A unique arginine cluster in PolDIP2 enhances nucleotide binding and DNA synthesis by PrimPol.

Replication forks often stall at damaged DNA. To overcome these obstructions and complete the DNA duplication in a timely fashion, replication can be restarted downstream of the DNA lesion. In mammalian cells, this repriming of replication can be achieved through the activities of primase and polymerase PrimPol. PrimPol is stimulated in DNA synthesis through interaction with PolDIP2, however the exact mechanism of this PolDIP2-dependent stimulation is still unclear. Here, we show that PrimPol uses a flexible loop to interact with the C-terminal ApaG-like domain of PolDIP2, and that this contact is essential for PrimPol's enhanced processivity. PolDIP2 increases primer-template and dNTP binding affinities of PrimPol, which concomitantly enhances its nucleotide incorporation efficiency. This stimulation is dependent on a unique arginine cluster in PolDIP2. Since the polymerase activity of PrimPol alone is very limited, this mechanism, where the affinity for dNTPs gets increased by PolDIP2 binding, might be critical for the in vivo function of PrimPol in tolerating DNA lesions at physiological nucleotide concentrations.

Novel Escherichia coli active site dnaE alleles with altered base and sugar selectivity.

The Escherichia coli dnaE gene encodes the α-catalytic subunit (pol IIIα) of DNA polymerase III, the cell's main replicase. Like all high-fidelity DNA polymerases, pol III possesses stringent base and sugar discrimination. The latter is mediated by a so-called "steric gate" residue in the active site of the polymerase that physically clashes with the 2'-OH of an incoming ribonucleotide. Our structural modeling data suggest that H760 is the steric gate residue in E.coli pol IIIα. To understand how H760 and the adjacent S759 residue help maintain genome stability, we generated DNA fragments in which the codons for H760 or S759 were systematically changed to the other nineteen naturally occurring amino acids and attempted to clone them into a plasmid expressing pol III core (α-θ-ε subunits). Of the possible 38 mutants, only nine were successfully sub-cloned: three with substitutions at H760 and 6 with substitutions at S759. Three of the plasmid-encoded alleles, S759C, S759N, and S759T, exhibited mild to moderate mutator activity and were moved onto the chromosome for further characterization. These studies revealed altered phenotypes regarding deoxyribonucleotide base selectivity and ribonucleotide discrimination. We believe that these are the first dnaE mutants with such phenotypes to be reported in the literature.

Kinetic Effects of ß,γ-Modified Deoxynucleoside 5'-Triphosphate Analogues on RNA-Catalyzed Polymerization of DNA.

A recently described DNA polymerase ribozyme, obtained by in vitro evolution, provides the opportunity to investigate mechanistic features of RNA catalysis using methods that previously had only been applied to DNA polymerase proteins. Insight can be gained into the transition state of the DNA polymerization reaction by studying the behavior of various ß,γ-bridging substituted methylene (CXY; X, Y = H, halo, methyl) or imido (NH) dNTP analogues that differ with regard to the pKa4 of the bisphosphonate or imidodiphosphate leaving group. The apparent rate constant (kpol) of the polymerase ribozyme was determined for analogues of dGTP and dCTP that span a broad range of acidities for the leaving group, ranging from 7.8 for the CF2-bisphosphonate to 11.6 for the CHCH3-bisphosphonate. A Brønsted plot of log(kpol) versus pKa4 of the leaving group demonstrates linear free energy relationships (LFERs) for dihalo-, monohalo-, and non-halogen-substituted analogues of the dNTPs, with negative slopes, as has been observed for DNA polymerase proteins. The unsubstituted dNTPs have a faster catalytic rate than would be predicted from consideration of the linear free energy relationship alone, presumably due to a relatively more favorable interaction of the ß,γ-bridging oxygen within the active site. Although the DNA polymerase ribozyme is considerably slower than DNA polymerase proteins, it exhibits a similar LFER fingerprint, suggesting mechanistic commonality pertaining to the buildup of negative charge in the transition state, despite the very different chemical compositions of the two catalysts.

Probing the Catalytic Mechanism and Inhibition of SAMHD1 Using the Differential Properties of Rp- and Sp-dNTPαS Diastereomers.

SAMHD1 is a fundamental regulator of cellular dNTPs that catalyzes their hydrolysis into 2'-deoxynucleoside and triphosphate, restricting the replication of viruses, including HIV-1, in CD4+ myeloid lineage and resting T-cells. SAMHD1 mutations are associated with the autoimmune disease Aicardi-Goutières syndrome (AGS) and certain cancers. More recently, SAMHD1 has been linked to anticancer drug resistance and the suppression of the interferon response to cytosolic nucleic acids after DNA damage. Here, we probe dNTP hydrolysis and inhibition of SAMHD1 using the Rp and Sp diastereomers of dNTPαS nucleotides. Our biochemical and enzymological data show that the α-phosphorothioate substitution in Sp-dNTPαS but not Rp-dNTPαS diastereomers prevents Mg2+ ion coordination at both the allosteric and catalytic sites, rendering SAMHD1 unable to form stable, catalytically active homotetramers or hydrolyze substrate dNTPs at the catalytic site. Furthermore, we find that Sp-dNTPαS diastereomers competitively inhibit dNTP hydrolysis, while Rp-dNTPαS nucleotides stabilize tetramerization and are hydrolyzed with similar kinetic parameters to cognate dNTPs. For the first time, we present a cocrystal structure of SAMHD1 with a substrate, Rp-dGTPαS, in which an Fe-Mg-bridging water species is poised for nucleophilic attack on the Pα. We conclude that it is the incompatibility of Mg2+, a hard Lewis acid, and the α-phosphorothioate thiol, a soft Lewis base, that prevents the Sp-dNTPαS nucleotides coordinating in a catalytically productive conformation. On the basis of these data, we present a model for SAMHD1 stereospecific hydrolysis of Rp-dNTPαS nucleotides and for a mode of competitive inhibition by Sp-dNTPαS nucleotides that competes with formation of the enzyme-substrate complex.

PrimPol, an archaic primase/polymerase operating in human cells.

We describe a second primase in human cells, PrimPol, which has the ability to start DNA chains with deoxynucleotides unlike regular primases, which use exclusively ribonucleotides. Moreover, PrimPol is also a DNA polymerase tailored to bypass the most common oxidative lesions in DNA, such as abasic sites and 8-oxoguanine. Subcellular fractionation and immunodetection studies indicated that PrimPol is present in both nuclear and mitochondrial DNA compartments. PrimPol activity is detectable in mitochondrial lysates from human and mouse cells but is absent from mitochondria derived from PRIMPOL knockout mice. PRIMPOL gene silencing or ablation in human and mouse cells impaired mitochondrial DNA replication. On the basis of the synergy observed with replicative DNA polymerases Polγ and Polε, PrimPol is proposed to facilitate replication fork progression by acting as a translesion DNA polymerase or as a specific DNA primase reinitiating downstream of lesions that block synthesis during both mitochondrial and nuclear DNA replication.

Single-molecule detection of deoxyribonucleoside triphosphates in microdroplets.

A new approach to single-molecule DNA sequencing in which dNTPs, released by pyrophosphorolysis from the strand to be sequenced, are captured in microdroplets and read directly could have substantial advantages over current sequence-by-synthesis methods; however, there is no existing method sensitive enough to detect a single nucleotide in a microdroplet. We have developed a method for dNTP detection based on an enzymatic two-stage reaction which produces a robust fluorescent signal that is easy to detect and process. By taking advantage of the inherent specificity of DNA polymerases and ligases, coupled with volume restriction in microdroplets, this method allows us to simultaneously detect the presence of and distinguish between, the four natural dNTPs at the single-molecule level, with negligible cross-talk.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Safety evaluation of 2'-deoxy-2'-fluoro nucleotides in GalNAc-siRNA conjugates.

For oligonucleotide therapeutics, chemical modifications of the sugar-phosphate backbone are frequently used to confer drug-like properties. Because 2'-deoxy-2'-fluoro (2'-F) nucleotides are not known to occur naturally, their safety profile was assessed when used in revusiran and ALN-TTRSC02, two short interfering RNAs (siRNAs), of the same sequence but different chemical modification pattern and metabolic stability, conjugated to an N-acetylgalactosamine (GalNAc) ligand for targeted delivery to hepatocytes. Exposure to 2'-F-monomer metabolites was low and transient in rats and humans. In vitro, 2'-F-nucleoside 5'-triphosphates were neither inhibitors nor preferred substrates for human polymerases, and no obligate or non-obligate chain termination was observed. Modest effects on cell viability and mitochondrial DNA were observed in vitro in a subset of cell types at high concentrations of 2'-F-nucleosides, typically not attained in vivo. No apparent functional impact on mitochondria and no significant accumulation of 2'-F-monomers were observed after weekly administration of two GalNAc-siRNA conjugates in rats for ∼2 years. Taken together, the results support the conclusion that 2'-F nucleotides can be safely applied for the design of metabolically stabilized therapeutic GalNAc-siRNAs with favorable potency and prolonged duration of activity allowing for low dose and infrequent dosing.

A Model for the Emergence of RNA from a Prebiotically Plausible Mixture of Ribonucleotides, Arabinonucleotides, and 2'-Deoxynucleotides.

The abiotic synthesis of ribonucleotides is thought to have been an essential step toward the emergence of the RNA world. However, it is likely that the prebiotic synthesis of ribonucleotides was accompanied by the simultaneous synthesis of arabinonucleotides, 2'-deoxyribonucleotides, and other variations on the canonical nucleotides. In order to understand how relatively homogeneous RNA could have emerged from such complex mixtures, we have examined the properties of arabinonucleotides and 2'-deoxyribonucleotides in nonenzymatic template-directed primer extension reactions. We show that nonenzymatic primer extension with activated arabinonucleotides is much less efficient than with activated ribonucleotides, and furthermore that once an arabinonucleotide is incorporated, continued primer extension is strongly inhibited. As previously shown, 2'-deoxyribonucleotides are also less efficiently incorporated in primer extension reactions, but the difference is more modest. Experiments with mixtures of nucleotides suggest that the coexistence of ribo- and arabinonucleotides does not impede the copying of RNA templates. Moreover, chimeric oligoribonucleotides containing 2'-deoxy- or arabinonucleotides are effective templates for RNA synthesis. We propose that the initial genetic polymers were random sequence chimeric oligonucleotides formed by untemplated polymerization, but that template copying chemistry favored RNA synthesis; multiple rounds of replication may have led to pools of oligomers composed mainly of RNA.

DNA Nucleobase under Ionizing Radiation: Unexpected Proton Transfer by Thymine Cation in Water Nanodroplets.

The effect of ionizing radiation on DNA constituents is a widely studied fundamental process using experimental and computational techniques. In particular, radiation effects on nucleobases are usually tackled by mass spectrometry in which the nucleobase is embedded in a water nanodroplet. Here, we present a multiscale theoretical study revealing the effects and the dynamics of water droplets towards neutral and ionized thymine. In particular, by using both hybrid quantum mechanics/molecular mechanics and full ab initio molecular dynamics, we reveal an unexpected proton transfer from thymine cation to a nearby water molecule. This leads to the formation of a neutral radical thymine and a Zundel structure, while the hydrated proton localizes at the interface between the deprotonated thymine and the water droplet. This observation opens entirely novel perspectives concerning the reactivity and further fragmentation of ionized nucleobases.

Structures of Class Id Ribonucleotide Reductase Catalytic Subunits Reveal a Minimal Architecture for Deoxynucleotide Biosynthesis.

Class I ribonucleotide reductases (RNRs) share a common mechanism of nucleotide reduction in a catalytic α subunit. All RNRs initiate catalysis with a thiyl radical, generated in class I enzymes by a metallocofactor in a separate ß subunit. Class Id RNRs use a simple mechanism of cofactor activation involving oxidation of a MnII2 cluster by free superoxide to yield a metal-based MnIIIMnIV oxidant. This simple cofactor assembly pathway suggests that class Id RNRs may be representative of the evolutionary precursors to more complex class Ia-c enzymes. X-ray crystal structures of two class Id α proteins from Flavobacterium johnsoniae ( Fj) and Actinobacillus ureae ( Au) reveal that this subunit is distinctly small. The enzyme completely lacks common N-terminal ATP-cone allosteric motifs that regulate overall activity, a process that normally occurs by dATP-induced formation of inhibitory quaternary structures to prevent productive ß subunit association. Class Id RNR activity is insensitive to dATP in the Fj and Au enzymes evaluated here, as expected. However, the class Id α protein from Fj adopts higher-order structures, detected crystallographically and in solution. The Au enzyme does not exhibit these quaternary forms. Our study reveals structural similarity between bacterial class Id and eukaryotic class Ia α subunits in conservation of an internal auxiliary domain. Our findings with the Fj enzyme illustrate that nucleotide-independent higher-order quaternary structures can form in simple RNRs with truncated or missing allosteric motifs.

Optimization of Replication, Transcription, and Translation in a Semi-Synthetic Organism.

Previously, we reported the creation of a semi-synthetic organism (SSO) that stores and retrieves increased information by virtue of stably maintaining an unnatural base pair (UBP) in its DNA, transcribing the corresponding unnatural nucleotides into the codons and anticodons of mRNAs and tRNAs, and then using them to produce proteins containing noncanonical amino acids (ncAAs). Here we report a systematic extension of the effort to optimize the SSO by exploring a variety of deoxy- and ribonucleotide analogues. Importantly, this includes the first in vivo structure-activity relationship (SAR) analysis of unnatural ribonucleoside triphosphates. Similarities and differences between how DNA and RNA polymerases recognize the unnatural nucleotides were observed, and remarkably, we found that a wide variety of unnatural ribonucleotides can be efficiently transcribed into RNA and then productively and selectively paired at the ribosome to mediate the synthesis of proteins with ncAAs. The results extend previous studies, demonstrating that nucleotides bearing no significant structural or functional homology to the natural nucleotides can be efficiently and selectively paired during replication, to include each step of the entire process of information storage and retrieval. From a practical perspective, the results identify the most optimal UBP for replication and transcription, as well as the most optimal unnatural ribonucleoside triphosphates for transcription and translation. The optimized SSO is now, for the first time, able to efficiently produce proteins containing multiple, proximal ncAAs.

Absolute Quantification of RNA or DNA Using Acid Hydrolysis and Mass Spectrometry.

Accurate, traceable quantification of ribonucleotide or deoxyribonucleotide oligomers is achievable using acid hydrolysis and isotope dilution mass spectrometry (ID-MS). In this work, formic acid hydrolysis is demonstrated to generate stoichiometric release of nucleobases from intact oligonucleotides, which then can be measured by ID-MS, facilitating true and precise absolute quantification of RNA, short linearized DNA, or genomic DNA. Surrogate nucleobases are quantified with a liquid chromatography-tandem mass spectrometry (LC-MS/MS) workflow, using multiple reaction monitoring (MRM). Nucleobases were chromatographically resolved using a novel cation-exchange separation, incorporating a pH gradient. Trueness of this quantitative assay is estimated from agreement among the surrogate nucleobases and by comparison to concentrations provided for commercial materials or Standard Reference Materials (SRMs) from the National Institute of Standards and Technology (NIST). Comparable concentration estimates using NanoDrop spectrophotometry or established from droplet-digital polymerase chain reaction (ddPCR) techniques agree well with the results. Acid hydrolysis-ID-LC-MS/MS provides excellent quantitative selectivity and accuracy while enabling traceability to mass unit. Additionally, this approach can be uniquely useful for quantifying modified nucleobases or mixtures.

Analysis of the Isolated and the Clustered DNA Damages by Single-Molecule Counting.

DNA damage seriously threats the genomic stability and is linked to mutagenesis, carcinogenesis, and cell death. DNA damage includes the isolated damage and the clustered damages, but few approaches are available for efficient detection of the clustered damage due to its spatial distribution. Herein, we present a single-molecule counting approach with the capability of detecting both the isolated and the clustered damages in genomic DNAs. We employed the repair enzymes to remove the DNA damage and used the terminal deoxynucleotidyl transferase (TdT) to incorporate biotinylated nucleotides and fluorescent nucleotides into the damage sites in a template-independent manner. The number of total oxidative damaged bases is quantified to be 7328-7406 in a single HeLa cell treated with 150 µM H2O2. This method in combination with special repair enzymes can detect a variety of DNA damage in different types of cells, holding great potential for early diagnosis of DNA damage-related human diseases.

Crystal structures of phage NrS-1 N300-dNTPs-Mg2+ complex provide molecular mechanisms for substrate specificity.

A novel DNA polymerase from the deep-sea vent phage NrS-1, was characterized as a primase-polymerase (referred to as prim-pol), which works as a self-priming DNA polymerase to synthesize de novo long DNA strands. Functional research on the NrS-1 prim-pol illustrated that the N-terminal 300 residues (referred to as N300) have de novo synthesis activity similar to that of the full-length enzyme. Just like other prim-pols, NrS-1 prim-pol was able to initiate DNA synthesis, proficiently discriminating against ribonucleotides (NTPs), exclusively using deoxynucleotides (dNTPs). However, the structural basis for this discrimination is not well understood. Here, the three kinds of crystal structures of N300-dNTPs-Mg2+ complex were determined. These complex structures shared the identical steric architecture and hydrogen-bond interactions in the catalytic center. The results of biochemical studies indicated that R145 possibly plays an indispensable role in the primer extension. Mutagenesis and structural simulation showed that the backbone carboxyl group of Y146, as a potential sugar selector, was involved in steric clashing with the incoming 2'-OH group of NTPs. However, the mechanism of substrate discrimination probably was different from that of other prim-pols, according to the structural analyses and sequence comparison.

Structural accommodation of ribonucleotide incorporation by the DNA repair enzyme polymerase Mu.

While most DNA polymerases discriminate against ribonucleotide triphosphate (rNTP) incorporation very effectively, the Family X member DNA polymerase µ (Pol µ) incorporates rNTPs almost as efficiently as deoxyribonucleotides. To gain insight into how this occurs, here we have used X-ray crystallography to describe the structures of pre- and post-catalytic complexes of Pol µ with a ribonucleotide bound at the active site. These structures reveal that Pol µ binds and incorporates a rNTP with normal active site geometry and no distortion of the DNA substrate or nucleotide. Moreover, a comparison of rNTP incorporation kinetics by wildtype and mutant Pol µ indicates that rNTP accommodation involves synergistic interactions with multiple active site residues not found in polymerases with greater discrimination. Together, the results are consistent with the hypothesis that rNTP incorporation by Pol µ is advantageous in gap-filling synthesis during DNA double strand break repair by nonhomologous end joining, particularly in nonreplicating cells containing very low deoxyribonucleotide concentrations.

The presence of ribonucleotides in DNA has an ambiguous impact on the maintenance of genetic stability / Obecnosc rybonukleotydów w DNA ma antagonistyczne znaczenie dla utrzymania stabilnosci genetycznej organizmów.

High replication fidelity, understood as the DNA polymerases' ability to select nucleotides with both correct base and sugar, is of critical importance for maintaining the genetic stability. Due to the fact that the cellular levels of ribonucleotides are much higher than the concentrations of deoxyribonucleotides, replicative polymerases are able to incorporate ribonucleotides with up to 1000-fold higher frequency than mismatched deoxyribonucleotides. The ability to discriminate against ribonucleotides by the DNA polymerases relies on the steric gate residue in the enzyme's catalytic centre. Despite the fact that ribonucleotides are the most abundantly inserted incorrect nucleotides in DNA, they are not observed in properly functioning cells. The major pathway responsible for the recognition and removal of ribonucleotides from DNA is called Ribonucleotide Excision Repair. The impairment of ribonucleotide removal pathways can cause increased mutation rate, replication stress, DNA breakage, problems with transcription, chromatin structure maintenance, genetic disorders and cell death. In spite of that, ribonucleotide incorporation into DNA may have some positive biological impact, stimulating mismatch repair and non-homologous end joining.

Mapping Functional Substrate-Enzyme Interactions in the pol ß Active Site through Chemical Biology: Structural Responses to Acidity Modification of Incoming dNTPs.

We report high-resolution crystal structures of DNA polymerase (pol) ß in ternary complex with a panel of incoming dNTPs carrying acidity-modified 5'-triphosphate groups. These novel dNTP analogues have a variety of halomethylene substitutions replacing the bridging oxygen between Pß and Pγ of the incoming dNTP, whereas other analogues have alkaline substitutions at the bridging oxygen. Use of these analogues allows the first systematic comparison of effects of 5'-triphosphate acidity modification on active site structures and the rate constant of DNA synthesis. These ternary complex structures with incoming dATP, dTTP, and dCTP analogues reveal the enzyme's active site is not grossly altered by the acidity modifications of the triphosphate group, yet with analogues of all three incoming dNTP bases, subtle structural differences are apparent in interactions around the nascent base pair and at the guanidinium groups of active site arginine residues. These results are important for understanding how acidity modification of the incoming dNTP's 5'-triphosphate can influence DNA polymerase activity and the significance of interactions at arginines 183 and 149 in the active site.

p21 Restricts HIV-1 in Monocyte-Derived Dendritic Cells through the Reduction of Deoxynucleoside Triphosphate Biosynthesis and Regulation of SAMHD1 Antiviral Activity.

HIV-1 infection of noncycling cells, such as dendritic cells (DCs), is impaired due to limited availability of deoxynucleoside triphosphates (dNTPs), which are needed for HIV-1 reverse transcription. The levels of dNTPs are tightly regulated during the cell cycle and depend on the balance between dNTP biosynthesis and degradation. SAMHD1 potently blocks HIV-1 replication in DCs, although the underlying mechanism is still unclear. SAMHD1 has been reported to be able to degrade dNTPs and viral nucleic acids, which may both hamper HIV-1 reverse transcription. The relative contribution of these activities may differ in cycling and noncycling cells. Here, we show that inhibition of HIV-1 replication in monocyte-derived DCs (MDDCs) is associated with an increased expression of p21cip1/waf, a cell cycle regulator that is involved in the differentiation and maturation of DCs. Induction of p21 in MDDCs decreases the pool of dNTPs and increases the antiviral active isoform of SAMHD1. Although both processes are complementary in inhibiting HIV-1 replication, the antiviral activity of SAMHD1 in our primary cell model appears to be, at least partially, independent of its dNTPase activity. The reduction in the pool of dNTPs in MDDCs appears rather mostly due to a p21-mediated suppression of several enzymes involved in dNTP synthesis (i.e., RNR2, TYMS, and TK-1). These results are important to better understand the interplay between HIV-1 and DCs and may inform the design of new therapeutic approaches to decrease viral dissemination and improve immune responses against HIV-1.IMPORTANCE DCs play a key role in the induction of immune responses against HIV. However, HIV has evolved ways to exploit these cells, facilitating immune evasion and virus dissemination. We have found that the expression of p21, a cyclin-dependent kinase inhibitor involved in cell cycle regulation and monocyte differentiation and maturation, potentially can contribute to the inhibition of HIV-1 replication in monocyte-derived DCs through multiple mechanisms. p21 decreased the size of the intracellular dNTP pool. In parallel, p21 prevented SAMHD1 phosphorylation and promoted SAMHD1 dNTPase-independent antiviral activity. Thus, induction of p21 resulted in conditions that allowed the effective inhibition of HIV-1 replication through complementary mechanisms. Overall, p21 appears to be a key regulator of HIV infection in myeloid cells.

Interfacing DNA Oligonucleotides with Calcium Phosphate and Other Metal Phosphates.

Calcium phosphate (CaP) has long been used for DNA delivery, although its fundamental interaction with DNA, especially with single-stranded DNA oligonucleotides, remains to be fully understood. Using fluorescently labeled oligonucleotides, we herein studied DNA adsorption isotherm and the effect of DNA length and sequence. Longer DNAs are adsorbed more strongly, and at neutral pH, poly-C DNAs are adsorbed more than the other three DNA homopolymers. However, at near pH 11, the pH of CaP synthesis, T30 DNA is adsorbed more strongly than C30 or A30. This can explain why T30 and G30 can fully inhibit the growth of CaP, while A30 and C30 only retarded its growth kinetics. DNA adsorption also reduces aggregation of CaP. DNA desorption experiments were carried out using concentrated urea, thymidine, or inorganic phosphate as competitors, and desorption was observed only in the presence of phosphate, suggesting that DNA uses its phosphate backbone to interact with the CaP surface. Desorption was also promoted by raising the NaCl concentration suggesting the electrostatic nature of interaction. Finally, ten different metal phosphate materials were synthesized by co-precipitating each metal ion (Ce3+, Fe3+, Ca2+, Ni2+, Zn2+, Mn2+, Ba2+, Cu2+, Sr2+, Co2+), and DNA adsorption by these phosphate precipitants was found to be related to their surface charge and metal chemistry. This work has revealed fundamental surface science of DNA adsorption by CaP and other metal phosphate salts, and this knowledge might be useful for gene delivery, biomineralization, and DNA-directed assembly of metal phosphate materials.