Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 257
Filtrar
Más filtros

Bases de datos
Tipo del documento
Intervalo de año de publicación
1.
BMC Public Health ; 24(1): 453, 2024 Feb 13.
Artículo en Inglés | MEDLINE | ID: mdl-38350875

RESUMEN

BACKGROUND: Multimorbidity, the concurrent presence of two or more chronic conditions is an emerging public health challenge. Till date, most of the research have focused on the presence and interaction of selected co-morbidities in tuberculosis (TB). There exist a critical knowledge gap on the magnitude of multimorbidity among TB patients and its impact on health outcomes. METHODS: We undertook a cross-sectional study to assess the prevalence and patterns of multimorbidity among newly diagnosed TB patients in two states of India. A total of 323 patients were interviewed using a structured multimorbidity assessment questionnaire for primary care (MAQ-PC). MAQ-PC is already validated for Indian population and elicits 22 chronic conditions. We defined TB multimorbidity as the co-existence of TB with one or more chronic conditions and identified commonly occurring dyads (TB + single condition) and triads (TB + two conditions). RESULTS: More than half (52%) of TB patients reported multimorbidity. Among dyads, depression, diabetes mellitus (DM), acid peptic disease (APD), hypertension, chronic alcoholism, arthritis and chronic back ache (CBA) were the most common co-occurring conditions while 'DM + arthritis', 'depression + APD', 'depression + DM' were the most commonly occurring triads among TB patients. Factors such as increasing age, low levels of education, alcohol abusers, drug-resistant TB and having health insurance were significantly associated with multimorbidity among TB patients. CONCLUSIONS: Our findings suggest high prevalence of multimorbidity among newly diagnosed TB patients in India. The presence of concordant and discordant conditions with TB may increase the health complexity, thus necessitating appropriate care protocols. Given, the current situation, wherein TB and non-communicable diseases (NCD) services are delivered through collaborative framework between programmes, there is a need for addressing multimorbidity at the healthcare delivery level.


Asunto(s)
Artritis , Diabetes Mellitus , Tuberculosis , Humanos , Multimorbilidad , Estudios Transversales , Tuberculosis/epidemiología , Enfermedad Crónica , Prevalencia , India/epidemiología
2.
Physiol Mol Biol Plants ; 30(6): 957-967, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38974360

RESUMEN

Zingiber zerumbet Sm. (Family: Zingiberaceae) is an important perennial medicinal oil-bearing herb that is native to the Southeast Asia. This study examines the impact of different durations of post-harvest shade drying (ranging from 1 to 12 months) on essential oil yield and chemical composition of Z. zerumbet, in comparison to the freshly collected oil sample. This study explores how post-harvest shade drying impact the composition and longevity of Z. zerumbet rhizomes as well as its antimicrobial, antibiofilm activity. The oils were analyzed for their chemical composition analysis using a gas chromatography-flame ionization detector (GC-FID) and gas chromatography-mass spectrometry (GC-MS). The post-harvest periods of drying (1-12 months) were discovered to enhance the concentration of marker constituents in the oil. The primary constituent, Zerumbone, was detected in concentrations ranging from 69.38 ± 5.63% to a maximum of 80.19 ± 1.53% as the drying duration of the rhizome was extended. The output of the essential oil was not significantly affected by drying times; however, it did have a noticeable impact on the proportions of monoterpenes. Both disc diffusion and broth microdilution assay were used in freshly collected Z. zerumbet oil for its antimicrobial potential against S. aureus, L. monocytogens, S. hominis, Salmonella enterica serovar Typhimurium, P. aeruginosa, S. intermedius, E. coli, and C. albicans. For the first time, the oil reported to exhibit antibiofilm activity against S. aureus which was validated using fluorescence microscopy, and effectively disrupts the biofilm by 47.38% revealing that essential oil was able to disintegrate the clusters of the pathogen. Z. zerumbet rhizome oil is effective to reduce food-borne microorganisms. Therefore, its essential oil, a natural source of bioactive zerumbone, may improve flavor, aroma, and preservation.

3.
Am J Orthod Dentofacial Orthop ; 163(3): e84-e92, 2023 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-36635144

RESUMEN

INTRODUCTION: Various literature has verified that apical root resorption is a common adverse effect of orthodontic treatment, particularly intrusion. Conventional radiographic techniques underestimated root lengths and overestimated tooth lengths. Cone-beam computed tomography (CBCT) is a useful diagnostic tool to detect orthodontically induced external apical root resorption. This prospective study aimed to compare maxillary incisor intrusion and associated root resorption via CBCT. METHODS: Thirty patients aged 16-23 years, having a deepbite of 6-8 mm and excessive gingival display on smiling, were divided into 2 groups: group 1, with 15 patients who were treated with Burstone intrusion arch, and group 2 with 15 patients who were treated with mini-implants applying 100 g of intrusive force for 4 months with activation done every 4 weeks. During this 4-month study period, no treatment was performed other than the intrusion of incisors. CBCT scans were obtained before and after the intrusion phase of treatment to compare the amount of intrusion and associated root resorption among both groups. RESULTS: No significant difference was found in mean incisor intrusion between groups 1 and 2 (P = 0.772), with slightly more proclination of incisors in group 1, resulting in a significant (P = 0.018) increase in the vertical change of incisal edge in group 1. A statistically significant difference was found in root resorption among both groups (P = 0.004), with more root resorption in group 2. CONCLUSIONS: The results of this study indicate intrusion with both the intrusion systems using appropriate intrusive forces is effective in opening the bite with slightly more external apical root resorption in the mini-implant group.


Asunto(s)
Implantes Dentales , Resorción Radicular , Humanos , Resorción Radicular/etiología , Incisivo , Estudios Prospectivos , Tomografía Computarizada de Haz Cónico , Maxilar , Técnicas de Movimiento Dental/métodos
4.
Anim Genet ; 53(1): 68-79, 2022 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-34729794

RESUMEN

The live attenuated classical swine fever (CSF) vaccine has been successfully used to prevent and control CSF outbreaks for 6 decades. However, the immune response mechanisms against the vaccine remain poorly understood. Moreover, very few reports exist regarding the breed differences in the response to CSF vaccine. In this study, we generated the peripheral blood mononuclear cell transcriptomes of indigenous Ghurrah and commercial Landrace pig breeds, before and 7 days after CSF vaccination. Subsequently, between and within-breed differential gene expression analyses were carried out. Results revealed large differences in pre-vaccination peripheral blood mononuclear cell transcriptome profiles of the two breeds, which were homogenised 7 days after vaccination. Before vaccination, gene set enrichment analysis showed that pathways related to antigen sensing and innate immune response were enriched in Ghurrah, while pathways related to adaptive immunity were enriched in Landrace. Ghurrah exhibited greater immunomodulation compared to Landrace following the vaccination. In Ghurrah, cell-cycle processes and T-cell response pathways were upregulated after vaccination. However, no pathways were upregulated in Landrace after vaccination. Pathways related to inflammation were downregulated in both the breeds after vaccination. Key regulators of inflammation such as IL1A, IL1B, NFKBIA and TNF genes were strongly downregulated in both the breeds after vaccination. Overall, our results have elucidated the mechanisms of host immune response against CSF vaccination in two distinct breeds and revealed common key genes instrumental in the global immune response to the vaccine.


Asunto(s)
Peste Porcina Clásica/inmunología , Inmunidad Innata , Transcriptoma/inmunología , Vacunas Virales/administración & dosificación , Animales , Femenino , Especificidad de la Especie , Sus scrofa , Porcinos
5.
BMC Pulm Med ; 22(1): 407, 2022 Nov 09.
Artículo en Inglés | MEDLINE | ID: mdl-36352399

RESUMEN

PURPOSE: Uncontrolled severe asthma constitutes a major economic burden to society. Add-ons to standard inhaled treatments include inexpensive oral corticosteroids and expensive biologics. Nocturnal treatment with Temperature-controlled Laminar Airflow (TLA; Airsonett®) could be an effective, safe and cheaper alternative. The potential of TLA in reducing severe asthma exacerbations was addressed in a recent randomised placebo-controlled trial (RCT) in patients with severe asthma (Global Initiative for Asthma (GINA) step 4/5), but the results were inconclusive. We re-analysed the RCT with severe exacerbations stratified by the level of baseline asthma symptoms and Quality of Life. METHODS: More uncontrolled patients, defined by Asthma Control Questionnaire 7 (ACQ7) > 3, EuroQoL 5-Dimension Questionnaire Visual Analogue Scale (EQ5D-VAS) ≤ 65 and Asthma Quality of Life Questionnaire (AQLQ) ≤ 4 were selected for re-analysis. The rates of severe asthma exacerbations, changes in QoL and health-economics were analysed and compared between TLA and placebo. RESULTS: The study population included 226 patients (113 TLA / 113 placebo.) The rates of severe asthma exacerbations were reduced by 33, 31 and 25% (p = 0.083, 0.073, 0.180) for TLA compared to placebo, dependent on selected control measures (ACQ7, EQ5D-VAS, AQLQ, respectively). For patients with less control defined by AQLQ≤4, the difference in mean AQLQ0-12M between TLA and placebo was 0.31, 0.33, 0.26 (p = 0.085, 0.034, 0.150), dependent on selected covariate (AQLQ, EQ5D-VAS, ACQ7, respectively). For patients with poor control defined by ACQ7 > 3, the difference in EQ5D-5 L utility scores between TLA and placebo was significant at 9 and 12 months with a cost-effective ICER. The results from the original study did not demonstrate these differences. CONCLUSION: This post hoc analysis demonstrated an effect of TLA over placebo on severe exacerbations, asthma control and health economics in a subgroup of patients with more symptomatic severe allergic asthma. The results are consistent with the present recommendations for TLA. However, these differences were not demonstrated in the full study. Several explanations for the different outcomes have been outlined, which should be addressed in future studies. FUNDING: NIHR Health Technology Assessment Programme and Portsmouth Hospitals NHS Trust.


Asunto(s)
Antiasmáticos , Asma , Hipersensibilidad , Humanos , Corticoesteroides/uso terapéutico , Antiasmáticos/uso terapéutico , Asma/tratamiento farmacológico , Calidad de Vida , Temperatura
6.
Colorectal Dis ; 22(5): 562-568, 2020 05.
Artículo en Inglés | MEDLINE | ID: mdl-31713965

RESUMEN

AIM: Patients who undergo radical pelvic surgery often have problems with perineal wound healing and pelvic collections. While there is recognition of the perineal morbidity, there also remains uncertainty around the benefit of vertical rectus abdominus myocutaneous (VRAM) flaps due to the balance between primary healing and the complications associated with this form of reconstruction. This study aimed to evaluate factors associated with significant flap and donor site related complications following VRAM flap reconstruction for radical pelvic surgery. METHOD: A retrospective analysis of VRAM flap related complications was undertaken from prospectively maintained databases for all patients undergoing radical pelvic surgery (2001- 2017) in two cancer centres. RESULTS: In all, 154 patients were identified [median age 62 years (range 26-89 years), 80 (52%) men]. Thirty-three (21%) patients experienced significant donor or flap related complications. Major complications (Clavien-Dindo ≥ 3) related to the abdominal donor site occurred in nine (6%) patients, while those related to the flap or perineal site occurred in 28 (18%) patients. Only smoking (P = 0.003) and neoadjuvant radiotherapy (P = 0.047) were associated with the development of significant flap related complications on univariate analysis. Flap related complications resulted in a significantly longer hospital stay (P < 0.001). CONCLUSION: Careful patient selection is required to balance the risks vs the benefits of VRAM flap reconstruction. Immediate VRAM reconstruction in patients undergoing radical pelvic surgery can achieve early healing and stable perineal closure; it has a low but significant morbidity. Major flap related complications are significantly associated with smoking status and neoadjuvant radiotherapy and result in a prolonged length of hospital stay.


Asunto(s)
Colgajo Miocutáneo , Procedimientos de Cirugía Plástica , Adulto , Anciano , Anciano de 80 o más Años , Femenino , Humanos , Masculino , Persona de Mediana Edad , Morbilidad , Colgajo Miocutáneo/trasplante , Perineo/cirugía , Complicaciones Posoperatorias/epidemiología , Complicaciones Posoperatorias/etiología , Complicaciones Posoperatorias/cirugía , Procedimientos de Cirugía Plástica/efectos adversos , Procedimientos de Cirugía Plástica/métodos , Recto del Abdomen/trasplante , Estudios Retrospectivos
7.
Microb Pathog ; 130: 196-203, 2019 May.
Artículo en Inglés | MEDLINE | ID: mdl-30878620

RESUMEN

A total of 150 rhizobacteria and endorhizobacteria previously isolated from three different horticultural crops; strawberry, apple and apricot were screened for antagonistic activitiy against Clavibacter michiganensis ssp. michiganensis. Among them strain S1, exhibiting significantly higher antagonistic and plant growth promoting ability was characterized as Bacillus amyloliquefaciens based on morphological, biochemical and partial gene sequence analysis of 16S rRNA. B. amyloliquefaciens strain S1 showed maximum growth inhibition of C. michiganensis (12 mm). Moreover, B. amyloliquefaciens strain S1 exhibit significant phosphorus solubilization (94.16 %SEl) and indole acetic acid (27 µg ml-1) production under in vitro conditions. Antagonistic activity of Bacillus amyloliquefaciens strain S1 was compared with other four strains KU2S1, R2S(1), RG1(3) and AG1(7) against bacterial canker of tomato under net house conditions. Minimum bacterial canker disease incidence (30.0%) was recorded in B. amyloliquefaciens S1 followed by RG1(3) after 30 days of inoculation. The bio-control efficacy was higher in B. amyloliquefaciens S1 treated plants, followed by RG1(3).


Asunto(s)
Actinobacteria/crecimiento & desarrollo , Antibiosis , Bacillus amyloliquefaciens/crecimiento & desarrollo , Enfermedades de las Plantas/microbiología , Enfermedades de las Plantas/prevención & control , Solanum lycopersicum/microbiología , Bacillus amyloliquefaciens/clasificación , Bacillus amyloliquefaciens/genética , Bacillus amyloliquefaciens/aislamiento & purificación , Análisis por Conglomerados , ADN Bacteriano/química , ADN Bacteriano/genética , ADN Ribosómico/química , ADN Ribosómico/genética , Ácidos Indolacéticos/metabolismo , Fósforo/metabolismo , Filogenia , ARN Ribosómico 16S/genética , Análisis de Secuencia de ADN
8.
Rev Sci Tech ; 38(1): 135-144, 2019 May.
Artículo en Inglés | MEDLINE | ID: mdl-31564734

RESUMEN

Infectious diseases are known to disproportionately affect the poorer sectors of society, particularly those living in low- and middle-income countries. These vulnerable populations battle disease, debt, loss of livelihood and reduced economic well-being with consequences that extend to their families, communities, livestock and the environment. A strong One Health approach is acknowledged as a successful way of enhancing current capacity for the prevention and control of emerging infectious diseases. Furthermore, it is also an effective way to address the multifaceted nuances of poverty. In recognising the interconnectedness of human and animal health with the health of our shared environment, One Health offers a valuable framework to prevent and control emerging infectious diseases through collaboration, coordination and communication across the various sectors involved. In recent years, as examples of One Health implementation have been documented and assessed, the linkages between One Health interventions and poverty alleviation have become more obvious. One Health interventions have the potential to reduce the economic burden of disease and create more efficient systems and approaches that generate higher savings, both direct and indirect, at the human-animal-environment interface. This paper describes aspects of this potential in detail. Although, at present, examples of the relationship between One Health and poverty alleviation are few, they are compelling. The authors believe that they provide persuasive evidence to encourage governments and policy-makers to employ the One Health approach in their efforts to alleviate poverty. Measuring the impact of this link between One Health and poverty alleviation has its constraints since appropriate metrics are still evolving. However, this paper hopes to establish the wisdom of recognising the role that One Health can play in reducing poverty, as well as its capacity to enhance existing policy frameworks.


On sait que les secteurs les plus pauvres de la société subissent de manière disproportionnée l'impact des maladies infectieuses, en particulier dans les pays à revenu faible ou intermédiaire. Ces populations vulnérables sont confrontées à la maladie, à l'endettement, à la perte de leurs moyens de subsistance et à un déficit de bien-être économique dont les effets se perçoivent au niveau des familles et des communautés mais s'étendent également au bétail et à l'environnement. L'approche Une seule santé appliquée avec rigueur est reconnue comme un moyen efficace d'améliorer les capacités actuelles de prévention et de lutte contre les maladies infectieuses émergentes. Elle constitue également un outil puissant pour traiter les différents aspects plurifactoriels de la pauvreté. En prenant en compte l'interconnexion entre la santé humaine et animale et celle de notre environnement commun, Une seule santé fournit un cadre précieux pour prévenir et contrôler les maladies infectieuses émergentes à travers la mise en place d'une collaboration, d'une coordination et d'une communication transversales entre les différents secteurs concernés. Au cours de ces dernières années, l'évaluation et la collecte d'informations sur les exemples de mise en œuvre de l'approche Une seule santé ont fait ressortir les liens entre ces interventions et l'allègement de la pauvreté. Les interventions Une seule santé peuvent réduire le fardeau économique des maladies en créant des approches et des systèmes plus efficients qui permettent de réaliser des économies accrues, tant directes qu'indirectes, à l'interface homme­animal­environnement. Les auteurs décrivent en détail les différents aspects de ce potentiel. Les exemples du lien entre Une seule santé et l'allègement de la pauvreté sont encore peu nombreux mais ils sont probants. Les auteurs estiment apporter une démonstration suffisamment convaincante pour encourager les gouvernements et les décideurs politiques à recourir à l'approche Une seule santé dans le cadre de leurs initiatives de réduction de la pauvreté. La mesure de l'impact du lien entre Une seule santé et l'allègement de la pauvreté reste problématique en raison de l'évolution actuelle des méthodes d'évaluation appropriées. Néanmoins, les auteurs espèrent avoir établi le bien-fondé du rôle que peut jouer Une seule santé dans la réduction de la pauvreté ainsi que sa capacité d'améliorer les cadres politiques existants.


Se sabe que las enfermedades infecciosas afectan de forma desproporcionada a los sectores pobres de la sociedad, especialmente en los países de renta baja o mediana. Estas poblaciones vulnerables libran batalla a la enfermedad, las deudas, la pérdida de sus medios de vida y la merma de su bienestar económico con consecuencias que se extienden a su familia, su comunidad, su ganado y el medio ambiente. También está comprobado que una firme apuesta por la filosofía de Una sola salud es un expediente fructífero para mejorar la actual capacidad de prevención y control de enfermedades infecciosas emergentes. Se trata además de un medio eficaz para combatir la pobreza en sus múltiples facetas. Partiendo de la evidencia de la conexión recíproca existente entre salud humana, sanidad animal y el medio ambiente que todos compartimos, la noción de Una sola salud ofrece un valioso marco de referencia desde el que prevenir y combatir las enfermedades infecciosas emergentes gracias a la colaboración, coordinación y comunicación entre los distintos sectores interesados. De unos años a esta parte, a medida que se llevaban adelante y se describían experiencias de aplicación práctica de esta filosofía, ha ido quedando claro el nexo entre las intervenciones realizadas en clave de Una sola salud y la mitigación de la pobreza. Este tipo de intervenciones ofrecen la posibilidad de reducir el fardo económico que suponen las enfermedades y de propiciar sistemas y soluciones más eficaces y que generen un mayor ahorro, tanto directo como indirecto, en la interfaz del ser humano, los animales y el medio ambiente. Los autores describen en detalle una serie de aspectos del potencial que encierran esas intervenciones. Los ejemplos de la relación existente entre Una sola salud y la mitigación de la pobreza, aunque a día de hoy son contados, no dejan de resultar elocuentes. Los autores entienden que los datos expuestos son lo bastante convincentes como para alentar a gobiernos y planificadores de políticas a trabajar desde la óptica de Una sola salud para combatir la pobreza. Cuantificar los efectos de este nexo entre Una sola salud y mitigación de la pobreza no es tarea fácil, por cuanto las herramientas métricas necesarias aún están en plena gestación. Con todo, los autores esperan que el artículo avale la sabia conclusión de que los principios de Una sola salud pueden ser útiles para reducir la pobreza y también para perfeccionar los marcos de políticas existentes hoy en día.


Asunto(s)
Política de Salud , Salud Única , Pobreza , Animales , Control de Enfermedades Transmisibles , Países en Desarrollo/economía , Política de Salud/tendencias , Humanos , Ganado , Pobreza/prevención & control
10.
Allergy ; 72(6): 888-895, 2017 06.
Artículo en Inglés | MEDLINE | ID: mdl-27859399

RESUMEN

BACKGROUND: CD48 is a membrane receptor (mCD48) on eosinophils and mast cells and exists in a soluble form (sCD48). CD48 has a pivotal role in murine asthma and in the proinflammatory interactions of mast cells with eosinophils via its ligand CD244. Thus, CD48 might be important in human asthma. METHODS: Therefore, two separate cohorts (IL and UK) comprising mild, moderate, and severe asthma and healthy volunteers were evaluated for blood leukocyte mCD48 expression and sCD48 in serum. Asthmatic bronchial biopsies were immunostained for CD48. sCD48 effect on CD244-dependent eosinophil activation was evaluated. RESULTS: Eosinophil mCD48 expression was significantly elevated in moderate while downregulated in severe asthma. mCD48 expression on B, T, and NK cells and monocytes in severe asthma was significantly increased. sCD48 levels were significantly higher in mild while reduced in severe asthma. sCD48 optimal cutoff values for differentiating asthma from health were identified as >1482 pg/ml (IL) and >1619 pg/ml (UK). In asthmatic bronchial biopsies, mCD48 was expressed predominantly by eosinophils. sCD48 inhibited anti-CD244-induced eosinophil activation. CONCLUSIONS: mCD48 and sCD48 are differentially expressed in the peripheral blood of asthma patients of varying severity. sCD48 inhibits CD244-mediated eosinophil activation. These findings suggest that CD48 may play an important role in human asthma.


Asunto(s)
Asma/sangre , Antígeno CD48/análisis , Leucocitos/inmunología , Antígeno CD48/sangre , Eosinófilos , Humanos , Proteínas de la Membrana/inmunología , Índice de Severidad de la Enfermedad , Familia de Moléculas Señalizadoras de la Activación Linfocitaria , Solubilidad
11.
J Prev Med Hyg ; 58(4): E288-E293, 2017 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-29707659

RESUMEN

INTRODUCTION: Health promotion is an integral part of routine clinical practice. The physicians' role in improving the health status of the general population, through effective understanding and delivery of health promotion practice, is evident throughout the international literature. Data from India suggest that physicians have limited skills in delivering specific health promotion services. However, the data available on this is scarce. This study was planned to document the current health promotion knowledge, perception and practices of local primary care physicians in Odisha. METHODS: An exploratory study was planned between the months of January - February 2013 in Odisha among primary care physicians working in government set up. This exploratory study was conducted, using a two-step self-administered questionnaire, thirty physicians practicing under government health system were asked to map their ideal and current health promotion practice, and potential health promotion elements to be worked upon to enhance the practice. RESULTS: The study recorded a significant difference between the mean of current and ideal health promotion practices. The study reported that physicians want to increase their practice on health education. CONCLUSION: We concluded that inclusion of health promotion practices in routine care is imperative for a strong healthcare system. It should be incorporated as a structured health promotion module in medical curriculum as well.


Asunto(s)
Actitud del Personal de Salud , Competencia Clínica , Promoción de la Salud , Rol del Médico , Atención Primaria de Salud , Humanos , India , Encuestas y Cuestionarios
12.
Int J Cosmet Sci ; 38(4): 354-63, 2016 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-26610885

RESUMEN

OBJECTIVE: Sunscreens are commonly used to protect the body from damage caused by UV light. Some components of organic sunscreens have been shown to pass through the skin during wear which could raise toxicity concerns for these compounds. This study explores the potential for oils and fruit and vegetable juices to be substitutes for these compounds. METHODS: The absorptivity of various oils (canola oil, citronella oil, coconut oil, olive oil, soya bean oil, vitamin E, as well as aloe vera) and fruit and vegetable juices (acerola, beet, grape, orange carrot, purple carrot and raspberry) was measured in vitro. The mean absorptivity was compared with FDA-approved UV absorbers to gauge the potential of the natural products. The most promising candidates were incorporated into formulations, and the UV transmittance of a 20-µm-thick film of the formulation was measured. The formulations were also imaged by light microscopy and scanning electron microscopy. RESULTS: The absorptivity of oils was at least two orders of magnitude lower compared to the commercial UV blockers. The fruit juice powders were more effective at UV blocking but still showed an order of magnitude lower absorptivity compared to commercial UV blockers. CONCLUSION: The UV blocking from most natural oils is insufficient to obtain a significant UV protection. Formulations containing 50wt% purple carrot showed good UV-blocking capabilities and represent a promising ingredient for sunscreen and cosmetic applications.


Asunto(s)
Extractos Vegetales/uso terapéutico , Protectores Solares/uso terapéutico , Rayos Ultravioleta , Frutas/química , Microscopía Electrónica de Rastreo , Aceites de Plantas/química , Espectrofotometría Ultravioleta , Verduras/química
13.
HIV Med ; 16(10): 585-90, 2015 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-26238012

RESUMEN

OBJECTIVES: The antimalarial drug chloroquine (CQ) dampens the immune system and is used in the treatment of autoimmune disorders. CQ also shows antiviral activity against nonenveloped and enveloped viruses, including HIV-1. Persistent immune activation in chronic HIV-1infection leads to CD4 T-cell depletion. CQ is envisioned to attenuate immune activation and virus activity in HIV-1-infected patients. The role of CQ in immune activation and virus activity is discussed here. METHODS: To elucidate the effect of CQ on immune activation, a retrospective review of published clinical trials, in vivo experimental studies in animals, and the most relevant in vitro observations in HIV-1-infected cells, together with observations from our own laboratory studies, was carried out and the findings discussed. RESULTS: In a few clinical studies and animal experiments, CQ was ineffective in decreasing immune activation and HIV-1 infection. In vitro, CQ markedly increased HIV-1 infection in astrocytes and other non-CD4 cells. CONCLUSIONS: The use of CQ in HIV-1-infected patients is questionable. The evidence for a dampening of immune activation by CQ is inconclusive.


Asunto(s)
Antimaláricos/uso terapéutico , Autoinmunidad/efectos de los fármacos , Cloroquina/uso terapéutico , Infecciones por VIH/tratamiento farmacológico , VIH-1/efectos de los fármacos , Animales , Linfocitos T CD4-Positivos/inmunología , Ensayos Clínicos como Asunto , Infecciones por VIH/inmunología , Humanos
15.
J La State Med Soc ; 167(3): 149, 2015.
Artículo en Inglés | MEDLINE | ID: mdl-27159467

RESUMEN

BACKGROUND: Midgut neuroendocrine tumors (NETs) are rare malignancies with indolent clinical courses. In general, they are well-differentiated with most tumor cells in the G0 phase of the cell cycle, consistent with the poor response rate of NETs to chemotherapy in vivo. We hypothesize that insults, such as surgery, can drive NET cells from G0 into S phase and that biomarker analysis of individual patient tumors harvested and grown in the lab will provide useful practical guide for future intra and post-operative adjuvant therapy. METHODS: 97 well-differentiated midgut NET patients underwent cytoreductive surgery at our institution between May/2012 and October/2012. 148 surgical specimens were collected and submitted to a single commercial lab for processing. Primary tumors, lymph nodes and liver metastases were harvested and cultured. Their ribonucleic acids (RNA) were then extracted to analyze the expressivity, a total of 88 different biomarkers. Based on our patients' specific tumor biomarker expressivity and known correlations between 36 anti-neoplastic agents with their linked biomarkers, recommendations were reported as clinically beneficial or non-beneficial. RESULTS: A total of 148 specimens from 97 patients were tested. In four of the 97 patients, no clinically beneficial chemotherapy agent could be identified. Among the remaining 93 patients, the top three agents that are most likely to be clinically beneficial are: fluorouracil, cisplatin and carboplatin. These were reported to be clinically beneficial in 135/148 (91.2%), 103/148 (69.6%), and 103/148 (69.6%) patients respectively. CONCLUSIONS: Midgut NETs are slow growing tumors which are chemotherapeutically inert owing to the fact that most of the tumor cells are in G0 cell cycle. Surgical insult drives NET cells into active synthetic phase where they begin to express biomarkers specific to their tumor cells. Analysis of these biomarkers guides further potential beneficial therapy based on the current known associations among biomarkers and chemotherapy agents. These results must then be compared and confirmed against a direct in-vitro chemo sensitivity assessment conducted simultaneously on the same patients.

16.
J Food Sci Technol ; 52(3): 1808-13, 2015 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-25745261

RESUMEN

Rivina humilis L. (Phytolaccaceae) or pigeon berry accumulates betalains in its berries. It is reported that the berries are safe to consume, rich in nutrient content and exhibit efficient biological activity. In this report, Rivina berry extract was used as natural colorant in fruit spread and beverage to evaluate its effect on physicochemical properties and acceptability of the product. Results showed that 68 % color retained in Rivina banana spread after 6 months of storage at 5 °C, though there was reduction in L, a and chroma values. Rivina banana beverage lost redness completely during processing. Microbial analysis of the products indicated that they were safe for consumption. The spread had good overall sensorial quality and was liked by consumers indicating that addition of Rivina berry extract did not alter product quality.

17.
J Prev Med Hyg ; 55(2): 65-8, 2014 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-25916023

RESUMEN

OBJECTIVE: To study the knowledge and practice of hand washing among mothers and children of shikharchandi slum of Bhubaneswar, Odisha and to recommend possible measures to improve the current practices. METHODOLOGY: Present cross-sectional study was carried out in the Shikharchandi slum located in the Bhubaneswar city of Orissa state in India. 150 women and 80 children were interviewed. Children questionnaire were prepared to suit to their age and according to local context. Components of sanitation like food handling and hand washing were covered in this questionnaire. RESULTS: Hand washing before preparing food is being practiced by 85% of women. Of all women interviewed, 77% wash hands before serving food. Only 15% children said soap was available in their school to wash hands. Out of total children interviewed, 76% told that their teachers tell about sanitation and hand washing in the class. Only 5% children told they were consulted by doctor/health worker during last 3 months. As many as 81% children told that they wash their hands before taking food and 19% children said they take their food without washing hands. Though most of the children told that they wash hands before taking food, but only 17.5% told that they use soap for hand washing. Only 29% children told that their teachers check hand washing in school. When asked about critical timing of hand washing, 44% children told about at least two critical timings and 56% were unaware about the critical timings of hand washing. CONCLUSION: Inadequate knowledge on this among our study participant is a point of concern. Systematic integration of health and hygiene education in schools through curricular modifications could be an appropriate strategy.


Asunto(s)
Higiene de las Manos/estadística & datos numéricos , Conocimientos, Actitudes y Práctica en Salud , Madres/estadística & datos numéricos , Áreas de Pobreza , Adolescente , Adulto , Cuidadores/estadística & datos numéricos , Niño , Estudios Transversales , Femenino , Manipulación de Alimentos , Desinfección de las Manos , Humanos , India , Persona de Mediana Edad , Instituciones Académicas/estadística & datos numéricos , Jabones/provisión & distribución , Adulto Joven
18.
Plant Dis ; 97(3): 418, 2013 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-30722351

RESUMEN

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5'AACTGAAGAGTTTGATCCTGGCTC3' and PR:5'TACGGTTACCTTGTTACGACTT3', a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml-1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

19.
Indian J Clin Biochem ; 28(2): 193-6, 2013 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-24426209

RESUMEN

Growth retardation is one of the significant changes in chronic kidney disease (CKD) and is associated with increased morbidity and mortality. Disturbances in growth hormone (GH) are held responsible for several complications in CKD. GH is a protein based peptide hormone which directly or indirectly regulates renal functions to ensure homeostasis. We investigated the effects of growth hormone on plasminogen activators (PA) in rat kidney, PA and plasminogen activator inhibitor (PAI), glucose and fibrinogen in plasma and serum lipid profile. Rats were injected daily with 250 mU GH kg-1 body weight subcutaneously for one week. Growth hormone treatment increased PA activity significantly in rat kidneys as compared to controls. No changes were seen in PA, PAI and fibrinogen levels in the plasma of two groups of rats. There was significant decrease in plasma glucose, total cholesterol and LDL-cholesterol levels in serum of treated group resulting in the decrease of HDL/LDL and total cholesterol/cholesterol ratios. However, triglycerides and VLDL showed significant higher activity in the serum of treated group as compared to controls. Our data suggests that GH administration might improve renal function by increasing PA activity in kidney as well as by reducing the cholesterol content in blood. GH may be effective in improving growth failure as it helps to maintain the normal homeostatic balance.

20.
Respir Med ; 219: 107430, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37890639

RESUMEN

Many inhaler devices are currently used in clinical practice to deliver medication, with each inhaler device offering different benefits to overcome technique issues. Inhaler technique remains poor, contributing to reduced airway drug deposition and consequently poor disease control. Scoring inhaler technique has been used within research as an outcome measure of inhaler technique assessment, and this systematic review collates and evaluates these scoring methods. The review protocol was prospectively registered in PROSPERO (CRD42020218869). A total of 172 articles were screened with 77 included, and the results presented using narrative synthesis due to the heterogeneity of the study design and data. The most frequently used scoring method awarded one point per step in the inhaler technique checklist and was included in 59/77 (77%) of articles; however limited and varied guidance was provided for score interpretation. Other inhaler technique scoring methods included grading the final inhaler technique score, expressing the total score as a percentage/ratio, deducting points from the final score when errors were made, and weighting steps within the checklist depending on how crucial the step was. Vast heterogeneity in the number of steps and content in the inhaler technique checklists was observed across all device types (range 5-19 steps). Only 4/77 (5%) of the inhaler technique measures had undertaken fundamental steps required in the scale development process for use in real world practice. This review demonstrates the demand for a tool that measures inhaler technique and highlights the current unmet need for one that has undergone validation.


Asunto(s)
Enfermedad Pulmonar Obstructiva Crónica , Proyectos de Investigación , Humanos , Administración por Inhalación , Nebulizadores y Vaporizadores , Lista de Verificación , Enfermedad Pulmonar Obstructiva Crónica/tratamiento farmacológico
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA