Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 156
Filtrar
Más filtros

Bases de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Europace ; 26(2)2024 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-38289717

RESUMEN

AIMS: Sudden cardiac death (SCD) may occur in apparently healthy individuals, including athletes. The aim was to investigate the diagnostic role of post-mortem genetic testing, molecular autopsy (MA), in elucidating the cause of SCD in athletes. METHODS AND RESULTS: We reviewed a database of 6860 consecutive cases of SCD referred to our specialist cardiac pathology centre. All cases underwent detailed cardiac autopsy, and 748 were deemed to be athletes. Of these, 42 (6%) were investigated with MA (28 using a targeted sequencing, 14 exome sequencing). Variants were classified as pathogenic, likely pathogenic, or variant of unknown significance using international guidelines. Clinical information was obtained from referring coroners who completed a detailed health questionnaire. Out of the 42 decedents (average age 35 years old, 98% males) who were investigated with MA, the autopsy was in keeping with a structurally normal heart [sudden arrhythmic death syndrome (SADS)] in n = 33 (78%) cases, followed by arrhythmogenic cardiomyopathy (ACM) in eight (19%) individuals and idiopathic left ventricular fibrosis in one (2%). Death occurred during exercise and at rest in 26 (62%) and 16 (38%) individuals, respectively. Variants that were adjudicated clinically actionable were present in seven cases (17%). There was concordance between the genetic and phenotypic findings in two cases of ACM (in FLNC and TMEM43 genes). None of the variants identified in SADS cases were previously linked to channelopathies. Clinically actionable variants in cardiomyopathy-associated genes were found in five cases of SADS. CONCLUSION: The yield of MA in athletes who died suddenly is 17%. In SADS cases, clinically actionable variants were found in cardiomyopathy-associated genes and not in channelopathy-associated genes. Arrhythmogenic cardiomyopathy is a common cause of SCD in athletes, and one in four decedents with this condition had a clinically actionable variant in FLNC and TMEM43 genes.


Asunto(s)
Cardiomiopatías , Muerte Súbita Cardíaca , Masculino , Humanos , Adulto , Femenino , Muerte Súbita Cardíaca/etiología , Cardiomiopatías/diagnóstico , Cardiomiopatías/genética , Cardiomiopatías/complicaciones , Autopsia , Atletas , Sistema de Registros , Reino Unido/epidemiología
2.
Nutr Metab Cardiovasc Dis ; 34(5): 1283-1294, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38494368

RESUMEN

BACKGROUND AND AIMS: Vitamin D deficiency is a common cardiovascular risk factor associated with the development of atherosclerosis. We evaluated changes in 25(OH)D concentrations in 1510 patients with acute myocardial infarction (AMI) over a long observation period, including the COVID-19 pandemic. METHODS AND RESULTS: Patients were separated into four groups according to the year of enrolment, group 1 (2009-2010), group 2 (2014-2016), group 3 (2017-2019), and group 4 (2020-2022). The median 25(OH)D concentration in the overall cohort was 17.15 (10.3-24.7) ng/mL. The median plasma concentrations of 25(OH)D for groups 1, 2, 3, and 4 were 14.45 (7.73-22.58) ng/mL, 17.3 ng/mL (10.33-24.2), 18.95 (11.6-26.73) ng/mL and 19.05 (12.5-27.3) ng/mL, respectively. Although 25(OH)D levels increased over the years, the prevalence of vitamin D deficiency remained high in each group (68.4%, 61.4%, 53.8%, and 52% respectively). Hypovitaminosis D was predicted by the season influence (OR:2.03, p < 0.0001), higher body mass index (OR:1.25; p = 0.001), diabetes mellitus (OR:1.54; p = 0.001), smoking (OR:1.47; p = 0.001), older age (OR:1.07; p = 0.008), higher triglycerides levels (OR:1.02; p = 0.01), and female gender (OR:1.3; p = 0.038). After multivariable adjustment, vitamin D ≤ 20 ng/mL was an independent predictor of mortality. CONCLUSION: Vitamin D deficiency is highly prevalent and persistent in patients with AMI despite a trend towards increasing 25(OH)D concentrations over the years. The frequent lockdowns did not reduce the levels of 25(OH)D in the fourth group. Low levels of 25(OH)D are an independent predictor of mortality.


Asunto(s)
Infarto del Miocardio , Deficiencia de Vitamina D , Humanos , Femenino , Pandemias , Factores de Riesgo , Deficiencia de Vitamina D/diagnóstico , Deficiencia de Vitamina D/epidemiología , Vitamina D , Infarto del Miocardio/diagnóstico , Infarto del Miocardio/epidemiología , Italia/epidemiología
3.
Arch Toxicol ; 98(1): 135-149, 2024 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-38051366

RESUMEN

Sudden death could occur after assumption of illicit drugs for recreational purposes in adults or after intoxication in children, and toxicological testing would help identify the cause of the death. Analytical methods sensitive and specific for the quantification of a great number of drugs and metabolites in at least 2 matrices should be used. Bile, collected postmortem, may be considered a specimen alternative to blood and urine to perform toxicological testing because of its extended detection window. The present study proposed a LC-MS/MS method to quantify 108 drugs and metabolites in bile. Compounds belonging to the drugs of abuse classes of amphetamines, benzodiazepines, cocaine derivatives, barbiturates, opioids, z-drugs, and psychedelics were analyzed. The sample preparation is simple and does not require solid-phase extraction. The proposed method showed an appropriate selectivity, specificity, accuracy, and precision of the calibrators and quality controls tested (precision < 15%; accuracy < 100 ± 15%). The sensitivity allowed to identify low amounts of drugs (e.g., morphine limit of detection = 0.2 µg/L; limit of quantification = 1.1 µg/L). There is no significant matrix effect, except for buprenorphine and 11-Nor-9-carboxy-Δ9-tetrahydrocannabinol. Carry-over was not present. Analytes were stable at least for 1 month at - 20 °C. Analyzing 13 postmortem specimens, methadone (50%), and cocaine (37.5%) resulted to be the most prevalent consumed substances; the concentrations quantified in bile resulted to be higher than the ones in blood suggesting bile as a potential new matrix for identifying illicit drugs and their metabolites.


Asunto(s)
Cocaína , Drogas Ilícitas , Adulto , Humanos , Niño , Cromatografía Liquida/métodos , Cromatografía Líquida con Espectrometría de Masas , Bilis , Espectrometría de Masas en Tándem/métodos , Detección de Abuso de Sustancias/métodos , Toxicología Forense/métodos
4.
Arch Toxicol ; 2024 Jun 25.
Artículo en Inglés | MEDLINE | ID: mdl-38918214

RESUMEN

The toxicologist ascertains drug assumptions in case of paediatric intoxications and death for overdose. The analytical approach consists of initially screening and consequently confirming drug positivity. We developed a toxicological screening method and validated its use comparing the results with a LC-MS/MS analysis. The method identifies 751 drugs and metabolites (704 in positive and 47 in negative mode). Chromatographic separation was achieved eluting mobile phase A (10 mM ammonium formate) and B (0.05% formic acid in methanol) in gradient on Kinetex Phenyl-Hexyl (50 × 4.6 mm, 2.6 µm) with 0.7 mL/min flow rate for 11 min. Multiple Reaction Monitoring (MRM) was adopted as survey scan and, after an Information-Dependent Analysis (IDA) (threshold of 30,000 for positive and 1000 cps for negative mode), the Enhanced Product Ion (scan range: 50-700 amu) was triggered. The MS/MS spectrum generated was compared with one of the libraries for identification. Data processing was optimised through creation of rules. Sample preparation, mainly consisting of deproteinization and enzymatic hydrolysis, was set up for different matrices (blood, urine, vitreous humor, synovial fluid, cadaveric tissues and larvae). Cut-off for most analytes resulted in the lowest concentration tested. When the results from the screening and LC-MS/MS analysis were compared, an optimal percentage of agreement (100%) was assessed for all matrices. Method applicability was evaluated on real paediatric intoxications and forensic cases. In conclusion, we proposed a multi-targeted, fast, sensitive and specific MRM-IDA-EPI screening having an extensive use in different toxicological fields.

5.
Int J Mol Sci ; 25(7)2024 Mar 29.
Artículo en Inglés | MEDLINE | ID: mdl-38612632

RESUMEN

Bile has emerged as an alternative matrix for toxicological investigation of drugs in suspected forensic cases of overdose in adults and intoxications in children. Toxicological investigation consists in screening and, subsequently, confirming the result with specific techniques, such as liquid chromatography with tandem mass spectrometry (LC-MS/MS). As there is no screening test on the market to test postmortem bile specimens, the novelty of this study was in investigating the applicability of a chemiluminescence immunoassay, designed for other matrices and available on the market, on bile and validate its use, testing the agreement with LC-MS/MS analysis. Bile specimens were obtained from 25 forensic cases of suspected death from overdose and intoxication. Sample preparation for bile screening consists simply in centrifugation and dilution. Confirmation analysis allows simultaneous identification of 108 drugs and was validated on bile. Kappa analysis assessed a perfect agreement (0.81-1) between the assays for benzodiazepines, methadone, opiates, cocaine, oxycodone, cannabinoids, buprenorphine and pregabalin; a substantial agreement (0.41-0.6) was reported for barbiturates. No agreement was assessed for amphetamines, due to an abundance of putrefactive amines in postmortem specimens. In conclusion, this fast and easy immunoassay could be used for initial screening of bile specimens, identifying presence of drugs, except amphetamines, with reliability.


Asunto(s)
Bilis , Sobredosis de Droga , Adulto , Niño , Humanos , Cromatografía Liquida , Luminiscencia , Reproducibilidad de los Resultados , Espectrometría de Masas en Tándem , Anfetaminas
6.
Int J Mol Sci ; 25(5)2024 Feb 25.
Artículo en Inglés | MEDLINE | ID: mdl-38473914

RESUMEN

The study of aquaporins (AQPs) in various forensic fields has offered a promising horizon in response to the need to have reliable elements for the identification of the manner of death and for the individuation of forensic markers for the timing of lesions and vitality of injury. In the literature, various tissues have been studied; the most investigated are the lungs, brain, kidneys, skin, and blood vessels. A systematic literature review on PubMed following PRISMA 2020 guidelines enabled the identification of 96 articles. In all, 34 of these were enrolled to identify Aquaporin-like (AQP-like) forensic markers. The analysis of the literature demonstrated that the most significant markers among the AQPs are as follows: for the brain, AQP4, which is very important in brain trauma and hypoxic damage; AQP3 in the skin lesions caused by various mechanisms; and AQP5 in the diagnosis of drowning. Other applications are in organ damage due to drug abuse and thrombus dating. The focus of this review is to collect all the data present in the literature about the forensic application of AQPs as forensic markers in the most important fields of application. In the current use, the individuation, validation, and application of markers in forensic investigation are very useful in real forensic applications in cases evaluated in court.


Asunto(s)
Acuaporinas , Humanos , Acuaporinas/metabolismo , Pulmón/patología , Hipoxia/patología , Encéfalo/metabolismo , Piel/metabolismo
7.
Bioorg Chem ; 131: 106325, 2023 02.
Artículo en Inglés | MEDLINE | ID: mdl-36577221

RESUMEN

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.


Asunto(s)
Antineoplásicos , Complejos de Coordinación , Compuestos de Platino , Antineoplásicos/farmacología , Antineoplásicos/química , Cisplatino/química , Complejos de Coordinación/farmacología , Nucleósidos/farmacología , Nucleótidos , Compuestos de Platino/química , Compuestos de Platino/farmacología
8.
Int J Med Sci ; 20(6): 749-753, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37213668

RESUMEN

The forensic investigation of asphyxia deaths still poses a challenge due to the need to demonstrate vital exposure to hypoxic insult according to high levels of evidence. The pulmonary effects of hypoxia are complex and the understanding of the mechanisms underlying the acute pneumotoxicity induced by hypoxia is still incomplete. Redox imbalance has been suggested as the protagonist of the main acute changes in pulmonary function in the hypoxic context. The development of knowledge in biochemistry and molecular biology has allowed research in forensic pathology to identify some markers useful in immunohistochemical diagnostics of asphyxia deaths. Several studies have highlighted the diagnostic potential of markers belonging to the HIF-1α and NF-kB pathways. The central role of some highly specific microRNAs has recently been recognized in the complex molecular mechanisms involved in the hypoxia response; thus, several research activities are currently aimed at identifying miRNAs involved in the regulation of oxygen homeostasis (hypoxamiR). The aim of the manuscript is to identify, the miRNAs involved in the early stages of the cellular response to hypoxia, in order to characterize the possible implications in the forensic field of the determination of expression profiles. At present, more than 60 miRNAs involved in the hypoxia response with different expression profiles (upregulation and downregulation) have been identified. Despite the multiple and different effects on reprogramming following the hypoxic insult, the evaluation of the diagnostic implications of hypoxamiRs in the forensic field presupposes a specific treatment of the influences on HIF-1α regulation, cell cycle progression, DNA repair, and apoptosis.


Asunto(s)
Asfixia , MicroARNs , Humanos , Asfixia/patología , MicroARNs/metabolismo , Autopsia , Hipoxia/genética , Hipoxia/metabolismo , Pulmón/patología , Subunidad alfa del Factor 1 Inducible por Hipoxia/genética , Subunidad alfa del Factor 1 Inducible por Hipoxia/metabolismo , Hipoxia de la Célula/genética
9.
Int J Mol Sci ; 24(13)2023 Jun 29.
Artículo en Inglés | MEDLINE | ID: mdl-37446013

RESUMEN

In forensic medicine, identifying novel biomarkers for use as diagnostic tools to ascertain causes of death is challenging because of sample degradation. To that aim, a cohort (n = 26) of fatal traumatic brain injuries (TBIs) were tested for three candidate miRNAs (namely, miR-124-3p, miR-138-5p, and miR144-3p). For each case, three FFPE specimens (coup area (CA), contrecoup area (CCA), and the corpus callosum (CC)) were investigated, whereas the FFPE brain tissues of 45 subjects (deceased due to acute cardiovascular events) were used as controls. Relative quantification via the ∆∆Ct method returned significantly higher expression levels of the three candidate miRNAs (p < 0.01) in the TBI cases. No difference was detected in the expression levels of any miRNA investigated in the study among the CA, CCA, and CC. Furthermore, the analyzed miRNAs were unrelated to the TBI samples' post-mortem intervals (PMIs). On the contrary, has-miR-124-3p ahashsa-miR-144-3p were significantly correlated (p < 0.01) with the agonal time in TBI deaths. Since the RNA was highly degraded in autoptic FFPE tissues, it was impossible to analyze the mRNA targets of the miRNAs investigated in the present study, highlighting the necessity of standardizing pre-analytical processes even for autopsy tissues.


Asunto(s)
Lesiones Traumáticas del Encéfalo , MicroARNs , Humanos , MicroARNs/genética , Biomarcadores , Lesiones Traumáticas del Encéfalo/diagnóstico , Lesiones Traumáticas del Encéfalo/genética , Autopsia , ARN Mensajero
10.
Int J Mol Sci ; 24(19)2023 Sep 25.
Artículo en Inglés | MEDLINE | ID: mdl-37833964

RESUMEN

Cocaine abuse is a serious public health problem as this drug exerts a plethora of functional and histopathological changes that potentially lead to death. Cocaine causes complex multiorgan toxicity, including in the heart where the blockade of the sodium channels causes increased catecholamine levels and alteration in calcium homeostasis, thus inducing an increased oxygen demand. Moreover, there is evidence to suggest that mitochondria alterations play a crucial role in the development of cocaine cardiotoxicity. We performed a systematic review according to the Preferred Reporting Items for Systemic Reviews and Meta-Analysis (PRISMA) scheme to evaluate the mitochondrial mechanisms determining cocaine cardiotoxicity. Among the initial 106 articles from the Pubmed database and the 17 articles identified through citation searching, 14 final relevant studies were extensively reviewed. Thirteen articles included animal models and reported the alteration of specific mitochondria-dependent mechanisms such as reduced energy production, imbalance of membrane potential, increased oxidative stress, and promotion of apoptosis. However, only one study evaluated human cocaine overdose samples and observed the role of cocaine in oxidative stress and the induction of apoptosis though mitochondria. Understanding the complex processes mediated by mitochondria through forensic analysis and experimental models is crucial for identifying potential therapeutic targets to mitigate or reverse cocaine cardiotoxicity in humans.


Asunto(s)
Trastornos Relacionados con Cocaína , Cocaína , Animales , Humanos , Cardiotoxicidad/etiología , Cocaína/toxicidad , Corazón , Mitocondrias , Estrés Oxidativo
11.
Int J Mol Sci ; 24(15)2023 Jul 30.
Artículo en Inglés | MEDLINE | ID: mdl-37569597

RESUMEN

During pregnancy, reactive oxygen species (ROS) serve as crucial signaling molecules for fetoplacental circulatory physiology. Oxidative stress is thought to sustain the pathogenesis and progression of hypoxic-ischemic encephalopathy (HIE). A retrospective study was performed on the brains and placentas of fetuses and newborns between 36-42 weeks of gestation (Group_1: Fetal intrauterine deaths, Group_2: Intrapartum deaths, Group_3: Post-partum deaths, Control group sudden neonatal death); all groups were further divided into two subgroups (Subgroup_B [brain] and Subgroup_P [placenta]), and the study was conducted through the immunohistochemical investigations of markers of oxidative stress (NOX2, 8-OHdG, NT, iNOS), IL-6, and only on the brain samples, AQP4. The results for the brain samples suggest that NOX2, 8-OHdG, NT, iNOS, and IL-6 were statistically significantly expressed above the controls. iNOS was more expressed in the fetal intrauterine death (Group_1) and less expressed in post-partum death (Group_3), while in intrapartum death (Group_2), the immunoreactivity was very low. IL-6 showed the highest expression in the brain cortex of the fetal intrauterine death (Group_1), while intrapartum death (Group_2) and post-partum death (Group_3) showed weak immunoreactivity. Post-partum death (Group_3) placentas showed the highest immunoreactivity to NOX2, which was almost double that of the fetal intrauterine death (Group_1) and intrapartum death (Group_2) placentas. Placental tissues of fetal intrauterine death (Group_1) and intrapartum death (Group_2) showed higher expression of iNOS than post-partum death (Group_3), while the IL-6 expression was higher in the fetal intrauterine death (Group_1) than the post-partum death (Group_3). The AQP4 was discarded as a possible marker because the immunohistochemical reaction in the three groups of cases and the control group was negative. The goal of this study, from the point of view of forensic pathology, is to provide scientific evidence in cases of medical liability in the Obstetric field to support the clinical data of the timing of HIE.


Asunto(s)
Hipoxia-Isquemia Encefálica , Placenta , Humanos , Embarazo , Recién Nacido , Femenino , Placenta/patología , Estudios Retrospectivos , Interleucina-6 , Muerte Fetal/etiología , Mortinato , Encéfalo , Hipoxia-Isquemia Encefálica/patología , Estrés Oxidativo
12.
Small ; 18(41): e2204732, 2022 10.
Artículo en Inglés | MEDLINE | ID: mdl-36089668

RESUMEN

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.


Asunto(s)
Antineoplásicos , Nanopartículas , Ácidos Nucleicos de Péptidos , Antineoplásicos/química , Antineoplásicos/farmacología , Antígeno B7-H1 , Línea Celular Tumoral , Tierra de Diatomeas , Disulfuros , Ligandos , Nanopartículas/química , Oxidación-Reducción , Péptidos , Polietilenglicoles/química , Receptor de Muerte Celular Programada 1 , Dióxido de Silicio
13.
Int J Mol Sci ; 24(1)2022 Dec 21.
Artículo en Inglés | MEDLINE | ID: mdl-36613513

RESUMEN

Traumatic brain injury (TBI) is one of the first causes of death and disability in the world. Because of the lack of macroscopical or histologic evidence of the damage, the forensic diagnosis of TBI could be particularly difficult. Considering that the activation of autophagy in the brain after a TBI is well documented in literature, the aim of this review is to find all autophagy immunohistological protein markers that are modified after TBI to propose a method to diagnose this eventuality in the brain of trauma victims. A systematic literature review on PubMed following PRISMA 2020 guidelines has enabled the identification of 241 articles. In all, 21 of these were enrolled to identify 24 markers that could be divided into two groups. The first consisted of well-known markers that could be considered for a first diagnosis of TBI. The second consisted of new markers recently proposed in the literature that could be used in combination with the markers of the first group to define the elapsed time between trauma and death. However, the use of these markers has to be validated in the future in human tissue by further studies, and the influence of other diseases affecting the victims before death should be explored.


Asunto(s)
Lesiones Traumáticas del Encéfalo , Humanos , Lesiones Traumáticas del Encéfalo/metabolismo , Autofagia , Encéfalo/metabolismo
14.
Molecules ; 27(9)2022 May 07.
Artículo en Inglés | MEDLINE | ID: mdl-35566347

RESUMEN

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.


Asunto(s)
G-Cuádruplex , Ácidos Nucleicos , ADN/química , Genes myc , Glucósidos/farmacología , Simulación del Acoplamiento Molecular , Fitoquímicos , Proteínas Proto-Oncogénicas c-myc/metabolismo , Análisis Espectral , Estilbenos
15.
Forensic Sci Med Pathol ; 18(1): 4-19, 2022 03.
Artículo en Inglés | MEDLINE | ID: mdl-34463916

RESUMEN

This study involves the histological analysis of samples taken during autopsies in cases of COVID-19 related death to evaluate the inflammatory cytokine response and the tissue localization of the virus in various organs. In all the selected cases, SARS-CoV-2 RT-PCR on swabs collected from the upper (nasopharynx and oropharynx) and/or the lower respiratory (trachea and primary bronchi) tracts were positive. Tissue localization of SARS-CoV-2 was detected using antibodies against the nucleoprotein and the spike protein. Overall, we tested the hypothesis that the overexpression of proinflammatory cytokines plays an important role in the development of COVID-19-associated pneumonia by estimating the expression of multiple cytokines (IL-1ß, IL-6, IL-10, IL-15, TNF-α, and MCP-1), inflammatory cells (CD4, CD8, CD20, and CD45), and fibrinogen. Immunohistochemical staining showed that endothelial cells expressed IL-1ß in lung samples obtained from the COVID-19 group (p < 0.001). Similarly, alveolar capillary endothelial cells showed strong and diffuse immunoreactivity for IL-6 and IL-15 in the COVID-19 group (p < 0.001). TNF-α showed a higher immunoreactivity in the COVID-19 group than in the control group (p < 0.001). CD8 + T cells where more numerous in the lung samples obtained from the COVID-19 group (p < 0.001). Current evidence suggests that a cytokine storm is the major cause of acute respiratory distress syndrome (ARDS) and multiple organ failure and is consistently linked with fatal outcomes.


Asunto(s)
COVID-19 , Síndrome de Liberación de Citoquinas , Carga Viral , COVID-19/mortalidad , COVID-19/patología , Células Endoteliales , Humanos , Interleucina-15 , Interleucina-1beta , Interleucina-6 , SARS-CoV-2 , Factor de Necrosis Tumoral alfa
16.
Bioorg Chem ; 117: 105401, 2021 12.
Artículo en Inglés | MEDLINE | ID: mdl-34662754

RESUMEN

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.


Asunto(s)
Calcio/metabolismo , ADP-Ribosa Cíclica/análogos & derivados , ADP-Ribosa Cíclica/farmacología , Neuronas/efectos de los fármacos , Animales , Células Cultivadas , Neuronas/metabolismo , Ratas , Ratas Wistar
17.
Int J Mol Sci ; 22(5)2021 Mar 02.
Artículo en Inglés | MEDLINE | ID: mdl-33801394

RESUMEN

The evolution of antibacterial resistance has arisen as the main downside in fighting bacterial infections pushing researchers to develop novel, more potent and multimodal alternative drugs.Silver and its complexes have long been used as antimicrobial agents in medicine due to the lack of silver resistance and the effectiveness at low concentration as well as to their low toxicities compared to the most commonly used antibiotics. N-Heterocyclic Carbenes (NHCs) have been extensively employed to coordinate transition metals mainly for catalytic chemistry. However, more recently, NHC ligands have been applied as carrier molecules for metals in anticancer applications. In the present study we selected from literature two NHC-carbene based on acridinescaffoldand detailed nonclassicalpyrazole derived mono NHC-Ag neutral and bis NHC-Ag cationic complexes. Their inhibitor effect on bacterial strains Gram-negative and positivewas evaluated. Imidazolium NHC silver complex containing the acridine chromophore showed effectiveness at extremely low MIC values. Although pyrazole NHC silver complexes are less active than the acridine NHC-silver, they represent the first example of this class of compounds with antimicrobial properties. Moreover all complexesare not toxic and they show not significant activity againstmammalian cells (Hek lines) after 4 and 24 h. Based on our experimental evidence, we are confident that this promising class of complexes could represent a valuable starting point for developing candidates for the treatment of bacterial infections, delivering great effectiveness and avoiding the development of resistance mechanisms.


Asunto(s)
Antibacterianos/farmacología , Bacterias/efectos de los fármacos , Compuestos Heterocíclicos/farmacología , Metano/análogos & derivados , Plata/química , Antibacterianos/química , Catálisis , Células HEK293 , Compuestos Heterocíclicos/química , Humanos , Metano/química , Estructura Molecular
18.
Medicina (Kaunas) ; 57(2)2021 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-33535407

RESUMEN

Epidural hematomas (EDHs) and subdural hematomas (SDHs), or so-called extra-axial bleedings, are common clinical entities after a traumatic brain injury (TBI). A forensic pathologist often analyzes cases of traumatic EDHs or SDHs due to road accidents, suicides, homicides, assaults, domestic or on-the-job accidents, and even in a medical responsibility scenario. The aim of this review is to give an overview of the published data in the medical literature, useful to forensic pathologists. We mainly focused on the data from the last 15 years, and considered the most updated protocols and diagnostic-therapeutic tools. This study reviews the epidemiology, outcome, and dating of extra-axial hematomas in the adult population; studies on the controversial interdural hematoma are also included.


Asunto(s)
Lesiones Traumáticas del Encéfalo , Hematoma Epidural Craneal , Suicidio , Adulto , Lesiones Traumáticas del Encéfalo/complicaciones , Lesiones Traumáticas del Encéfalo/epidemiología , Hematoma Epidural Craneal/epidemiología , Hematoma Epidural Craneal/etiología , Hematoma Subdural/epidemiología , Hematoma Subdural/etiología , Humanos , Estudios Retrospectivos
19.
Int J Legal Med ; 134(4): 1345-1351, 2020 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-32367331

RESUMEN

Injection drug use-related infective endocarditis (IDU-IE) assumes peculiar epidemiological, pathogenetic, and prognostic characteristics that allow to consider it a distinct nosological entity, as well as a current problem of considerable social weight. Incidence is reasonably underestimated because diagnosis is often accidental in postmortem examination when drug-related death is suspected. In many cases, postmortem toxicological examinations are negative for acute drug abuse, and findings of infective endocarditis became relevant in the explanation of the mechanism of death. Extracardiac involvement of infective endocarditis is rarely reported as fatal. Fragmentation and embolization of bacterial vegetations can be associated with parenchymal infarcts, systemic spread of the infectious process by formation of an abscess. A case of septic shock as a consequence of the constant bacteremia determined by the continuous proliferation and release of bacteria into the circulation is presented in an injection drug user with left-sided endocarditis and widespread septic embolization. Authors reviewed forensic and medical literature and promote epidemiological value of medical and forensic autopsy. Extracardiac involvement of infective endocarditis may represent a remote and alternative cause of death in injection drug users, and an early diagnosis can be relevant for prognosis. Postmortem examination still represents a valuable opportunity of learning for clinicians and improving diagnostic accuracy with injection drug users. A call for changing of attitudes and practice toward autopsy is finally demanded.


Asunto(s)
Embolia/etiología , Endocarditis/complicaciones , Endocarditis/diagnóstico , Endocarditis/microbiología , Choque Séptico/etiología , Abuso de Sustancias por Vía Intravenosa , Autopsia , Causas de Muerte , Humanos , Masculino , Persona de Mediana Edad
20.
Mar Drugs ; 18(11)2020 Nov 19.
Artículo en Inglés | MEDLINE | ID: mdl-33228211

RESUMEN

In the effort to improve the antimicrobial activity of iminosugars, we report the synthesis of lipophilic iminosugars 10a-b and 11a-b based on the one-pot conjugation of both enantiomeric forms of N-butyldeoxynojirimycin (NBDNJ) and N-nonyloxypentyldeoxynojirimycin (NPDNJ) with cholesterol and a succinic acid model linker. The conjugation reaction was tuned using the established PS-TPP/I2/ImH activating system, which provided the desired compounds in high yields (94-96%) by a one-pot procedure. The substantial increase in the lipophilicity of 10a-b and 11a-b is supposed to improve internalization within the bacterial cell, thereby potentially leading to enhanced antimicrobial properties. However, assays are currently hampered by solubility problems; therefore, alternative administration strategies will need to be devised.


Asunto(s)
Antibacterianos/síntesis química , Antibacterianos/farmacología , Iminoazúcares/síntesis química , Iminoazúcares/farmacología , Staphylococcus aureus/efectos de los fármacos , Pruebas de Sensibilidad Microbiana , Estructura Molecular , Staphylococcus aureus/crecimiento & desarrollo , Relación Estructura-Actividad
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA