Molecular and phenotypic characterization of Agrobacterium species from vineyards allows identification of typical Agrobacterium vitis and atypical biovar 1 strains.

AIM: To molecularly and phenotypically characterize a selection of Agrobacterium-like isolates from grapevine canes, crowns, soil and tumours in plants grown under cold conditions. METHODS AND RESULTS: Most of the strains were biovar 3 (Agrobacterium vitis), and the remaining were atypical biovar 1 (Agrobacterium tumefaciens). All of them were tumourigenic on grapevine plants but differences in other hosts were observed. Chromosomal and plasmid-borne traits were analysed by gene amplification with four primer sets. Detection of the pectin enzyme hydrolase gene clearly distinguished A. vitis from the atypical A. tumefaciens. Regarding the virulence sensor gene, limited host range tumour-inducing plasmids were found in the atypical isolates. About opine utilization, most A. vitis and some A. tumefaciens contained octopine/cucumopine plasmids, but the nopaline-type was only detected in one A. tumefaciens. CONCLUSIONS: The A. vitis strains were molecularly and phenotypically more homogeneous than those of A. tumefaciens, the latter displaying some typical A. vitis characteristics, suggesting an adaptation to life in grapevine. SIGNIFICANCE AND IMPACT OF THE STUDY: The findings of this work will help to improve detection procedures of the pathogen, and demonstrate the pathogen diversity in cold vineyards, laying the groundwork for epidemiological studies and development of control strategies of the crown and cane gall disease.

First Report of Dickeya dianthicola Causing Blackleg on Potato (Solanum tuberosum) in Bulgaria.

Potato (Solanum tuberosum) is an important and widespread crop in Bulgaria. A new disease was observed on a single potato plot (Plovdiv region) without a history of potato cultivation in the spring of 2011. Initially, single lower leaves wilted on recently emerged plants (approx. 15% incidence) with subsequent desiccation of the leaf margins. The wilting progressed over time and eventually the whole stem became desiccated. A blackleg-like necrosis was noticed at the stem base when symptomatic plants were uprooted. Most diseased stems remained green above ground but pith tissue was heavily macerated and some of the stems became hollow as the pith dried out. Mother tubers were partially or entirely macerated. In most cases, the decay was initiated from the stolon end. Bacterial strains were obtained from symptomatic stems and tubers by dilution plating on King's B medium. The strains produced indigoidin pigment and induced a hypersensitive response 24 h after infiltration into tobacco and Sedum hybridum leaves (2). The strains were identified as Dickeya spp. by the production of the PCR amplicon of the pectate lyase ADE gene cluster (3) and of the pectate lyase I gene (4). The partial sequence of the fliC PCR amplicon (1) of strain SB2589 (GenBank Accession No. KF442436) displayed 100% homology with four whole genome shotgun sequences of Dickeya dianthicola in GenBank. Pectinolytic activity was demonstrated by inoculation of surface disinfested potato tubers of cv. Kondor. Conical core tissue was removed at the apical end and 100 µl bacterial suspension (107 CFU in sterile 10 mM phosphate buffer) was deposited in the cavity. The cap was reattached to the tuber and immobilized by Parafilm. Positive control tubers were inoculated with D. dianthicola reference strain GBBC 2039 (LMG 25864) and negative control tubers were inoculated with sterile 10 mM phosphate buffer. All tubers were incubated for 48 h at 28°C under micro-aerobic conditions reducing the air pressure to 90 mb in a vacuum incubator. The D. dianthicola reference strain and Bulgarian strains produced maceration of tuber tissue. Maceration was not observed in the negative control tubers. Potato plants cv. Kondor were grown from minitubers in sandy soil in plastic nursery containers. The plants were inoculated by root drenching (one application of cell suspension at 109 CFU/liter) when the stems were 15 to 20 cm high (tuber initiation stage). Plants were incubated at 25 to 28°C with regular watering. Wilting symptoms developed within 10 days of inoculation, followed by necrosis of the pith. Strains obtained from the inoculated stems were confirmed as D. dianthicola as described above. Based on the disease symptoms, the cultural, molecular, and pathological features of the strains, we conclude that the disease was caused by D. dianthicola and to our knowledge this is the first report of the pathogen on potato in Bulgaria. Furthermore, this incident warrants further surveys of pectinolytic bacteria causing blackleg-like symptoms in potato crops in Bulgaria. References: (1) S. Diallo et al. Eur. J. Plant Pathol. 125:349, 2009. (2) Y-.A. Lee and C-.P. Yu. J. Microbiol. Methods 64:200, 2006. (3) A. Nassar et al. Appl. Environ. Microbiol. 62:2228, 1996. (4) J. Van Vaerenbergh et al. PLoS ONE 7(5):e35738, 2012.

First Report of Candidatus Phytoplasma solani on Blackberry (Rubus fruticosus) in Bulgaria.

While performing a routine field survey on 2-year-old canes of Rubus fruticosus (cv. Evergreen Thornless) in the region of Plovdiv (central southern Bulgaria), severe stunting of single or grouped plants (3 to 4 in a row) was found in late August of 2009. It was noteworthy that the leaves of these plants were curved upwards and stayed green until the end of the season. The bushy aspect of the diseased plants led to the assumption of a phytoplasma origin; therefore, specific PCR and sequence based identification methods were applied on leaves, petioles, and stems from three infected Rubus plants grown in different rows of the field (midsummer, nine samples in total) and the same number of asymptomatic samples. Partial amplification of the 16S ribosomal RNA gene with generic phytoplasma primer pairs P1/P7 and fu5/ru3 (3), followed by a nested PCR specific for all members of the Phytoplasma stolbur subgroup by means of the stol11 primers (1), and an RFLP analysis of the tuf gene (elongation factor Tu) fragment produced with PCR primers tufAY/r tufAY (3), were used for the identification and characterization of the pathogen. All target amplicons were also sequenced by Macrogen (Seoul, South Korea) following gel purification (Nucleospoin Plant II, Macher-Nagel). Identical sequences were obtained from each of the P1/P7-derived amplicons (100% homology between samples) and a consensus 1,142 bp sequence was delineated and submitted to NCBI GenBank with accession no. JF293091. It had the highest similarity (99 to 100%) to sequences of 'Bois noir' phytoplasma (e.g. HQ589193; Candidatus Phytoplasma solani, position 29 to 1,171). The fu5/ru3 amplicons produced sequences that showed 99.5% homology to the Ca. Phytoplasma solani strains of a southern Russian and Romanian phytoplasma survey on different hosts (potato, tomato, Convolvulus) (GenBank Accession No. HM449999 to HM4450002). The stolbur specific primers also produced an amplicon in all samples and again the consensus sequence was identified (100% homology between the samples) and deposited in GenBank (JN561701). RFLP analysis of the tuf gene with the enzymes HindIII, HinfI, HpaII, and TaqI (Fermentas) produced the same profile types for the different samples and clearly allocated the phytoplasma in the tuf type-b (VKII), according to (2). This type is commonly reported as associated with bindweed (Convolvulus arvensis). Additionally, the sequenced tufAY fragment also confirmed a 100% correspondence with the submitted Tu elongation factor fragments of Ca. Phytoplasma solani strains in GenBank. No phytoplasma was detected in symptomless blackberry plants that were sampled from the same plot. In the molecular identification tests, a stolbur phytoplasma control (potato isolate), a Rubus stunt (EY subgroup, 16SrV) and an apple proliferation phytoplasma (AP subgroup, 16SrX) were used as controls. Based on the symptoms and the laboratory results, we concluded that the Rubus plants were infected by Ca. Phytoplasma solani, a species belonging to the stolbur subgroup (16SrXII-A). To our knowledge, this is the first report of Ca. Phytoplasma solani on Rubus fruticosus in Bulgaria. The disease is not likely to be an isolated case in the future because of the pathogen's spread on other hosts and the expected increase in blackberry fields. References: (1) X. Daire et al. Eur. J. Plant Pathol. 103:507, 1997. (2) M. Langer and M. Maixner. Vitis 43:191, 2004. (3) K.-H. Lorenz et al. Phytopathology 85:771, 1995.

First Report of Freesia sneak virus Associated with Foliar Necrosis of Freesia refracta in Bulgaria.

In the early spring of 2011 and 2012, severe necrotic leaf symptoms were observed on freesia (Freesia refracta, family Iridaceae) in several greenhouses around Plovdiv (south central Bulgaria). The disease spread and symptom severity in several cultivars (Medeo, Calvados, and Pink Fountain) led to nearly complete production failure for some growers. Initial symptoms consisted of scattered pale, chlorotic, interveinal lesions that coalesced. Later, irregular brown to black necrotic blotches partially covered the leaves. Flower break was also observed. Diseased plants were collected in late April 2012 from one of the surveyed greenhouses, where >90% of Medeo (white-flowered) and 35 to 40% of Pink Fountain (pink) plants were symptomatic. Total RNA was extracted from three pooled samples of ~10 plants each and analyzed for Freesia sneak virus (3) (FreSV, Ophiovirus, Ophioviridae) infection by RT-PCR. A generic Ophiovirus RT-PCR (4) yielded the diagnostic 136-bp product, while primers FOV1 (TGCTCGAATAGCCGGAACTGAA) and FOV2 (TGCTTCCAGGTGTAAGATGGCA), designed from the Italian FreSV coat protein gene (RNA3; GenBank DQ885455), specifically amplified a 466 bp fragment. This FreSV-specific fragment was amplified from all samples, pooled, purified, and subjected to direct sequencing using the same primers. The deduced amino acid sequence had 99.8% identity to that of DQ885455, confirming FreSV infection in the symptomatic Bulgarian freesias. FreSV RNA3 (about 1.5 kbp) was also detected by northern blotting using a specific Digoxigenin-DNA probe (PCR-DIG Probe Synthesis Kit, Roche) amplified with primers FOV1/2. Due to severe symptoms present on freesias, a mixed infection was suspected. Several other viruses have been reported to infect cultivated freesia (1), so diagnostic primers for Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae), Tobacco rattle virus (TRV, Tobravirus, Virgaviridae), and Potyvirus genus (4) were used in RT-PCR assays with random-primed cDNA from infected freesias as the template. No CMV or TRV PCR products were detected; a generic potyvirus PCR product was identified as Freesia mosaic virus (FreMV, Potyvirus, Potyviridae) by sequencing of five independent clones. Severe leaf necrosis syndrome was described in freesia in The Netherlands before 1970, as well as in England and Germany; FreSV is a putative agent of freesia leaf necrosis, being reported in strong association with the disease in Italy, The Netherlands, the United States, and New Zealand, and also infects Lachenalia hyb. (Hyacinthaceae) (2,3,4). However, additional unidentified synergistic viral agents cannot be ruled out and must be identified to aid control of soilborne severe leaf necrosis syndrome. The vector of FreSV, Olpidium brassicae, may persist in soil for years (3). To our knowledge, this is the first report of FreSV on F. refracta in Bulgaria; identifying the disease and vector may allow growers to implement preventive control measures to reduce economic damage. References: (1) A. A. Brunt. In: Virus and Virus-Like Diseases of Flower Crops, pp. 274-280, Wiley, 1995. (2) M. N. Pearson et al. Austr. Plant Path. 38:305, 2009. (3) A. M. Vaira and R. G Milne. In: Encyclopedia of Virology, III ed., vol. 3, pp. 447-454, Elsevier, 2008. (4) A. M. Vaira et al. Plant Dis. 93:965, 2009.

First Report of Cercospora beticola as a Pathogen of German Statice (Goniolimon tataricum) in Bulgaria.

German statice (Goniolimon tataricum) is a protected, herbaceous, perennial plant species that occurs sporadically throughout Bulgaria. Some varieties, however, are cultivated outdoors because of their dry flowers, which are widely utilized by florists. For the past 3 years, a severe leaf disease has been observed on the lower and middle leaves of German statice plants growing in fields in the region of Plovdiv, Bulgaria. Symptoms consisted of brown, round to elliptical leaf spots (as much as 15 mm in diameter) that led to leaf yellowing and death. Similar sunken lesions were also observed on leaf petioles and flower bases. A cercosporoid fungus was consistently associated with disease symptoms. Conidiophores were fasciculate, unbranched, brown, and smooth. Conidiogenous cells were predominantly terminal, but also lateral, and had darkened, thickened, refractive scars. Conidia were solitary, hyaline, smooth, acicular, slightly curved, multiseptate, with subtruncate bases and acutely rounded apices, 30 to 105 × 2.5 to 4 (average 64.5 × 3.5) µm, in vivo (n = 30), with thickened, darkened, refractive hila. Colonies derived from single conidial isolates were established on potato dextrose agar (PDA). To confirm Koch's postulates, colonized mycelial plugs (5 mm in diameter) from 10-day-old PDA cultures were used to inoculate 3-month-old German statice pot plants (three replicates per treatment, three leaves per plant). Control plants were inoculated with uncolonized agar plugs. Healthy leaves were surface disinfested with 70% ethanol, wounded with a sterile needle, and covered with an agar plug. Inoculated plants were incubated at 20°C in a humidified chamber with a 12-h day/night light cycle. Eight to ten days after inoculation, small necrotic lesions developed around the points of inoculation, leading to necrosis and lesions (8 to 10 mm in diameter). The pathogen was successfully reisolated from all inoculated leaves, while control plants remained healthy. Five isolates (CPC 14616-14620) were subjected to multilocus sequence typing as described by Groenewald et al. (1) and the ITS, translation elongation factor 1-alpha, actin, calmodulin, and histone H3 gene sequences (GenBank Accession Nos. FJ473422-FJ473446) were found to be identical to that of the ex-type strain of Cercospora beticola Sacc. (GenBank Accession Nos. AY840527, AY840494, AY840458, AY840425 and AY840392, respectively). Two strains from Goniolimon were deposited in the CBS Fungal Biodiversity Centre in the Netherlands (CBS 123907 and 123908). To our knowledge, this is the first report of C. beticola occurring on and being destructive to Goniolimon tataricum under field conditions. Reference: (1) M. Groenewald et al. Phytopathology 95:951, 2005.

First Report of Phytophthora citricola on Cornus mas in Bulgaria.

Cornelian cherry dogwood (Cornus mas) is a widespread species in Bulgaria and some cultivars with large fruits are the subject of propagation. In the springs of 2007 and 2008, severe, unusual damages were observed on sporadically scattered plantlets of 'Kazanlashki' (known also as 'Kazanlaker') in a nursery located near Vratza in northwestern Bulgaria. Symptoms were identical in both years and expressed on the leaves, young shoots, and adjacent rootstock wood. Dark brown, necrotic leaf spots initiated most often from the leaf periphery and quickly covered more than half of the leaf area. Necrosis of the leaves and shoots spread toward the older woody tissues and the plantlets died within a couple of weeks. Isolations from symptomatic leaves, shoots, and rootstocks (three to five samples per plant organ) on potato dextrose agar always revealed a fungus-like organism that formed relatively fast-growing white, radial, petaloid colonies. Numerous, ovoid to obpyriform, noncaducous, semipapillate sporangia occasionally with two papilla were observed after 1 or 2 days of incubation at 20°C in nonsterile soil extract (1). Average sporangium size was 39 (35 to 45) × 31 (20 to 35) µm with a ratio between both parameters of approximately 1.26. The pathogen's paragynous antheridia and smooth-walled spherical oogonia (20 to 32 µm in diameter) yielded spherical aplerotic to almost plerotic oospores on V8 medium with an average size of 25 µm. The morphological data identified the organism as Phytophthora citricola (1). Isolates had identical cultural and morphological characteristics, and pathogenicity was tested by laboratory inoculations carried out in 2007 (two isolates) and twice in 2008 (three isolates). Separately, detached leaves of C. mas seedlings and 'Kazanlashki' were wiped with 70% ethanol, punctured with a needle, and the wounds inoculated with 5-mm mycelial plugs from a 7-day-old V8 growth plate. Sterile V8 plugs were placed onto similar wounds of control leaves. Leaf samples were incubated at 20°C in a humidified chamber. Necrosis similar to that observed in the field became visible around the mycelia plugs 4 days after inoculation. The necrotic lesions enlarged to 20 to 25 mm in diameter within the next 2 days, whereas the control leaves did not show any symptoms. Subsequently, the pathogen was reisolated solely from all the mycelium-inoculated samples. By means of the same inoculation method, pathogenicity was also demonstrated on shoots and mature fruits of C. mas. DNA was isolated from mycelium of an isolate and the internal transcribed spacer (ITS) region was amplified using ITS6 and ITS4 primers. The PCR product was sequenced (GenBank Accession No. FJ269034) and the BLAST search showed 100% homology with P. citricola, type II (2). To our knowledge, this is the first report of P. citricola on C. mas in Bulgaria, thus confirming its ability to attack Cornus spp. (3). Taking the lethal results of the disease and the polyphagous nature of the causal agent into consideration, this report is a serious warning for nurserymen and consumers. References: (1) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996. (2) M. E. Gallegly and C. X. Hong. Phytophthora: Identifying Species by Morphology and DNA Fingerprints. The American Phytopathological Society, St. Paul, MN, 2008. (3) F. N. Martin and P. W. Tooley. Mycologia 95:269, 2003.

First Report of Phytophthora nicotianae on German Statice in Bulgaria.

In June of 2008, rapidly developing necrotic symptoms were observed on 2-month-old seedlings of German statice (Goniolimon tataricum, synonym Limonium tataricum) that were started from field-collected seeds and grown in plastic pots under greenhouse conditions in the region of Plovdiv, Bulgaria. Initial symptoms were slight yellowing and wilting of single, lower leaves. Subsequently, necrosis affected several petioles and stem bases, which led to complete plant collapse. Isolations from symptomatic petioles, stem bases, and main roots were performed on potato dextrose agar (PDA) and corn meal agar (CMA). When incubated at 24 to 25°C, white, round, arachnoid colonies with fluffy aerial mycelium developed on the PDA isolation plates, whereas the mycelium was less dense on CMA. Sporangia were formed sporadically when cultures were maintained on V8 medium and formed abundantly in nonsterile soil extract after 1 to 2 days of incubation at 20°C. Sporangia were noncaducous, ovoid to spherical, semipapillate (sometimes with two papilla), measured 47.5 to 65 µm (average 53.6 µm) × 35 to 53.5 µm (average 42.9 µm) with an average length/width ratio of 1.25:1. Terminal and intercalary chlamydospores (25 to 48 µm in diameter; average 37 µm) and hyphal swellings were also present. Maximum temperature for growth was 36°C. Pathogenicity of the presumable Phytophthora nicotianae (1) isolate was proved by placing 5-mm-diameter mycelial plugs of 7-day-old cultures grown on V8 medium onto the petiole bases of three 3-month-old G. tataricum plantlets. Each inoculation site was first wiped with 70% ethanol and then scalpel wounded. Sterile V8 plugs were used as controls and all inoculated sites were wrapped with Parafilm. The plantlets were incubated at room temperature (22 to 26°C) and the first necrotic lesions around the mycelial plugs appeared 5 to 7 days after inoculation. Plantlets collapsed approximately 2 weeks later. Additionally, three plantlets were inoculated under the same conditions by watering their stem bases with a 15-ml suspension of mycelium and spores obtained by washing 2-week-old V8 cultures with sterile distilled water. Within a 4-week period, the plantlets died due to a stem base and petiole necrosis. Simultaneously, the pathogen was reisolated from all inoculated samples but not from any control plants that were symptomless. The internal transcribed spacer (ITS) region of mycelial DNA was amplified (ITS6 and ITS4 primers) and the PCR product was sequenced (GenBank Accession No. FJ410333). BLAST analysis showed 100% homology with P. nicotianae. To our knowledge, this is the first report of P. nicotianae on G. tataricum in Bulgaria and one of the few reports from Europe of Phytophthora invasion of related Limonium species (2,3). References: (1) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996. (2) E. Ilieva et al. Plant Dis. 85:445, 2001. (3) A. Pane et al. J. Plant Pathol. 87:301, 2005.

First Report of Anthracnose Caused by Colletotrichum dematium on Statice (Goniolimon tataricum, Synonym Limonium tataricum) in Bulgaria.

German statice (Goniolimon tataricum, synonym Limonium tataricum) is a popular ornamental species, which is frequently used in bouquet arrangements. During a field survey of statice farms in the Plovdiv Region of Bulgaria (August 2007), lesions were observed predominantly on the peduncles and rarely on wilted leaves of 2- and 3-year-old plants. Symptoms appeared on the base of peduncles as irregular, brown necrotic lesions ranging from 30 to 40 mm that coalesced, whereas lesions on leaves were initially round to elliptical with dimensions from 5 to 15 mm and developed a necrosis that subsequently spread toward the petioles. Rounded and elongated setose acervuli were observed on the lesions of peduncles. Isolations on potato dextrose agar (PDA) produced fungal colonies that initially were whitish but turned gray 4 to 5 days after incubation at 25°C. Falcate, hyaline, and aseptate conidia with mean dimensions of 22.0 × 4.5 µm, ranging from 18.3 to 25.0 × 4.2 to 5.8 µm, were observed from acervuli of both naturally infected peduncles and PDA-cultured colonies. Pathogenicity of the fungus (three single-conidium representative isolates) was tested by spray inoculating 4-month-old intact plantlets (12 to 15 fully developed leaf stage) with a conidial suspension (106 conidia/ml, 15 ml/plant) and maintaining them in a humidity chamber for 30 h. Plants sprayed with sterile water served as controls. There were three replicates per treatment per isolate and the experiment was conducted twice at room temperature (22 to 26°C). After 10 to 12 days, the spray-inoculated plants exhibited light brown lesions mainly on the older leaves that gradually expanded and caused leaf mortality. The pathogen was reisolated from all inoculated samples but not from any of the control and symptomless treatments, thus fulfilling Koch's postulates. It should be noted that symptoms caused by the pathogen in artificially inoculated plants were seen as wilting of petioles and leaves, as opposed to necrotic lesions observed on leaves under field conditions. This may be related to the method of inoculation, leaf age, and texture, as well as environmental factors affecting symptomology under natural field conditions. Sequence analysis of the rDNA internal transcribed spacer region of three representative isolates (GenBank Accession Nos. FJ236461-FJ236463) showed the fungus to be 99% similar to an isolate of Colletotrichum dematium (GenBank Accession No. AJ301954), consistent with the observed morphological characters. On the basis of observed symptoms, morphology, and molecular characterization, it can be concluded that C. dematium is the causal agent of anthracnose of German statice in Bulgaria. To our knowledge, this is the first report of this pathogen on G. tataricum in Bulgaria, although it has been reported that C. dematium (1) and C. gloeosporioides (1-3) may attack other Limonium species. References: (1) C. F. Hong et al. Plant Pathol. Bull. 15:241, 2006. (2) T. Kagiwata. J. Agric. Sci. (Jpn.) 31:101, 1986. (3) M. Maymon et al. Phytopathology 96:542, 2006.

First Report of Phytophthora Stem Rot on Gloxinia in Bulgaria.

Severe stem base necrosis was observed on potted gloxinia (Sinningia speciosa) plants in a greenhouse in the Plovdiv Region of Bulgaria in the spring of 2006 and sporadically in 2007. Initial symptoms were water-soaked lesions at the stem base; eventually the lesions spread upward and downward until the entire stem was affected, resulting in withered leaves and plant collapse. Disease foci were sometimes apparent in rows of plants because of water splash. White, fungal-like colonies with arachnoid, aerial mycelia were obtained from affected plant tissue placed on potato dextrose agar (PDA) at 24 to 25°C in the dark. Pyriform to ellipsoid sporangia, 30 to 55 × 23 to 40 µm (average 38 × 27 µm), with a prominent papilla (sometimes two) and a short pedicel were observed. Chlamydospores were intercalary or terminal, spherical, and 15 to 55 µm in diameter. Oogonia and antheridia were not observed. On the basis of morphological features, the pathogen was tentatively identified as Phytophthora nicotianae (2). Pathogenicity was tested by placing 3-mm-diameter discs from 7-day-old PDA cultures onto wounded petioles of visibly healthy 3-month-old gloxinia potted plants (three replicates). Sterile PDA plugs were placed onto similar wounds of three control plants. The inoculated wounds were covered with Parafilm. Three days after inoculation, water-soaked lesions began to spread longitudinally in both directions on inoculated petioles. The pathogen was recovered from the inoculated tissue but not from the control plants. Molecular identification of the pathogen was achieved with PCR-restriction fragment length polymorphism of the internal transcribed spacer regions ITS1 and ITS2 of the ribosomal DNA (1). The restriction patterns obtained with the enzymes AluI, MspI, and TaqIα were identical to those of P. nicotianae, confirming the morphological identification. To our knowledge, this is the first report of P. nicotianae on gloxinia in Bulgaria. References: (1) D. E. L. Cooke and J. M. Duncan. Mycol. Res. 101:667, 1997. (2) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996.

First Report of Diplodia seriata Causing Shoot Blight and Cankers of Cotoneaster salicifolius in Bulgaria.

Shoot and branch blight was observed on shrubs of Cotoneaster salicifolius in the region of Plovdiv, Bulgaria in autumn and winter surveys during 2005 and 2006. Scattered pycnida were found on the withered branches, which bore sunken cankers with marginal bark cracks. Fungal colonies obtained from affected host tissue developed on potato dextrose agar (PDA) at 24 to 25°C in the dark. Colonies grew rapidly, were floccose, initially white, becoming grayish brown, and finally went from gray to black. Dark brown, unilocular pycnida formed after 2 to 3 weeks in culture. Conidia that formed at the tips of cylindrical, percurrently, proliferating, conidiogenous cells were ovoid, straight, pale brown to dark brown, internally verruculose, aseptate or occasionally with a single median septum. The mean conidial dimensions were 20 × 12 µm, the extreme range was 15 to 25 × 11 to 15 µm. These characters correspond to Diplodia seriata De Not., which is the anamorph of "Botryosphaeria" obtusa (2). Identity was confirmed from the nucleotide sequences of the internal transcribed spacer (ITS) from the rRNA repeat as described elsewhere (1). BLAST searches in GenBank showed 100% identity of isolates with reference sequences of D. seriata including that from the ex-epitype culture. The ITS sequence of a representative isolate (CAP337) has been deposited in GenBank (Accession No. EU483658). Pathogenicity was tested by inserting 3-mm-diameter mycelia plugs from 7-day-old PDA cultures into scalpel-wounded mature apple fruits (cv. Granny Smith) and wounded shoots of C. salicifolius. Sterile PDA plugs were placed into similarly made wounds of control specimens. There were three replicates for each treatment and the inoculated wounds were subsequently covered with Parafilm. Small necrotic lesions occurred on the apple fruits 3 to 5 days after inoculation and after 10 to 12 days on the shoots. Within 4 to 5 weeks, all apple fruits were entirely rotten, shrunken, and covered with pycnida, whereas the shoots withered and typical blight symptoms developed above the inoculation sites. The pathogen was reisolated from all inoculated samples but not from any control treatment. To our knowledge, this is the first report of D. seriata on C. salicifolius in Bulgaria. It is likely that this pathogen will be found increasingly more frequently because of the intensive introduction of decorative Rosaceae species into urban districts. References: (1) A. Alves et al. Mycologia 96:598, 2004. (2) A. J. L. Phillips et al. Fungal Divers. 25:141, 2007.

First Report of Colletotrichum dracaenophilum on Dracaena sanderiana in Bulgaria.

In the winter of 2007, severe damage was observed on numerous indoor potted plants of Dracaena sanderiana hort. Sander ex Mast. ("lucky bamboo") in Plovdiv, Bulgaria, which were imported from a country of unknown origin. These plants were already in the retail distribution stream. Initially, the internodes of infected stems appeared pale green with yellowish lesions. An upward spreading necrosis led to a weakness of the stems with wilt and death of the plants occurring within 2 weeks. Eventually, entire stems were covered with numerous, black, globose-to-ellipsoid acervuli with sparse, black setae. The fungus was aseptically isolated from stem lesions on potato dextrose agar (PDA) on which it produced fast-growing, pale pink colonies. On the plant and in culture, the conidia were hyaline, broadly clavate to cylindrical, occasionally slightly curved, and measured 20 to 34 × 6.7 to 10.0 µm (average 28 × 8.5 µm). On the basis of the symptoms on the plant and morphological, cultural, and molecular characteristics, the fungus was identified as Colletotrichum dracaenophilum D.F. Farr & M.E. Palm (1). Pathogenicity of the fungus was confirmed by artificial inoculation of healthy plants of D. sanderiana (three replicates). Stems were inoculated by inserting small mycelial plugs from 7-day-old PDA cultures into wounds that were subsequently covered with Parafilm strips. After 2 weeks, pale green lesions started developing on all inoculated plants and the fungus was successfully reisolated. No symptoms were found around the pure agar control wounds. The specimen from Bulgaria was deposited in the U.S. National Fungus Collections (BPI 877337) with the derived culture deposited as CBS 121453. In addition, the internal transcribed spacer region of the nrDNA of this isolate was sequenced and deposited as GenBank Accession No. EU003533. To our knowledge, this is the first report of C. dracaenophilum on potted plants outside of China and is the first report of this species in Bulgaria. Reference: (1) D. F. Farr et al. Mycol. Res. 110:1395, 2006.

First Record of Bacterial Blight Caused by Pseudomonas syringae pv. syringae on Pyracantha coccinea and an Amelanchier sp. in Bulgaria.

During the spring and summer months of 2004 and 2005, sporadic damage on individual shrubs of Pyracantha coccinea and an Amelanchier sp. were observed at two locations in the region of Plovdiv, Bulgaria. Symptoms initially were expressed as blossom blight and subsequently expanded to the shoots and branches, forming cankers on the supplying wood. In both years, a fluorescent gram-negative bacterium was isolated from diseased tissues onto King's B medium. The bacterial strains were levan positive and oxidase and arginine dihydrolase negative. They were able to induce a typical hypersensitive response on tobacco plants (cv. Samsun), but failed to rot potato slices. Pathogenicity of the strains was confirmed by puncture-inoculating detached shoots from both hosts and immature cherry and pear fruits with a bacterial suspension (108 CFU/ml, 50 µl per wound, and 3 replicates). Controls were punctured with sterile water. The inoculated plant material was maintained at room temperature (22 to 25°C) in plastic pots and covered with polyethylene bags for the first 48 h after inoculation. The inoculated and control subjects were kept under the same conditions as before inoculation. Except for the controls, slowly expanding but well defined necrotic lesions around the inoculation points were observed within the next 5 to 7 days. Bacteria reisolated from symptomatic tissue were identical to the initial cultures. On the basis of the symptoms and results from all laboratory tests, the bacterium was considered to be Pseudomonas syringae pv. syringae (1). PCR amplification of the 752-bp syrB fragment (2) confirmed the identification. To our knowledge, this is the first occurrence of P. syringae pv. syringae on Pyracantha coccinea and an Amelanchier sp. in Bulgaria, and most probably, this pathogen will play a more significant role within the rosaceous group because of a rising number of the cultivated ornamental species. References: (1) N. W. Schaad et al., eds. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (2) K. N. Sorensen et al. Appl. Environ. Microbiol. 64:226, 1998.

First Report of Anthracnose Fruit Rot Caused by Colletotrichum acutatum on Pepper and Tomato in Bulgaria.

In the late summer of 2005, sporadic and unusual damage was observed on pepper (Capsicum annuum cv. Kurtovska kapia and local cv. Ribka) on two farms and tomato (Lycopersicon esculentum cv. Florida 47) fruits on one farm in the Plovdiv Region of Bulgaria. Dry, round, sunken zones (10 to 20 mm) were observed on pepper fruits that preserved their natural skin color even after black acervuli containing orange masses of conidia appeared. Eventually, the lesions turned brown, coalesced, and the fruits mummified on the plants. Tomato fruits developed similar symptoms, with less prominent discoloration and fewer acervuli. The pathogen was easily isolated from both hosts on potato dextrose agar where it formed white-to-gray colonies with salmon orange pigmentation on the reverse side of the plates. Conidia that formed were hyaline, fusiform, aseptate, and measured 13.3 to 17.4 × 3.5 to 5.5 µm and 11.6 to 15.5 × 4.1 to 5.0 µm for pepper and tomato isolates, respectively. Both cultural and morphological characteristics of the isolates were similar to those described for Colletotrichum acutatum (3). Koch's postulates were performed with two representative isolates from each host by artificial inoculation of healthy, green pepper and ripe tomato fruits from the respective cultivars. Fruits were wound inoculated with a sterile scalpel, and small agar plugs (3 to 4 mm) containing 7-day-old sporulating cultures were placed on each wound (five fruits per isolate), or by pipette tip-pricking and pipetting a 5-µl droplet of a conidial suspension (5 × 106 conidia ml-1) on each wound. The same number of wounded, noninoculated fruits was used as a control. Fruits were maintained in a humidity chamber at 22 to 25°C, and 4 days later, sunken necrotic zones were observed around the wounds of inoculated fruit, whereas control fruits remained symptomless. The pathogen was subsequently reisolated from the inoculated diseased tissues but not from the control fruits. Species-specific PCR (using primer pair CaInt2/ITS4) (2,4) of genomic DNA from three representative isolates (two from pepper and one from tomato) resulted in an amplification product of 490 bp, specific for C. acutatum, further confirming the identity of the pathogen. To our knowledge, this is the second report of C. acutatum in Bulgaria (1), and the first occurrence of that agent on tomato and pepper in this country. References: (1) S. G. Bobev et al. Plant Dis. 86:1178, 2002. (2) S. Freeman et al. Phytopathology 91:586, 2001. (3) P. S. Gunnell and W. D. Gubler. Mycologia 84:157, 1992. (4) M. L. Lewis Ivey et al. Plant Dis. 88:1198, 2004.

First Report of Fire Blight on Pyrus elaeagrifolia and Amelanchier sp. in Bulgaria.

In 2005, a fire blight epidemic occurred for the second time within the last 3 years, and severe damages were observed on pome fruits trees in many regions of Bulgaria. For the first time, we found fire blight on Pyrus elaeagrifolia and Amelanchier sp. grown in a park area (Plovdiv Region), providing evidence of continuing spread of the pathogen in Bulgaria. The symptoms on P. elaeagrifolia were necrotic, immature fruitlets and progressive necrosis toward the adjacent branches, thus forming cankers and leading to death of the plant above the canker. Many Amelanchier sp. shrubs had severely blighted flowers, fruitlets, shoots, and branches and dried, amber ooze droplets on the shoots. All the isolations made from blighted hosts' shoots and cankers on King's medium B (2 to 3 days, 26 to 27°C) yielded whitish, glistening, round bacterial colonies. Infiltration of the suspensions of randomized isolates from both hosts into tobacco leaves resulted in a typical hypersensitive reaction. Subsequently, some strains showed a typical ooze production on immature pear fruits (cv. Conference) and were also successfully reisolated from artificially inoculated quince shoots (1.2 × 109 CFU, cv. Portugalska, three replicates), where typical fire blight symptoms were observed, thereby fulfilling Koch's postulates. No symptoms or bacteria were found within any of the shoots from the same plant species injected with sterile water. The identity of the isolates was confirmed as Erwinia amylovora by an antibody-based slide agglutination test (Neogen_Express; Neogen Europe, Ltd., UK) and PCR test with primers derived from the ams region (1). On the basis of the symptoms, cultural characteristics, and positive results in pathogenicity, serological, and PCR tests, the isolates were considered to be E. amylovora. To our knowledge, this is the first report of fire blight on P. elaeagrifolia and Amelanchier sp. in Bulgaria. Reference: (1) S. Bereswill et al. Appl. Environ. Microbiol. 61:2636, 1995.

First Report of White Rust Caused by Albugo tragopogonis on Sunflower in Belgium.

Sunflower (Helianthus annuus) is widely used for cut flowers and decoration in Belgium. A serious outbreak of what was suspected to be white rust on sunflower was observed in an East Flemish nursery near the city of Ghent in August 2004. This disease has previously been reported in Europe (southwest of France) (1) and other parts of the world with losses as much as 70 to 80% (Australia, North and South America, and Africa) (2,3). In the Flemish nursery, only single diseased plants (cv. Sunrich) were found. Blister-like pustules containing sporangia were observed on infected leaves. Initially the blisters were pale green to yellow on the abaxial surface and white on the adaxial surface of the leaves. As the disease progressed, white pustules that formed on the adaxial surface of the leaves slowly turned yellow, and the blisters on the abaxial surface became yellow to orange and necrotic in the center. Finally, the pustules coalesced and the leaves withered. Stem lesions were not observed. Short, cylindrical to spherical-cuboid sporangia, recovered from the pustules on the adaxial surface of leaves, measured between 17.5 and 22.5 µm, with an average of 20.2 µm. Sporangial dimensions were similar to those of Albugo tragopogonis (Pers.) S.F. Gray (1). Inoculations were done by spraying a suspension of 1 × 105 sporangia per ml prepared by scraping pustules from naturally infected leaves. Leaves on three 2-month-old healthy plants were sprayed with this inoculum and three plants sprayed with distilled water served as controls. The plants were kept for 48 h under a humid chamber and subsequently at room temperature (20 to 25°C) on the laboratory bench. Initial symptoms of white rust were observed 12 to 14 days after inoculation. On the basis of symptoms, morphological characteristics, and pathogenicity tests, the pathogen was identified as A. tragopogonis. To our knowledge, this is the first record of A. tragopogonis on H. annuus in Belgium. References: (1) K. G. Mukerji. Description of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, England, UK, 1976. (2) A. Pernaud and A. Perny, Phytoma 471:43, 1995. (3) P. S. van Wyk et al. Helia 22:83, 1999.

First Report of Leaf Spots on Laurus nobilis Caused by Phytophthora citricola in Belgium.

Laurus nobilis (laurel tree) is used as an herbal and ornamental tree in gardens in Belgium. During the summer of 2001, a serious outbreak of leaf spots was observed in some Belgian nurseries. Symptoms were large, irregular, brown leaf spots located primarily on the distal half of leaves and delimited by a black margin. As the disease progressed, the spots enlarged, coalesced, and finally led to leaf withering. The isolated fungus had morphological characteristics typical of Phytophthora citricola. On potato dextrose agar (PDA) it formed white, entire rosette colonies. Within 1 week, semipapillate sporangia were found abundantly in water at room temperature. They were mostly ovoid and highly variable in size (20 to 82 × 12 to 48 µm). The sporangial apex was broadly papillate. Oogonia were spherical (18 to 38 µm in diameter), and the antheridia were paragynous. Pathogenicity of the isolated fungus was confirmed by inoculating two visibly healthy L. nobilis plants. Five leaves per plant were wounded by a scalpel, subsequently inoculated with 5-mm-diameter mycelial plugs on PDA, and sealed with Parafilm. As a control, noncolonized agar plugs were placed on wounded leaves from a third L. nobilis plant. The inoculated plants and the control plant were kept for 1 day under a plastic cover (approximately 95% relative humidity) on the laboratory bench. Within 1 week, all inoculated leaves developed symptoms, whereas the control leaves remained symptomless. P. citricola was sucessfully re-isolated, satisfying Koch's postulates. The pathogen was also characterized using molecular tools. The ribosomal DNA regions, ITS1 and 5.8S rDNA-ITS2, were sequenced and highest similarity scores were obtained with corresponding Phytophthora citricola sequence regions (>99% identity for both sequences). The new GenBank Accession Nos. are AY525786 (ITS1) and AY525787 (5.8S rDNA-ITS2). On the basis of the symptoms, cultural and morphological characteristics, and positive results in pathogenicity and PCR tests, the isolate was considered to be P. citricola. To our knowledge, this is the first record of P. citricola on leaves of L. nobilis in Belgium.

First Report of Colletotrichum acutatum on Strawberry in Bulgaria.

Recently, there has been increasing interest in growing strawberries (Fragaria × ananassa) in Bulgaria. During the spring seasons of 2001 and 2002, progressive fruit damage in some producers' plots was observed in the Plovdiv Region. Appearance and development of symptoms were typical of anthracnose on aboveground plant structures. On immature fruits, lesions were single or in groups of two or three, circular, small (1 to 3 mm), sunken, and dark brown to black. Lesions on ripe fruits were similar in shape and color, larger (10 to 15 mm), and when coalesced, they covered most or the entire surface. Elliptical, sunken lesions with lighter centers were also found on petioles and stolons, and blighted flowers and infected immature fruits became dark in color. Under wet conditions, salmon-colored masses of conidia were produced mainly on mature but also on unripe fruits, and on petioles and stolons. Conidia were hyaline, cylindrical, and attenuated at both ends measuring 11.5 (9.2 to 13.3) × 4.5 (4.2 to 5.0) µm (2). Colonies of the isolated fungus growing on potato dextrose agar were white with mycelium becoming gray and aerial. Symptoms were reproduced by artificial inoculation of healthy, ripe strawberry fruits. Fruits were wounded with a sterile scalpel, and 5-mm plugs of agar cultures of two isolates were placed on each wound (12 fruits per isolate). An equal number of wounded and noninoculated fruits were used as a control. Fruits were kept in a humidity chamber at 25°C, and 3 to 5 days later, necrotic sunken zones containing acervuli were observed around the wounds of inoculated fruits, and the pathogen was subsequently reisolated. Identical symptoms were obtained after inoculation of raspberry fruits. Intact strawberry stolons and stalks were also successfully inoculated in the lab with two additional isolates using the same technique and tightly covering wounds with adhesive tape. No symptoms were found in the controls of all tests. On the basis of symptoms and pathogen characteristics, the disease was confirmed as anthracnose (black spot) caused by Colletotrichum acutatum. Additionally, the identity of six isolates was confirmed as C. acutatum by species-specific polymerase chain reaction amplification resulting in a single fragment of 490 bp using primers ITS4 and CaInt2 (1). To our knowledge this is the first report of C. acutatum on strawberry in Bulgaria. References: (1) S. Freeman et al. Pathogenic and non-pathogenic lifestyles in Colletotrichum acutatum from strawberry and other plants. Phytopathology 91:986, 2001. (2) P. S. Gunnell, and W. D. Gubler. Taxonomy and morphology of Colletotrichum species pathogenic to strawberry. Mycologia 84:157, 1992.

First Report of Erwinia amylovora on Crataegus monogyna and Pyrus pyraster in Bulgaria.

Typical symptoms of fire blight, caused by Erwinia amylovora, were observed in late June of 1998 on Crataegus monogyna Jacq. (hawthorn) and Pyrus pyraster Burgsd. (syn. P. caucasia, wild or thorny pear) in the region of Plovdiv. Symptoms observed on hawthorn were shepherd's-crook shoots, necrotic flowers and fruitlets, and dried amber ooze droplets. On thorny pear, only infected shoots were detected. Isolation on King's B medium (2 days, 26°C) resulted in the appearance of whitish, glistening, rounded colonies. Based on their cultural characteristics, positive hypersensitive response (HR) on tobacco leaves, successful laboratory inoculations of hosts' shoots and pear fruitlets, positive serological reaction (slide agglutination), and target-specific polymerase chain reaction (PCR; 23S rDNA), the isolates from both species were placed in the E. amylovora group. The bacterium has also been isolated by the first author from Cydonia oblonga, Pyrus communis, Mespilus germanica, and Malus sylvestris within the 5-year period of 1989-1993 (1). To our knowledge this is the first official report of fire blight on C. monogyna and P. pyraster in Bulgaria. Reference: (1) S. G. Bobev. 1995. Pages 121-126 in: Jubilee Scientific Session, Higher Agricultural Institute of Plovdiv, vol. 3, bk. 1. (In Bulgarian.).

First Report of Phoma strasseri as a Pathogen of Stachys officinalis in Bulgaria.

For several years, a leaf spot disease has been observed on Betony, Stachys officinalis (synonym Betonica officinalis), in an experimental field in Kazanlak, Bulgaria. The round to somewhat angular spots (6 to 8 mm diameter) are dark brown with a pale center and have a chlorotic halo. A Phoma species isolated from the lesions formed regular to irregular, light brown colonies on potato dextrose agar (PDA). The isolate was studied as described by de Gruyter and Noordeloos (2). After 7 days, the growth rate was 43 mm on oatmeal agar and 33 mm on malt agar; the colonies were olivaceous gray-to-glauceous gray with a regular outline and with finely floccose, white-to-olivaceous gray aerial mycelium. Pycnidia, produced after 2 weeks, were ostiolate, globose to subglobose, 120 to 280 µm in diameter, citrine or honey, and later olivaceous to olivaceous black. The conidiogenous cells were globose to bottle shaped, 2 to 6 × 3 to 5 µm. The conidia were hyaline and unicellular, 5 to 7.5 × 2.5 to 4.2 µm, cylindrical to ellipsoidal with several small, scattered guttules. Chlamydospores were absent. According to these in vitro characters and after comparing the isolate with several Phoma isolates present in the culture collection of the Dutch Plant Protection Service, Wageningen, the Netherlands, the fungus has been identified as Phoma strasseri Moesz. The pathogenicity of the isolate was confirmed by artificial leaf inoculation of potted S. officinalis plants with a spore suspension (8 × 106 spores per ml) kept in a moist chamber for 48 h at a mean average temperature of 16°C. Leaf spots observed 4 to 5 days after inoculation were similar to those observed in the field. P. strasseri was subsequently reisolated from the spots. P. strasseri (synonym Phoma mentae Strasser) has been recorded as the cause of rhizome and stem rot on mint, Mentha spp., in Europe, Japan, and North America (3). In addition, this fungus has been found in New Zealand (strain identified at the Dutch Plant Protection Service, unpublished data). To our knowledge, this is the first report of P. strasseri on S. officinalis in Bulgaria. P. strasseri may produce septate conidia and, therefore, can be classified in Phoma section Phyllostictoides Zherbele ex Boerema (1). P. strasseri clearly differs from other Phoma species described on Lamiaceae: Phoma leonuri Letendre (Phoma section Plenodomus (Preuss) Boerema et al., pycnidia scleroplectenchymatous, conidia aseptate, 3.5 to 5.5 × 1.5 to 2.5 µm), Phoma dorenboschii Noordel. & de Gruyter (Phoma Sacc. section Phoma, conidia aseptate, 3 to 5.5 × 2 to 2.5 µm, producing dendritic crystals in vitro), and Phoma valerianae Henn. (Phoma Sacc. section Phoma, conidia aseptate, 2.5 to 4 × 1.5 to 2 µm). Occasionally P. strasseri has been isolated from other Lamiaceae, namely Monarda didyma (Dutch Plant Protection Service, unpublished data). There is also a report from Valeriana sp. (3). References: (1) G. H. Boerema. Mycotaxon 64:321, 1998. (2) J. de Gruyter and M. E. Noordeloos. Persoonia 15(1):71, 1992. (3) C. E. Horner. Plant Dis. Rep. 55:814, 1971.

First Report of Fire Blight Caused by Erwinia amylovora on Pyracantha coccinea in Bulgaria.

During late May and June of 2003, a fire blight epidemic occurred in southcentral Bulgaria on earlier reported hosts such as apple, pear, quince, and hawthorn (1). A new host was found when fire blight was also observed in mid-June on Pyracantha coccinea grown in the Plovdiv Region. Symptoms were necrotic flowers, shoots, petioles, and the presence of sticky ooze droplets mainly on the shoots. Isolations made from blighted Pyracantha coccinea flowers and shoots onto King's medium B (2 days at 25 to 26°C) yielded whitish, glistening, round bacterial colonies. Infiltration of the suspensions of three of the isolates into tobacco leaves resulted in a typical hypersensitive reaction. When Pyracantha coccinea and Cotoneaster sp. shoots were inoculated with these three isolates, typical fire blight symptoms were obtained. The pathogen was reisolated 2 weeks after inoculation from necrotic tissues (15 to 20 mm above and below the inoculation site), thereby fulfilling the Koch's postulates. No symptoms and bacteria were found within any of the shoots from the same plant species injected with sterile water. The identity of the isolates was also determined by conducting nested polymerase chain reaction (PCR) (2) and target-specific PCR (23S rDNA) (3). On the basis of the symptoms, cultural characteristics, and positive results in pathogenicity and PCR tests, the isolates were considered to be Erwinia amylovora. To our knowledge, this is the first report of fire blight on Pyracantha coccinea in Bulgaria. References: (1) S. G. Bobev et al. Plant Dis. 82:1283, 1998. (2) P. Llop et al. Appl. Environ. Microbiol. 66:2071, 2000. (3) M. Maes et al. Plant Pathol. 45:1139, 1996.