Obesity in adult acute myeloid leukemia is not associated with inferior response or survival even when dose capping anthracyclines: An ECOG-ACRIN analysis.

BACKGROUND: Obesity (body mass index [BMI] ≥30 kg/m2 ) is an important epidemiological risk factor for developing acute myeloid leukemia (AML). Therefore, the authors studied the association of obesity with clinical and genetic phenotype and its impact on outcome in adults with AML. METHODS: The authors analyzed BMI in 1088 adults who were receiving intensive remission induction and consolidation therapy in two prospective, randomized therapeutic clinical trials of the Eastern Cooperative Oncology Group-American College of Radiology Imaging Network: E1900 (ClinicalTrials.gov identifier NCT00049517; patients younger than 60 years) and E3999 (ClinicalTrials.gov identifier NCT00046930; patients aged 60 years or older). RESULTS: Obesity was prevalent at diagnosis (33%) and, compared with nonobesity, was associated with intermediate-risk cytogenetics group (p = .008), poorer performance status (p = .01), and a trend toward older age (p = .06). Obesity was not associated with somatic mutations among a selected 18-gene panel that was tested in a subset of younger patients. Obesity was not associated with clinical outcome (including complete remission, early death, or overall survival), and the authors did not identify any patient subgroup that had inferior outcomes based on BMI. Obese patients were significantly more likely to receive <90% of the intended daunorubicin dose despite protocol specification, particularly in the E1900 high-dose (90 mg/m2 ) daunorubicin arm (p = .002); however, this did not correlate with inferior overall survival on multivariate analysis (hazard ratio, 1.39; 95% confidence interval, 0.90-2.13; p = .14). CONCLUSIONS: Obesity is associated with unique clinical and disease-related phenotypic features in AML and may influence physician treatment decisions regarding daunorubicin dosing. However, the current study demonstrates that obesity is not a factor in survival, and strict adherence to body surface area-based dosing is not necessary because dose adjustments do not affect outcomes.

Neutralizing GM-CSF autoantibodies in pulmonary alveolar proteinosis, cryptococcal meningitis and severe nocardiosis.

BACKGROUND: Anti GM-CSF autoantibodies (aAb) have been related to acquired pulmonary alveolar proteinosis (PAP) and described in cases of severe infections such as cryptococcosis and nocardiosis in previously healthy subjects. Whether there are different anti-GM-CSF autoantibodies corresponding to these phenotypes is unclear. Therefore, we examined anti-GM-CSF autoantibodies to determine whether amount or neutralizing activity could distinguish between groups. METHODS: Plasma samples gathered in the National Institute of Health from patients with anti GM-CSF aAb and either PAP (n = 15), cryptococcal meningitis (n = 15), severe nocardiosis (n = 5) or overlapping phenotypes (n = 6) were compared. The relative amount of aAb was assessed using a particle-based approach, reported as a mouse monoclonal anti-human GM-CSF as standard curve and expressed in an arbitrary Mouse Monoclonal Antibody Unit (MMAU). The neutralizing activity of the plasma was assessed by inhibition of GM-CSF-induced intracellular phospho-STAT5 (pSTAT5) in monocytes. RESULTS: Anti-GM-CSF aAb relative amounts were higher in PAP patients compared to those with cryptococcosis (mean 495 ± 464 MMAU vs 197 ± 159 MMAU, p = 0.02); there was no difference with patients with nocardiosis (430 ± 493 MMAU) nor between the two types of infections. The dilution of plasma resulting in 50% inhibition of GM-CSF-induced pSTAT5 (approximate IC50) did not vary appreciably across groups of patients (1.6 ± 3.1%, 3.9 ± 6% and 1.8 ± 2.2% in PAP patients, cryptococcosis and nocardiosis patients, respectively). Nor was the concentration of GM-CSF necessary to induce 50% of maximal GM-CSF-induced pSTAT5 in the presence of 10 MMAU of anti-GM-CSF aAb (EC50). When studying longitudinal samples from patients with PAP or disseminated nocardiosis, the neutralizing effect of anti-GM-CSF aAb was relatively constant over time despite targeted treatments and variations in aAb levels. CONCLUSIONS: Despite different clinical manifestations, anti-GM-CSF antibodies were similar across PAP, cryptococcosis and nocardiosis. Underlying host genetics and functional analyses may help further differentiate the biology of these conditions.

NCCN Guidelines® Insights: Myelodysplastic Syndromes, Version 3.2022.

The NCCN Guidelines for Myelodysplastic Syndromes (MDS) provide recommendations for the evaluation, diagnosis, and management of patients with MDS based on a review of clinical evidence that has led to important advances in treatment or has yielded new information on biologic factors that may have prognostic significance in MDS. The multidisciplinary panel of MDS experts meets on an annual basis to update the recommendations. These NCCN Guidelines Insights focus on some of the updates for the 2022 version of the NCCN Guidelines, which include treatment recommendations both for lower-risk and higher-risk MDS, emerging therapies, supportive care recommendations, and genetic familial high-risk assessment for hereditary myeloid malignancy predisposition syndromes.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Systematic review and meta-analysis comparing perioperative outcomes of pediatric emergency appendicectomy performed by trainee vs trained surgeon.

Appendicectomy is a common pediatric surgical procedure performed by trainees and surgeons with varying reported outcomes. It is a benchmark procedure for trainee progression and training benefits should be weighed against patient safety and perioperative outcomes. This systematic review and meta-analysis investigated any differential perioperative outcomes dependent on the grade of the operating surgeon. A systematic literature review and meta-analysis were performed comparing outcomes of pediatric appendicectomy performed by trainees versus trained surgeons. Of 2,086 articles screened, 5 retrospective non-randomized comparative studies reporting on 10,019 participants were analyzed. There was no difference in overall complications (OR 0.92; 95% CI 0.76, 1.12; P = 0.42), major complications [Clavien-Dindo (CD) III/IV] (OR 1.18; 95% CI 0.71, 1.97; P = 0.52), minor complications (CD I/II) (OR 1.13; 95% CI 0.57, 2.27; P = 0.72), post-op ileus (OR 0.74; 95% CI 0.10, 5.26; P = 0.76), wound infections (OR 0.87; 95% CI 0.62, 1.21; P = 0.41), abscess formation (OR 0.58; 95% CI 0.28, 1.22; P = 0.15), operation times [Mean Difference (MD) 2.31 min; 95% CI - 4.94, 9.56; P = 0.53] and reoperation rate (OR 1.22; 95% CI 0.23, 6.42; P = 0.81). Trainees had fewer conversions to open appendicectomy (OR 0.14; 95% CI 0.02, 0.88; P = 0.04). Appendicectomy performed on pediatric patients by trainees did not compromise patient safety. LEVEL OF EVIDENCE: III.

Enasidenib plus azacitidine versus azacitidine alone in patients with newly diagnosed, mutant-IDH2 acute myeloid leukaemia (AG221-AML-005): a single-arm, phase 1b and randomised, phase 2 trial.

BACKGROUND: Enasidenib is an oral inhibitor of mutant isocitrate dehydrogenase-2 (IDH2) proteins. We evaluated the safety and activity of enasidenib plus azacitidine versus azacitidine alone in patients with newly diagnosed, mutant-IDH2 acute myeloid leukaemia ineligible for intensive chemotherapy. METHODS: This open-label, phase 1b/2 trial was done at 43 clinical sites in 12 countries (the USA, Germany, Canada, the UK, France, Spain, Australia, Italy, the Netherlands, Portugal, Switzerland, and South Korea). Eligible patients were aged 18 years or older and had newly diagnosed, mutant-IDH2 acute myeloid leukaemia, and an Eastern Cooperative Oncology Group performance status of 0-2. In the phase 1b dose-finding portion, patients received oral enasidenib 100 mg/day or 200 mg/day in continuous 28-day cycles, plus subcutaneous azacitidine 75 mg/m2 per day for 7 days of each cycle. In phase 2, patients were randomly assigned (2:1) via an interactive web response system to enasidenib plus azacitidine or azacitidine-only, stratified by acute myeloid leukaemia subtype (de novo or secondary). The primary endpoint in the phase 2 portion was the overall response rate in the intention-to-treat population at a prespecified interim analysis (Aug 20, 2019) when all patients had at least 1 year of follow-up. Safety was assessed in all patients who received at least one dose of study drug. The trial is registered with ClinicalTrials.gov, NCT02677922, and is ongoing. FINDINGS: Between June 3, 2016, and Aug 2, 2018, 322 patients were screened and 107 patients with mutant-IDH2 acute myeloid leukaemia were enrolled. At data cutoff for the interim analysis, 24 patients (including two from the phase 1 portion) were still receiving their assigned treatment. Six patients were enrolled in the phase 1b dose-finding portion of the trial and received enasidenib 100 mg (n=3) or 200 mg (n=3) in combination with azacitidine. No dose-limiting toxicities occurred and the enasidenib 100 mg dose was selected for phase 2. In phase 2, 101 patients were randomly assigned to enasidenib plus azacitidine (n=68) or azacitidine only (n=33). Median age was 75 years (IQR 71-78). 50 (74%; 95% CI 61-84) patients in the enasidenib plus azacitidine combination group and 12 (36%; 20-55) patients in the azacitidine monotherapy group achieved an overall response (odds ratio 4·9 [95% CI 2·0-11·9]; p=0·0003). Common treatment-related grade 3 or 4 adverse events with enasidenib plus azacitidine were thrombocytopenia (25 [37%] of 68 vs six [19%] of 32 in the azacitidine-only group), neutropenia (25 [37%] vs eight [25%]), anaemia (13 [19%] vs seven [22%]), and febrile neutropenia (11 [16%] vs five [16%]). Serious treatment-related adverse events were reported in 29 (43%) patients in the combination group and 14 (44%) patients in the azacitidine-only group; serious treatment-related adverse events occurring in more than 5% of patients in either group were febrile neutropenia (nine [13%] in the combination group vs five [16%] in the azacitidine-only group), differentiation syndrome (seven [10%] vs none), and pneumonia (three [4%] vs two [6%]). No treatment-related deaths were reported. INTERPRETATION: Combination enasidenib plus azacitidine was well tolerated and significantly improved overall response rates compared with azacitidine monotherapy, suggesting that this regimen can improve outcomes for patients with newly diagnosed, mutant-IDH2 acute myeloid leukaemia. FUNDING: Bristol Myers Squibb.

Outcomes in Previously Healthy Cryptococcal Meningoencephalitis Patients Treated With Pulse Taper Corticosteroids for Post-infectious Inflammatory Syndrome.

BACKGROUND: Cryptococcal meningoencephalitis (CM) is a major cause of mortality in immunosuppressed patients and previously healthy individuals. In the latter, a post-infectious inflammatory response syndrome (PIIRS) is associated with poor clinical response despite antifungal therapy and negative cerebrospinal fluid (CSF) cultures. Data on effective treatment are limited. METHODS: Between March 2015 and March 2020, 15 consecutive previously healthy patients with CM and PIIRS were treated with adjunctive pulse corticosteroid taper therapy (PCT) consisting of intravenous methylprednisolone 1 gm daily for 1 week followed by oral prednisone 1 mg/kg/day, tapered based on clinical and radiological response plus oral fluconazole. Montreal cognitive assessments (MOCA), Karnofsky performance scores, magnetic resonance imaging (MRI) brain scanning, ophthalmic and audiologic exams, and CSF parameters including cellular and soluble immune responses were compared at PIIRS diagnosis and after methylprednisolone completion. RESULTS: The median time from antifungal treatment to steroid initiation was 6 weeks. The most common symptoms at PIIRS diagnosis were altered mental status and vision changes. All patients demonstrated significant improvements in MOCA and Karnofsky scores at 1 month (P < .0003), which was accompanied by improvements in CSF glucose, white blood cell (WBC) count, protein, cellular and soluble inflammatory markers 1 week after receiving corticosteroids (CS) (P < .003). All patients with papilledema and visual field deficits also exhibited improvement (P < .0005). Five out of 7 patients who underwent audiological testing demonstrated hearing improvement. Brain MRI showed significant improvement of radiological findings (P = .001). CSF cultures remained negative. CONCLUSIONS: PCT in this small cohort of PIIRS was associated with improvements in CM-related complications with minimal toxicity in the acute setting.

A Multicenter, Longitudinal Cohort Study of Cryptococcosis in Human Immunodeficiency Virus-negative People in the United States.

BACKGROUND: Cryptococcosis is increasingly recognized in people without human immunodeficiency virus (HIV). METHODS: A multicenter, prospective cohort study was performed in 25 US centers. Consenting patients were prospectively followed for ≤2 years. Neurological morbidities were assessed with longitudinal event depiction and functional scores (Montreal Cognitive Assessment [MoCA]). Risks of death were analyzed using Cox regression. RESULTS: One hundred forty-five subjects were enrolled. Most were male (95; 65.5%) and had immunosuppression (120; 82.8%), including solid organ transplant (SOT; 33.8%), autoimmunity (15.9%), and hematologic malignancies (11.7%). Disease involved the central nervous system (CNS) in 71 subjects (49%). Fever was uncommon, documented in 40 (27.8%) subjects, and absence was associated with diagnostic delay (mean: 48.2 vs 16.5 days; P = .007). Abnormal MoCA scores (<26) were predictive of CNS disease; low scores (<22) were associated with poor long-term cognition. Longitudinal event depiction demonstrated frequent complications in people with CNS disease; 25 subjects (35.2%) required >1 lumbar puncture and 8 (11.3%) required ventriculostomies. In multivariable models, older age (>60 years) was associated with higher risks of death (hazard ratio [HR], 2.14; 95% confidence interval [CI], 1.05-4.38; P = .036), and lower risks were noted with underlying hematologic malignancy (HR, 0.29; 95% CI, 0.09-0.98; P = .05) and prior SOT (HR, 0.153; 95% CI, 0.05-0.44; P = .001). CONCLUSIONS: Despite aggressive antifungal therapies, outcomes of CNS cryptococcosis in people without HIV are characterized by substantial long-term neurological sequelae. Studies are needed to understand mechanism(s) of cognitive decline and to enable better treatment algorithms.

The role of eosinophil morphology in distinguishing between reactive eosinophilia and eosinophilia as a feature of a myeloid neoplasm.

Morphological features of eosinophils in patients with reactive eosinophilia (28 patients) and clonal eosinophilia (26 patients) have been compared with each other and with the eosinophil characteristics of healthy volunteers (three subjects) and of patients with the idiopathic hypereosinophilic syndrome (three patients). Morphological features, assessed in isolation from other haematological abnormalities, were found to have poor specificity for a myeloid neoplasm. The most useful feature was the presence of basophilic granules in mature eosinophils, which was associated particularly with acute myeloid leukaemia with inv(16). Marked reduction in granules occurred more often in some subsets of the myeloid neoplasm group but nevertheless was lacking in specificity since it was not infrequently seen in reactive eosinophilia. Although experienced morphologists more often considered that a myeloid neoplasm was likely in patients in whom this was the diagnosis (69%), myeloid neoplasia was also considered likely in a considerable proportion (39%) of patients with reactive eosinophilia. Morphological abnormalities of eosinophils therefore cannot be assessed in isolation in seeking to make a diagnosis of a myeloid neoplasm. Morphology is, however, needed and should be integrated with the results of other investigations.

Acetylcholine Inhibits Platelet Activation.

Platelets are key mediators of thrombosis. Many agonists of platelet activation are known, but fewer endogenous inhibitors of platelets, such as prostacyclin and nitric oxide (NO), have been identified. Acetylcholinesterase inhibitors, such as donepezil, can cause bleeding in patients, but the underlying mechanisms are not well understood. We hypothesized that acetylcholine is an endogenous inhibitor of platelets. We measured the effect of acetylcholine or analogs of acetylcholine on human platelet activation ex vivo. Acetylcholine and analogs of acetylcholine inhibited platelet activation, as measured by P-selectin translocation and glycoprotein IIb IIIa conformational changes. Conversely, we found that antagonists of the acetylcholine receptor, such as pancuronium, enhance platelet activation. Furthermore, drugs inhibiting acetylcholinesterase, such as donepezil, also inhibit platelet activation, suggesting that platelets release acetylcholine. We found that NO mediates acetylcholine inhibition of platelets. Our data suggest that acetylcholine is an endogenous inhibitor of platelet activation. The cholinergic system may be a novel target for antithrombotic therapies.

Ethylene signaling regulates natural variation in the abundance of antifungal acetylated diferuloylsucroses and Fusarium graminearum resistance in maize seedling roots.

The production and regulation of defensive specialized metabolites play a central role in pathogen resistance in maize (Zea mays) and other plants. Therefore, identification of genes involved in plant specialized metabolism can contribute to improved disease resistance. We used comparative metabolomics to identify previously unknown antifungal metabolites in maize seedling roots, and investigated the genetic and physiological mechanisms underlying their natural variation using quantitative trait locus mapping and comparative transcriptomics approaches. Two maize metabolites, smilaside A (3,6-diferuloyl-3',6'-diacetylsucrose) and smiglaside C (3,6-diferuloyl-2',3',6'-triacetylsucrose), were identified that could contribute to maize resistance against Fusarium graminearum and other fungal pathogens. Elevated expression of an ethylene signaling gene, ETHYLENE INSENSITIVE 2 (ZmEIN2), co-segregated with a decreased smilaside A : smiglaside C ratio. Pharmacological and genetic manipulation of ethylene availability and sensitivity in vivo indicated that, whereas ethylene was required for the production of both metabolites, the smilaside A : smiglaside C ratio was negatively regulated by ethylene sensitivity. This ratio, rather than the absolute abundance of these two metabolites, was important for maize seedling root defense against F. graminearum. Ethylene signaling regulates the relative abundance of the two F. graminearum-resistance-related metabolites and affects resistance against F. graminearum in maize seedling roots.

Proposed diagnostic criteria for classical chronic myelomonocytic leukemia (CMML), CMML variants and pre-CMML conditions.

Chronic myelomonocytic leukemia (CMML) is a myeloid neoplasm characterized by dysplasia, abnormal production and accumulation of monocytic cells and an elevated risk of transforming into acute leukemia. Over the past two decades, our knowledge about the pathogenesis and molecular mechanisms in CMML has increased substantially. In parallel, better diagnostic criteria and therapeutic strategies have been developed. However, many questions remain regarding prognostication and optimal therapy. In addition, there is a need to define potential pre-phases of CMML and special CMML variants, and to separate these entities from each other and from conditions mimicking CMML. To address these unmet needs, an international consensus group met in a Working Conference in August 2018 and discussed open questions and issues around CMML, its variants, and pre-CMML conditions. The outcomes of this meeting are summarized herein and include diag nostic criteria and a proposed classification of pre-CMML conditions as well as refined minimal diagnostic criteria for classical CMML and special CMML variants, including oligomonocytic CMML and CMML associated with systemic mastocytosis. Moreover, we propose diagnostic standards and tools to distinguish between 'normal', pre-CMML and CMML entities. These criteria and standards should facilitate diagnostic and prognostic evaluations in daily practice and clinical studies in applied hematology.

Clonal architecture in patients with myelodysplastic syndromes and double or minor complex abnormalities: Detailed analysis of clonal composition, involved abnormalities, and prognostic significance.

The study analyzes the clonal architecture and the abnormalities involved in a series of 191 patients with myelodysplastic syndromes (MDS) and 2-3 clonal abnormalities. All patients were extracted from an international database. The patients were classified into six clonal subtypes (2A-3C) based on the number of abnormalities and the presentation of unrelated clones (UC) and/or a clonal evolution. UC were detected in 23/191 patients (12%). The composition of UC showed great variability. The only recurrent combination of abnormalities was del(5q) and + 8 in 8 of 23 patients (35%). In patients with clonal evolution, the clone size of the primary and secondary clone varied: Patients with -7 and + 8 in the primary clone showed a larger primary and a smaller secondary clone (-7: median 74% vs 10%; +8 73% vs 18%) while patients with del(5q) in the primary clone showed a smaller primary and a larger secondary clone (33% vs 61%). Univariate and multivariate analyses showed no significant differences regarding overall or AML-free survival between the clonal subtypes. Only the subtype 3C (3 abnormalities and clonal evolution) was an independent risk factor for developing AML (Hazard Ratio 5.5 as compared to subtype 2A, P < .05). Finally, our study confirms that the number of abnormalities clearly defines a significant risk factor for overall- as well as AML-free survival. Importantly, in patients with more than one clone, the calculation of the number of abnormalities in the entire sample instead of the number of abnormalities per clone allows a higher prognostic accuracy.

Dyserythropoiesis in the diagnosis of the myelodysplastic syndromes and other myeloid neoplasms: problem areas.

An evaluation of the significance of specified dyserythropoietic features in suspected myelodysplastic syndrome (MDS) and acute myeloid leukaemia with erythroid dysplasia was made by means of evaluation of 100 electronic images of bone marrow erythroblasts from each of 20 subjects: 11 with a myeloid neoplasm, six with another condition that could cause erythroid dysplasia and three healthy controls. The evaluation was carried out independently by seven experienced haematologists/haematopathologists who were blinded to the diagnosis. The majority of the dyserythropoietic features listed in the World Health Organization Classification of Tumours of Haematopoietic and Lymphoid Tissues were validated, although karyorrhexis was found to be infrequent and lacking in specificity; multinuclearity and megaloblastosis were more often observed but also lacked specificity. Good majority agreement on the identification of dysplastic features was obtained. Despite this, it was demonstrated that a reliable diagnosis of MDS can often not be made on the basis of erythroid morphology alone. Interpretation of dyserythropoiesis must be carried out with full knowledge of other clinicopathological features and with a constant awareness of the other conditions that can be confused with MDS. An iron stain is essential, as cases with ring sideroblasts may otherwise not be recognised as having MDS.

A 17-Gene Genomic Prostate Score Assay Provides Independent Information on Adverse Pathology in the Setting of Combined Multiparametric Magnetic Resonance Imaging Fusion Targeted and Systematic Prostate Biopsy.

PURPOSE: Multiparametric magnetic resonance imaging and biopsy based molecular tests such as the 17-gene Oncotype DX® Genomic Prostate Score™ assay are increasingly performed to improve risk stratification in men with clinically localized prostate cancer. The prostate score assay was previously shown to be a significant independent predictor of adverse pathology findings at radical prostatectomy in men diagnosed by systematic biopsies only. Therefore, we investigated the ability of the prostate score assay to predict adverse pathology findings in the setting of magnetic resonance imaging guided prostate biopsy. MATERIALS AND METHODS: We identified men diagnosed with NCCN® (National Comprehensive Cancer Network®) very low, low or intermediate risk prostate cancer who underwent simultaneous multiparametric magnetic resonance imaging fusion targeted and systematic prostate biopsy with subsequent radical prostatectomy within 6 months. Prostate score assay testing was performed on biopsy tissue with the highest Gleason score. The primary outcome of the study was adverse pathology findings, defined as Gleason score 4 + 3 or greater disease and/or pT3+ at radical prostatectomy. Independent predictors of adverse pathology findings were determined in a multivariable model to adjust for clinical parameters. RESULTS: A total of 134 men were eligible for primary analysis. On univariable analysis the UCLA score, magnetic resonance imaging, prostate score assay results and biopsy Gleason score were significant predictors of adverse pathology findings. After multivariable adjustment prostate score assay values remained a significant predictor of adverse pathology results (prostate score assay per 20 U OR 3.28, 95% CI 1.74-6.62, p <0.001). A wide and overlapping distribution of prostate score assay results was seen across PI-RADS® (Prostate Imaging Reporting and Data System) version 2 scores. CONCLUSIONS: The prostate score assay result is an independent predictor of adverse pathology findings in patients who were diagnosed with very low, low or intermediate risk prostate cancer in the setting of multiparametric magnetic resonance imaging fusion prostate biopsy. This assay can be useful as an independent technology or an adjunct technology to multiparametric magnetic resonance imaging to individualize risk stratification of low and intermediate risk prostate cancer.

Benefit of high-dose daunorubicin in AML induction extends across cytogenetic and molecular groups.

The initial report of the Eastern Cooperative Oncology Group-American College of Radiology Imaging Network Cancer Research Group trial E1900 (#NCT00049517) showed that induction therapy with high-dose (HD) daunorubicin (90 mg/m(2)) improved overall survival in adults <60 years old with acute myeloid leukemia (AML); however, at initial analysis, the benefit was restricted to younger patients (<50 years) and patients without unfavorable cytogenetics or aFLT3-ITD mutation. Here, we update the results of E1900 after longer follow-up (median, 80.1 months among survivors), focusing on the benefit of HD daunorubicin on common genetic subgroups. Compared with standard-dose daunorubicin (45 mg/m(2)), HD daunorubicin is associated with a hazard ratio (HR) for death of 0.74 (P= .001). Younger patients (<50 years) benefited from HD daunorubicin (HR, 0.66;P= .002), as did patients with favorable and intermediate cytogenetics (HR, 0.51;P= .03 and HR, 0.68;P= .01, respectively). Patients with unfavorable cytogenetics were shown to benefit from HD daunorubicin on multivariable analysis (adjusted HR, 0.66;P= .04). Patients with FLT3-ITD (24%),DNMT3A(24%), and NPM1(26%) mutant AML all benefited from HD daunorubicin (HR, 0.61,P= .009; HR, 0.62,P= .02; and HR, 0.50,P= .002; respectively). HD benefit was seen in the subgroup of older patients (50-60 years) with the FLT3-ITD or NPM1 mutation. Additionally, the presence of an NPM1 mutation confers a favorable prognosis only for patients receiving anthracycline dose intensification during induction.

Time-dependent changes in mortality and transformation risk in MDS.

In myelodysplastic syndromes (MDSs), the evolution of risk for disease progression or death has not been systematically investigated despite being crucial for correct interpretation of prognostic risk scores. In a multicenter retrospective study, we described changes in risk over time, the consequences for basal prognostic scores, and their potential clinical implications. Major MDS prognostic risk scoring systems and their constituent individual predictors were analyzed in 7212 primary untreated MDS patients from the International Working Group for Prognosis in MDS database. Changes in risk of mortality and of leukemic transformation over time from diagnosis were described. Hazards regarding mortality and acute myeloid leukemia transformation diminished over time from diagnosis in higher-risk MDS patients, whereas they remained stable in lower-risk patients. After approximately 3.5 years, hazards in the separate risk groups became similar and were essentially equivalent after 5 years. This fact led to loss of prognostic power of different scoring systems considered, which was more pronounced for survival. Inclusion of age resulted in increased initial prognostic power for survival and less attenuation in hazards. If needed for practicability in clinical management, the differing development of risks suggested a reasonable division into lower- and higher-risk MDS based on the IPSS-R at a cutoff of 3.5 points. Our data regarding time-dependent performance of prognostic scores reflect the disparate change of risks in MDS subpopulations. Lower-risk patients at diagnosis remain lower risk whereas initially high-risk patients demonstrate decreasing risk over time. This change of risk should be considered in clinical decision making.

Very poor long-term survival in past and more recent studies for relapsed AML patients: The ECOG-ACRIN experience.

This study examines the long-term OS of relapsed AML patients who were enrolled to 9 successive ECOG-ACRIN trials for newly diagnosed AML, during 1984-2008. The objectives were to examine whether there is a trend of improvement in the survival of relapsed AML patients in the more recent studies and to search for prognostic factors that are associated with long-term OS after relapse. A total of 3012 patients were enrolled, 1779 (59.1%) achieved CR1 and of these, 58.9% relapsed. The median follow-up was 9.7 years. The median OS from relapse was 0.5 years and the 5-year OS was 10 (±1)%. These results were similar even for the most recent studies. A multivariate model showed that age, cytogenetics at diagnosis, duration of CR1 and undergoing allogeneic transplantation were significantly associated with OS from relapse. Even among patients who relapsed with better prognostic factors; age < 40 and CR1 > 12 months, there was no significant OS difference between the studies. In conclusion, this large cohort appears to confirm that the survival of AML patients postrelapse continues to be dismal and has not improved during the past quarter of a century.

Spinal Arachnoiditis as a Complication of Cryptococcal Meningoencephalitis in Non-HIV Previously Healthy Adults.

BACKGROUND: Cryptococcus can cause meningoencephalitis (CM) among previously healthy non-HIV adults. Spinal arachnoiditis is under-recognized, since diagnosis is difficult with concomitant central nervous system (CNS) pathology. METHODS: We describe 6 cases of spinal arachnoiditis among 26 consecutively recruited CM patients with normal CD4 counts who achieved microbiologic control. We performed detailed neurological exams, cerebrospinal fluid (CSF) immunophenotyping and biomarker analysis before and after adjunctive immunomodulatory intervention with high dose pulse corticosteroids, affording causal inference into pathophysiology. RESULTS: All 6 exhibited severe lower motor neuron involvement in addition to cognitive changes and gait disturbances from meningoencephalitis. Spinal involvement was associated with asymmetric weakness and urinary retention. Diagnostic specificity was improved by MRI imaging which demonstrated lumbar spinal nerve root enhancement and clumping or lesions. Despite negative fungal cultures, CSF inflammatory biomarkers, sCD27 and sCD21, as well as the neuronal damage biomarker, neurofilament light chain (NFL), were elevated compared to healthy donor (HD) controls. Elevations in these biomarkers were associated with clinical symptoms and showed improvement with adjunctive high dose pulse corticosteroids. CONCLUSIONS: These data suggest that a post-infectious spinal arachnoiditis is an important complication of CM in previously healthy individuals, requiring heightened clinician awareness. Despite microbiological control, this syndrome causes significant pathology likely due to increased inflammation and may be amenable to suppressive therapeutics.