Low resolution structure and dynamics of a colicin-receptor complex determined by neutron scattering.

Proteins that translocate across cell membranes need to overcome a significant hydrophobic barrier. This is usually accomplished via specialized protein complexes, which provide a polar transmembrane pore. Exceptions to this include bacterial toxins, which insert into and cross the lipid bilayer itself. We are studying the mechanism by which large antibacterial proteins enter Escherichia coli via specific outer membrane proteins. Here we describe the use of neutron scattering to investigate the interaction of colicin N with its outer membrane receptor protein OmpF. The positions of lipids, colicin N, and OmpF were separately resolved within complex structures by the use of selective deuteration. Neutron reflectivity showed, in real time, that OmpF mediates the insertion of colicin N into lipid monolayers. This data were complemented by Brewster Angle Microscopy images, which showed a lateral association of OmpF in the presence of colicin N. Small angle neutron scattering experiments then defined the three-dimensional structure of the colicin N-OmpF complex. This revealed that colicin N unfolds and binds to the OmpF-lipid interface. The implications of this unfolding step for colicin translocation across membranes are discussed.

Three-dimensional model of human platelet integrin alphaIIb beta3 in solution obtained by small angle neutron scattering.

Integrin alphaIIbbeta3 is the major membrane protein and adhesion receptor at the surface of blood platelets, which after activation plays a key role in platelet plug formation in hemostasis and thrombosis. Small angle neutron scattering (SANS) and shape reconstruction algorithms allowed formation of a low resolution three-dimensional model of whole alphaIIb beta3 in Ca(2+)/detergent solutions. Model projections after 90 degrees rotation along its long axis show an elongated and "arched" form (135 degrees) not observed before and a "handgun" form. This 20-nm-long structure is well defined, despite alphaIIb beta3 multidomain nature and expected segmental flexibility, with the largest region at the top, followed by two narrower and smaller regions at the bottom. Docking of this SANS envelope into the high resolution structure of alphaIIb beta3, reconstructed from crystallographic and NMR data, shows that the solution structure is less constrained, allows tentative assignment of the disposition of the alphaIIb and beta3 subunits and their domains within the model, and points out the structural analogies and differences of the SANS model with the crystallographic models of the recombinant ectodomains of alphaIIb beta3 and alphaV beta3 and with the cryo-electron microscopy model of whole alphaIIb beta3. The ectodomain is in the bent configuration at the top of the model, where alphaIIb and beta3 occupy the concave and convex sides, respectively, at the arched projection, with their bent knees at its apex. It follows the narrower transmembrane region and the cytoplasmic domains at the bottom end. AlphaIIb beta3 aggregated in Mn(2+)/detergent solutions, which impeded to get its SANS model.

Neutron fibre diffraction studies of amyloid using H2O/D2O isotopic replacement.

The first neutron fibre diffraction studies of an amyloid system are presented. The techniques used to prepare the large samples needed are described, as well as the procedures used to isotopically replace H2O in the sample by D2O. The results demonstrate the feasibility of this type of approach for the pursuit of novel structural analyses that will strongly complement X-ray fibre diffraction studies and probe aspects of amyloid structure that to date have remained obscure. The approach is demonstrated using an amyloid form of the peptide NSGAITIG, but is equally applicable for the study of other systems such as Alzheimer's Aß peptide.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

The pentameric nucleoplasmin fold is present in Drosophila FKBP39 and a large number of chromatin-related proteins.

Nucleoplasmin is a histone chaperone that consists of a pentameric N-terminal domain and an unstructured C-terminal tail. The pentameric core domain, a doughnut-like structure with a central pore, is only found in the nucleoplasmin family. Here, we report the first structure of a nucleoplasmin-like domain (NPL) from the unrelated Drosophila protein, FKBP39, and we present evidence that this protein associates with chromatin. Furthermore, we show that two other chromatin proteins, Arabidopsis thaliana histone deacetylase type 2 (HD2) and Saccharomyces cerevisiae Fpr4, share the NPL fold and form pentamers, or a dimer of pentamers in the case of HD2. Thus, we propose a new family of proteins that share the pentameric nucleoplasmin-like NPL domain and are found in protists, fungi, plants and animals.

Common architecture of nuclear receptor heterodimers on DNA direct repeat elements with different spacings.

Nuclear hormone receptors (NHRs) control numerous physiological processes through the regulation of gene expression. The present study provides a structural basis for understanding the role of DNA in the spatial organization of NHR heterodimers in complexes with coactivators such as Med1 and SRC-1. We have used SAXS, SANS and FRET to determine the solution structures of three heterodimer NHR complexes (RXR-RAR, PPAR-RXR and RXR-VDR) coupled with the NHR interacting domains of coactivators bound to their cognate direct repeat elements. The structures show an extended asymmetric shape and point to the important role played by the hinge domains in establishing and maintaining the integrity of the structures. The results reveal two additional features: the conserved position of the ligand-binding domains at the 5' ends of the target DNAs and the binding of only one coactivator molecule per heterodimer, to RXR's partner.

Structural and functional analysis of the engineered type I DNA methyltransferase EcoR124I(NT).

The Type I R-M system EcoR124I is encoded by three genes. HsdM is responsible for modification (DNA methylation), HsdS for DNA sequence specificity and HsdR for restriction endonuclease activity. The trimeric methyltransferase (M(2)S) recognises the asymmetric sequence (GAAN(6)RTCG). An engineered R-M system, denoted EcoR124I(NT), has two copies of the N-terminal domain of the HsdS subunit of EcoR124I, instead of a single S subunit with two domains, and recognises the symmetrical sequence GAAN(7)TTC. We investigate the methyltransferase activity of EcoR124I(NT), characterise the enzyme and its subunits by analytical ultracentrifugation and obtain low-resolution structural models from small-angle neutron scattering experiments using contrast variation and selective deuteration of subunits.

Selective deuteration of tryptophan and methionine residues in maltose binding protein: a model system for neutron scattering.

We describe methods that have been developed within the ILL-EMBL Deuteration Laboratory for the production of maltose binding protein (MBP) that has been selectively labelled either with deuterated tryptophan or deuterated methionine (single labelling), or both (double labelling). MBP is used as an important model system for biophysical studies, and selective labelling can be helpful in the analysis of small-angle neutron scattering (SANS) data, neutron reflection (NR) data, and high-resolution neutron diffraction data. The selective labelling was carried out in E. coli high-cell density cultures using auxotrophic mutants in minimal medium containing the required deuterated precursors. Five types of sample were prepared and studied: (1) unmodified hydrogenated MBP (H-MBP), (2) perdeuterated MBP (D-MBP), (3) singly labelled MBP with the tryptophan residues deuterated (D-trp MBP), (4) singly labelled MBP with methionine residues deuterated (D-met MBP) and (5) doubly labelled MBP with both tryptophan and methionine residues deuterated (D-trp/met MBP). Labelled samples were characterised by size exclusion chromatography, gel electrophoresis, light scattering and mass spectroscopy. Preliminary small-angle neutron scattering (SANS) experiments have also been carried out and show measurable differences between the SANS data recorded for the various labelled analogues. More detailed SANS experiments using these labelled MBP analogues are planned; the degree to which such data could enhance structure determination by SANS is discussed.