and sulfoxy-quinoline analogues targeting the cytochrome bc1 complex.

A library of 4-substituted quinolines was synthesised based on the structural features of the privileged 4-(benzylthio)-6-methoxy-2-methylquinoline scaffold. Quinoline-based chemical probes have proven to be effective anti-tuberculosis agents with the ability of inhibiting components of Mycobacterium tuberculosis (MTB) respiratory chain including the b subunit of the cytochrome bc1 complex. Novel 4-(arylalkyl)-thio, -oxy and sulfoxy-quinoline analogues were tested for their ability to inhibit the growth of MTB H37Rv and QcrB mutant strains, and the compounds mode of action was investigated. Members of the 4-subtituted thio- and sulfoxyquinoline series exhibited significant growth inhibitory activity in the high nanomolar range against wild-type MTB and induced depletion of intracellular ATP. These probes also showed reduced potency in the QcrB T313I mutant strain, thus indicating the cytochrome bc1 oxidase complex as the molecular target. Interestingly, new 4-(quinolin-2-yl)oxy-quinoline 4i was more selective for the QcrB T313I strain compared to the wild-type strain.

Evaluation of Encapsulation Potential of Selected Star-Hyperbranched Polyglycidol Architectures: Predictive Molecular Dynamics Simulations and Experimental Validation.

Polymers, including non-linear copolymers, have great potential in the development of drug delivery systems with many advantages, but the design requires optimizing polymer-drug interactions. Molecular dynamics (MD) simulations can provide insights into polymer-drug interactions for designing delivery systems, but mimicking formulation processes such as drying is often not included in in silico studies. This study demonstrates an MD approach to model drying of systems comprising either hydrophilic tinidazole or hydrophobic clotrimazole drugs with amphiphilic hyperbranched copolyethers. The simulated drying protocol was critical for elucidating drug encapsulation and binding mechanisms. Experimentally, two polymers were synthesized and shown to encapsulate clotrimazole with up to 83% efficiency, guided by interactions with the hydrophobic core observed in simulations. In contrast, tinidazole is associated with surface regions, indicating capacity differences between drug types. Overall, this work highlights MD simulation of the drying process as an important tool for predicting drug-polymer complex behaviour. The modelled formulation protocol enabled high encapsulation efficiency and opened possibilities for the design of delivery systems based on computationally derived binding mechanisms. This demonstrates a computational-experimental approach where simulated drying was integral to elucidating interactions and developing optimized complexes, emphasizing the value of molecular modelling for the development of drug delivery formulations.

Elucidation of critical pH-dependent structural changes in Botulinum Neurotoxin E.

Botulinum Neurotoxins (BoNT) are the most potent toxins currently known. However, they also have therapeutic applications for an increasing number of motor related conditions due to their specificity, and low diffusion into the system. Although the start- and end- points for the BoNT mechanism of action are well-studied, a critical step remains poorly understood. It is theorised that BoNTs undergo a pH-triggered conformational shift, activating the neurotoxin by priming it to form a transmembrane (TM) channel. To test this hypothesis, we combined molecular dynamics (MD) simulations and small-angle x-ray scattering (SAXS), revealing a new conformation of serotype E (BoNT/E). This conformation was exclusively observed in simulations below pH 5.5, as determined by principal component analysis (PCA), and its theoretical SAXS profile matched an experimental SAXS profile obtained at pH 4. Additionally, a localised secondary structural change was observed in MD simulations below pH 5.5, in a region previously identified as instrumental for membrane insertion for serotype A (BoNT/A). These changes were found at a critical pH value for BoNTs in vivo, and may be relevant for their therapeutic use.

Synthesis and in Silico Modelling of the Potential Dual Mechanistic Activity of Small Cationic Peptides Potentiating the Antibiotic Novobiocin against Susceptible and Multi-Drug Resistant Escherichia coli.

Cationic antimicrobial peptides have attracted interest, both as antimicrobial agents and for their ability to increase cell permeability to potentiate other antibiotics. However, toxicity to mammalian cells and complexity have hindered development for clinical use. We present the design and synthesis of very short cationic peptides (3-9 residues) with potential dual bacterial membrane permeation and efflux pump inhibition functionality. Peptides were designed based upon in silico similarity to known active peptides and efflux pump inhibitors. A number of these peptides potentiate the activity of the antibiotic novobiocin against susceptible Escherichia coli and restore antibiotic activity against a multi-drug resistant E. coli strain, despite having minimal or no intrinsic antimicrobial activity. Molecular modelling studies, via docking studies and short molecular dynamics simulations, indicate two potential mechanisms of potentiating activity; increasing antibiotic cell permeation via complexation with novobiocin to enable self-promoted uptake, and binding the E. coli RND efflux pump. These peptides demonstrate potential for restoring the activity of hydrophobic drugs.

Inhibitory Effect of Berberine on Broiler P-glycoprotein Expression and Function: In Situ and In Vitro Studies.

Overcoming P-glycoprotein (P-gp) efflux is a strategy to improve the absorption and pharmacokinetics of its substrate drugs. Berberine inhibits P-gp and thereby increases the bioavailability of the P-gp substrate digoxin in rodents. However, the effects of berberine on P-gp in chickens are still unclear. Here, we studied the role of berberine in modulating broilers P-gp expression and function through both in situ and in vitro models. In addition, molecular docking was applied to analyze the interactions of berberine with P-gp as well as with chicken xenobiotic receptor (CXR). The results showed that the mRNA expression levels of chicken P-gp and CXR decreased in the ileum following exposure to berberine. The absorption rate constant of rhodamine 123 increased after berberine treatment, as detected using an in situ single-pass intestinal perfusion model. Efflux ratios of P-gp substrates (tilmicosin, ciprofloxacin, clindamycin, ampicillin, and enrofloxacin) decreased and the apparent permeability coefficients increased after co-incubation with berberine in MDCK-chAbcb1 cell models. Bidirectional assay results showed that berberine could be transported by chicken P-gp with a transport ratio of 4.20, and this was attenuated by verapamil (an inhibitor of P-gp), which resulted in a ratio of 1.13. Molecular docking revealed that berberine could form favorable interactions with the binding pockets of both CXR and P-gp, with docking scores of -7.8 and -9.5 kcal/mol, respectively. These results indicate that berberine is a substrate of chicken P-gp and down-regulates P-gp expression in chicken tissues, thereby increasing the absorption of P-gp substrates. Our findings suggest that berberine increases the bioavailability of other drugs and that drug-drug interactions should be considered when it is co-administered with other P-gp substrates with narrow therapeutic windows.

Relevance of Breast Cancer Resistance Protein to Pharmacokinetics of Florfenicol in Chickens: A Perspective from In Vivo and In Vitro Studies.

Florfenicol (FFC) is a valuable synthetic fluorinated derivative of thiamphenicol widely used to treat infectious diseases in food animals. The aims of the study were to investigate whether FFC is a substrate for the breast cancer resistance protein (BCRP) and whether the transporter influences oral availability of FFC. In vitro transport assays using MDCK-chAbcg2 cells were conducted to assess chicken BCRP-mediated transport of FFC, while in vivo pharmacokinetic experiments with single or combined BCRP inhibitor gefitinib were employed to study the role of BCRP in oral FFC disposition. According to U.S. Food and Drug Administration (FDA) criteria, FFC was found to be a potential BCRP substrate due to the net efflux ratio being over 2.0 (2.37) in MDCK cells stably transfected with chicken BCRP and the efflux completely reversed by a BCRP inhibitor (Gefitinib). The molecular docking results indicated that florfenicol can form favorable interactions with the binding pocket of homology modeled chicken BCRP. Pharmacokinetic studies of FFC in different aged broilers with different expression levels of BCRP showed that higher BCRP expression would cause a lower Area Under Curve (AUC) and a higher clearance of FFC. In addition, more extensive absorption of florfenicol after the co-administration with gefitinib (a BCRP inhibitor) was observed. The overall results demonstrated that florfenicol is a substrate of the chicken breast cancer resistant protein which in turn affects its pharmacokinetic behavior.

Practical computational toolkits for dendrimers and dendrons structure design.

Dendrimers and dendrons offer an excellent platform for developing novel drug delivery systems and medicines. The rational design and further development of these repetitively branched systems are restricted by difficulties in scalable synthesis and structural determination, which can be overcome by judicious use of molecular modelling and molecular simulations. A major difficulty to utilise in silico studies to design dendrimers lies in the laborious generation of their structures. Current modelling tools utilise automated assembly of simpler dendrimers or the inefficient manual assembly of monomer precursors to generate more complicated dendrimer structures. Herein we describe two novel graphical user interface toolkits written in Python that provide an improved degree of automation for rapid assembly of dendrimers and generation of their 2D and 3D structures. Our first toolkit uses the RDkit library, SMILES nomenclature of monomers and SMARTS reaction nomenclature to generate SMILES and mol files of dendrimers without 3D coordinates. These files are used for simple graphical representations and storing their structures in databases. The second toolkit assembles complex topology dendrimers from monomers to construct 3D dendrimer structures to be used as starting points for simulation using existing and widely available software and force fields. Both tools were validated for ease-of-use to prototype dendrimer structure and the second toolkit was especially relevant for dendrimers of high complexity and size.

4,4'-Dimethylaminorex ("4,4'-DMAR"; "Serotoni") misuse: A Web-based study.

BACKGROUND: 4,4'-DMAR (4,4'-dimethylaminorex; "Serotoni") is a potent stimulant drug that has recently been associated with a number of fatalities in Europe. Over the last few years, online communities have emerged as important resources for disseminating levels of technical knowledge on novel psychoactive substances. OBJECTIVE: Analysing the information provided by the fora communities on 4,4'-DMAR use, additionally critical reviewing the available evidence-based literature on this topic. METHODS: Different website drug fora were identified. A critical review of the existing evidence-based literature was undertaken. Individuation and analysis of qualitative data from the identified website fora were performed. RESULTS: The combined search results identified six website fora from which a range of qualitative data on recurring themes was collected. These themes included routes of administration and doses; desired effects; adverse effects; comparison with other drugs; association with other drugs; medications self-administered to reverse 4,4'-DMAR action; overall impression; and provision of harm-reduction advice. CONCLUSIONS: Although being characterized by a number of methodological limitations, the social networks' Web monitoring approach (netnography) may be helpful to better understand some of the clinical and psychopharmacological issues pertaining to a range of novel psychoactive substances, including 4,4'-DMAR, for which only extremely little, if any, scientific knowledge is available.

Intended and unintended use of cathinone mixtures.

INTRODUCTION: Cathinones are one of the most popular categories of new psychoactive substances (NPS) consumed. Cathinones have different pharmacological activities and receptor selectivity for monoamine transporters based on their chemical structures. They are incorporated into NPS mixtures and used with other NPS or 'traditional' drugs. Cathinone use represents significant health risks to individuals and is a public health burden. METHODS: Evidence of poly-NPS use with cathinones, seizure information, and literature analyses results on NPS mixtures was systematically gathered from online database sources, including Google Scholar, Scopus, Bluelight, and Drugs-Forum. RESULTS AND DISCUSSION: Results highlight the prevalence of NPS with low purity, incorporation of cathinones into NPS mixtures since 2008, and multiple members of the cathinone family being present in individual UK-seized samples. Cathinones were identified as adulterants in NPS marketed as being pure NPS, drugs of abuse, branded products, herbal blends, and products labelled "not for human consumption." Toxicity resulting from cathinone mixtures is unpredictable because key attributes remain largely unknown. Symptoms of intoxication include neuro-psychological, psychiatric, and metabolic symptoms. Proposed treatment includes holistic approaches involving psychosocial, psychiatric and pharmacological interventions. CONCLUSION: Raising awareness of NPS, education, and training of health care professionals are paramount in reducing harms related to cathinone use.

In silico modelling of prostacyclin and other lipid mediators to nuclear receptors reveal novel thyroid hormone receptor antagonist properties.

Prostacyclin (PGI2) is a key mediator involved in cardiovascular homeostasis, acting predominantly on two receptor types; cell surface IP receptor and cytosolic peroxisome proliferator activated receptor (PPAR) ß/δ. Having a very short half-life, direct methods to determine its long term effects on cells is difficult, and little is known of its interactions with nuclear receptors. Here we used computational chemistry methods to investigate the potential for PGI2, beraprost (IP receptor agonist), and GW0742 (PPARß/δ agonist), to bind to nuclear receptors, confirmed with pharmacological methods. In silico screening predicted that PGI2, beraprost, and GW0742 have the potential to bind to different nuclear receptors, in particular thyroid hormone ß receptor (TRß) and thyroid hormone α receptor (TRα). Docking analysis predicts a binding profile to residues thought to have allosteric control on the TR ligand binding site. Luciferase reporter assays confirmed that beraprost and GW0742 display TRß and TRα antagonistic properties; beraprost IC50 6.3 × 10(-5)mol/L and GW0742 IC50 4.9 × 10(-6) mol/L. Changes to triiodothyronine (T3) induced vasodilation of rat mesenteric arteries measured on the wire myograph were measured in the presence of the TR antagonist MLS000389544 (10(-5) mol/L), beraprost (10(-5) mol/L) and GW0742 (10(-5) mol/L); all significantly inhibited T3 induced vasodilation compared to controls. We have shown that both beraprost and GW0742 exhibit TRß and TRα antagonist behaviour, and suggests that PGI2 has the ability to affect the long term function of cells through binding to and inactivating thyroid hormone receptors.

Application of diffusion-edited and solvent suppression ¹H-NMR to the direct analysis of markers in valerian-hop liquid herbal products.

INTRODUCTION: The rising trend to consume herbal products for the treatment and/or prevention of minor ailments together with their chemical and pharmacological complexity means there is an urgent need to develop new approaches to their quality and stability. OBJECTIVES: This work looks at the application of one-dimensional diffusion-edited (1)H-NMR spectroscopy (1D DOSY) and (1)H-NMR with suppression of the ethanol and water signals to the characterisation of quality and stability markers in multi-component herbal medicines/food supplements. MATERIAL AND METHODS: The experiments were performed with commercial tinctures of Valeriana officinalis L. (valerian), expired and non-expired, as well as its combination with Hummulus lupulus L. (hops), which is one of the most popular blends of relaxant herbs. These techniques did not require purification or evaporation of components for the qualitative analysis of the mixture, but only the addition of D2 O and TSP. RESULTS: The best diagnostic signals were found at δ 7 ppm (H-11, valerenic acid), δ 4.2 ppm (H-1, hydroxyvalerenic acid) and δ 1.5-1.8 ppm (methyl groups in prenylated moieties, α-acids/prenylated flavones). CONCLUSION: This work concludes on the potential value of 1D DOSY (1)H-NMR to provide additional assurance of quality in complex natural mixtures.

Identification of Protein-Excipient Interaction Hotspots Using Computational Approaches.

Protein formulation development relies on the selection of excipients that inhibit protein-protein interactions preventing aggregation. Empirical strategies involve screening many excipient and buffer combinations using force degradation studies. Such methods do not readily provide information on intermolecular interactions responsible for the protective effects of excipients. This study describes a molecular docking approach to screen and rank interactions allowing for the identification of protein-excipient hotspots to aid in the selection of excipients to be experimentally screened. Previously published work with Drosophila Su(dx) was used to develop and validate the computational methodology, which was then used to determine the formulation hotspots for Fab A33. Commonly used excipients were examined and compared to the regions in Fab A33 prone to protein-protein interactions that could lead to aggregation. This approach could provide information on a molecular level about the protective interactions of excipients in protein formulations to aid the more rational development of future formulations.

Production of water-soluble few-layer graphene mesosheets by dry milling with hydrophobic drug.

A novel, fast, and easy mechano-chemistry-based (dry milling) method has been developed to exfoliate graphene with hydrophobic drugs generating few-layer graphene mesosheets (< 10 nm in thickness and ∼1 µm in width). The electronic properties of the graphitic structure were partially preserved after the milling treatment compared with graphene oxide prepared by Hummers' method. Several characterization techniques such as thermogravimetric analysis, Raman spectroscopy, atomic force microscopy, electron microscopy, and molecular dynamics simulation were used to characterize this material. The drug-exfoliated mesosheets were pharmacologically inactive, offering a new approach for making water-soluble few-layer graphene mesosheets upon dry milling with hydrophobic drugs, mainly used as exfoliating agents.

Structural insights into binding of small molecule inhibitors to Enhancer of Zeste Homolog 2.

Enhancer of Zeste Homolog 2 (EZH2) is a SET domain protein lysine methyltransferase (PKMT) which has recently emerged as a chemically tractable and therapeutically promising epigenetic target, evidenced by the discovery and characterization of potent and highly selective EZH2 inhibitors. However, no experimental structures of the inhibitors co-crystallized to EZH2 have been resolved, and the structural basis for their activity and selectivity remains unknown. Considering the need to minimize cross-reactivity between prospective PKMT inhibitors, much can be learned from understanding the molecular basis for selective inhibition of EZH2. Thus, to elucidate the binding of small-molecule inhibitors to EZH2, we have developed a model of its fully-formed cofactor binding site and used it to carry out molecular dynamics simulations of protein-ligand complexes, followed by molecular mechanics/generalized born surface area calculations. The obtained results are in good agreement with biochemical inhibition data and reflect the structure-activity relationships of known ligands. Our findings suggest that the variable and flexible post-SET domain plays an important role in inhibitor binding, allowing possibly distinct binding modes of inhibitors with only small variations in their structure. Insights from this study present a good basis for design of novel and optimization of existing compounds targeting the cofactor binding site of EZH2.

Molecular Modeling to Study Dendrimers for Biomedical Applications.

Molecular modeling techniques provide a powerful tool to study the properties of molecules and their interactions at the molecular level. The use of computational techniques to predict interaction patterns and molecular properties can inform the design of drug delivery systems and therapeutic agents. Dendrimers are hyperbranched macromolecular structures that comprise repetitive building blocks and have defined architecture and functionality. Their unique structural features can be exploited to design novel carriers for both therapeutic and diagnostic agents. Many studies have been performed to iteratively optimise the properties of dendrimers in solution as well as their interaction with drugs, nucleic acids, proteins and lipid membranes. Key features including dendrimer size and surface have been revealed that can be modified to increase their performance as drug carriers. Computational studies have supported experimental work by providing valuable insights about dendrimer structure and possible molecular interactions at the molecular level. The progress in computational simulation techniques and models provides a basis to improve our ability to better predict and understand the biological activities and interactions of dendrimers. This review will focus on the use of molecular modeling tools for the study and design of dendrimers, with particular emphasis on the efforts that have been made to improve the efficacy of this class of molecules in biomedical applications.

Crystal structure of a promoter sequence in the B-raf gene reveals an intertwined dimer quadruplex.

The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.

Investigation of the protein alkylation sites of the STAT3:STAT3 inhibitor Stattic by mass spectrometry.

STAT3 (Signal Transducer and Activator of Transcription factor 3) is constitutively active in a wide range of human tumours. Stattic is one of the first non-peptidic small molecules reported to inhibit formation of the STAT3:STAT3 protein dimer complex. A mass spectrometry method has been developed to investigate the binding of Stattic to the un-phosphorylated STAT3ßtc (U-STAT3) protein. Alkylation of four cysteine residues has been observed with possible reaction at a fifth which could account for the mechanism of action.

Molecular dynamic simulations of ocular tablet dissolution.

Small tablets for implantation into the subconjunctival space in the eye are being developed to inhibit scarring after glaucoma filtration surgery (GFS). There is a need to evaluate drug dissolution at the molecular level to determine how the chemical structure of the active may correlate with dissolution in the nonsink conditions of the conjunctival space. We conducted molecular dynamics simulations to study the dissolution process of tablets derived from two drugs that can inhibit fibrosis after GFS, 5-fluorouracil (5-FU) and the matrix metalloprotease inhibitor (MMPi), ilomastat. The dissolution was simulated in the presence of simple point charge (SPC) water molecules, and the liquid turnover of the aqueous humor in the subconjunctival space was simulated by removal of the dissolved drug molecules at regular intervals and replacement by new water molecules. At the end of the simulation, the total molecular solvent accessible surface area of 5-FU tablets increased by 60 times more than that of ilomastat as a result of tablet swelling and release of molecules into solution. The tablet dissolution pattern shown in our molecular dynamic simulations tends to correlate with experimental release profiles. This work indicates that a series of molecular dynamic simulations can be used to predict the influence of the molecular properties of a drug on its dissolution profile and could be useful during preformulation where sufficient amounts of the drug are not always available to perform dissolution studies.

Potential of lichen secondary metabolites against Plasmodium liver stage parasites with FAS-II as the potential target.

Chemicals targeting the liver stage (LS) of the malaria parasite are useful for causal prophylaxis of malaria. In this study, four lichen metabolites, evernic acid (1), vulpic acid (2), psoromic acid (3), and (+)-usnic acid (4), were evaluated against LS parasites of Plasmodium berghei. Inhibition of P. falciparum blood stage (BS) parasites was also assessed to determine stage specificity. Compound 4 displayed the highest LS activity and stage specificity (LS IC50 value 2.3 µM, BS IC50 value 47.3 µM). The compounds 1-3 inhibited one or more enzymes (PfFabI, PfFabG, and PfFabZ) from the plasmodial fatty acid biosynthesis (FAS-II) pathway, a potential drug target for LS activity. To determine species specificity and to clarify the mechanism of reported antibacterial effects, 1-4 were also evaluated against FabI homologues and whole cells of various pathogens (S. aureus, E. coli, M. tuberculosis). Molecular modeling studies suggest that lichen acids act indirectly via binding to allosteric sites on the protein surface of the FAS-II enzymes. Potential toxicity of compounds was assessed in human hepatocyte and cancer cells (in vitro) as well as in a zebrafish model (in vivo). This study indicates the therapeutic and prophylactic potential of lichen metabolites as antibacterial and antiplasmodial agents.

LY2183240 regioisomers act as competitive and selective inhibitors of class C ß-lactamases.

The regioisomers of the anandamide-acting drug LY2183240 exhibited specific potent and competitive inhibitory activities against class C ß-lactamases. More explicitly, the 1,5- and 2,5-regioisomers inhibited AmpC from Enterobacter hormaechei (formerly Enterobacter cloacae) with inhibitor binding affinity values of 1.8 µM and 2.45 µM, respectively. Structural molecular modelling studies revealed the interaction of the regioisomers with the relevant residues of the catalytic site of cephalosporinase from E. hormaechei P99, which included Tyr150, Lys315 and Thr316.